ID: 1100911758

View in Genome Browser
Species Human (GRCh38)
Location 12:99372171-99372193
Sequence CACATGTACCACTCTAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1048
Summary {0: 1, 1: 9, 2: 90, 3: 345, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100911758 Original CRISPR CACATGTACCACTCTAGTGG GGG Intronic
900079676 1:846486-846508 CAAATGCATCACTCTGGTGGGGG + Intergenic
901750141 1:11401513-11401535 CAAATGCACCACTCTGATGGGGG - Intergenic
901771780 1:11534274-11534296 CACACGCACCACTCCATTGGTGG + Intronic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
902908248 1:19575335-19575357 CATATGTACTGCTCTGGTGGCGG - Intergenic
903727731 1:25463954-25463976 CAAATGTACCACTCTGGTGGGGG - Intronic
904115262 1:28157050-28157072 CACATGTTTCACTCTAGTCCTGG - Intronic
904518589 1:31076494-31076516 CAAATGTACCATTCTGGTGCTGG + Intergenic
904521327 1:31098388-31098410 CAAATGTACCACTCTGATGGGGG - Intergenic
904763896 1:32827049-32827071 CAAATGTACCACTGTGGTGTAGG - Intronic
905020018 1:34803216-34803238 CAAATGTACCTCTCTGGTGGGGG - Intronic
905578777 1:39067482-39067504 CAAATGTACCACTGTAGTGTGGG - Intergenic
905813186 1:40928123-40928145 CAAATGTACCCCTCTAATGGAGG + Intergenic
905831054 1:41067843-41067865 GAAATGTACCACTCTGGTGGAGG + Intronic
906806372 1:48782718-48782740 CAGATATACCACTCTGGTGGGGG - Intronic
907149372 1:52269042-52269064 CAAGTGTACCACTCTGGTAGGGG - Intronic
907300187 1:53482094-53482116 CTCATGTACCAACCTGGTGGGGG - Intergenic
907547203 1:55272559-55272581 CAGATATACCACTCTGGTGCAGG - Intergenic
908238111 1:62166818-62166840 CAAATGTACCATTCTGGTGGAGG - Intergenic
908585892 1:65567859-65567881 CAAATGTACCACTCTGAGGGGGG - Intronic
908793723 1:67810450-67810472 TAAATGTACCACTCTGGTGTGGG + Intronic
908917289 1:69143464-69143486 CAAATGAACCACTCTGGTGGGGG + Intergenic
909471083 1:76028879-76028901 CAAATGTACCACTCTCGTGGAGG + Intergenic
909509164 1:76431781-76431803 CAAATGTACCACTCTGGGCGGGG - Intronic
909510367 1:76446284-76446306 CAAATATACCACTCTAGTAATGG - Intronic
909768919 1:79395175-79395197 CAAATGTACTACTTTGGTGGGGG + Intergenic
910097428 1:83539347-83539369 CAAATGTACCACTCTGGTGGGGG + Intergenic
910136126 1:83972062-83972084 AAAATGTATCACTCTGGTGGTGG - Intronic
910232531 1:85001002-85001024 CAAATGTACTACTCTGGTGTAGG - Intronic
910326021 1:86008010-86008032 CAAATGTGCCACTCTTGTAGAGG + Intronic
910489857 1:87756859-87756881 CAAGTGTACCAGTTTAGTGGGGG + Intergenic
910640953 1:89461399-89461421 CACAAGTGCCACTCTAGAGGAGG + Intergenic
910732142 1:90409688-90409710 CAAAGGTACCACTCTGGTGGGGG - Intergenic
910903345 1:92146407-92146429 CAAAGGTACCACTCCAGTGTGGG - Intronic
910978410 1:92932974-92932996 CATATGTACCACTCTGGTGAGGG + Intronic
911579206 1:99615983-99616005 CAAATGTACCACCCTGGTGCTGG + Intergenic
911664346 1:100537159-100537181 CAGACGAACCACTCTGGTGGGGG - Intergenic
911813739 1:102315809-102315831 CAAATGTACCACTCTTGTGAGGG + Intergenic
912010911 1:104961182-104961204 CAGTTGTACCACTCTGGTGGAGG + Intergenic
912367578 1:109147652-109147674 CGAATGTACCACTCTGGTGGGGG + Intronic
912660661 1:111526626-111526648 TAAATGTACCACTGTGGTGGGGG - Intronic
912677329 1:111695964-111695986 CAAATGTACCACTCTGGTGCAGG + Intronic
913092691 1:115490283-115490305 CAAATGTACCACTCTGATGTGGG + Intergenic
913132826 1:115857620-115857642 CACATATACCACTGTGGAGGAGG - Intergenic
913204550 1:116525015-116525037 AAAATGTACCACTCTGGTGAGGG - Intronic
913236978 1:116793683-116793705 CGAATGTACCACTCTGGTGGGGG - Intergenic
913462834 1:119106264-119106286 CAAATGTACCACTATGGTGTGGG - Intronic
914993990 1:152524305-152524327 CAAATGTACCACTCTGGTGGGGG - Intronic
915982785 1:160431919-160431941 CAAATGTACCACTCTGGTGGGGG + Intergenic
916004203 1:160644945-160644967 CAAATGTACCATCCTGGTGGGGG + Intronic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
916332993 1:163639105-163639127 CAAATGCACCACTCTGGTGGGGG - Intergenic
916949062 1:169760292-169760314 TAAATGTACCACTCTGGTGCGGG - Intronic
917063149 1:171062914-171062936 TAAATGTACTACTCTGGTGGGGG - Intronic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
917616360 1:176749395-176749417 CAAATGTACCACTCTGGTGGGGG - Intronic
917875684 1:179285002-179285024 CAAATGTACCAGTCAGGTGGGGG + Intergenic
918241778 1:182626623-182626645 CAAATGTACCCCTCTGCTGGGGG - Intergenic
918500559 1:185190274-185190296 CAAAGGTACCACTCCAGTGAAGG - Intronic
918534823 1:185562242-185562264 CAACTGTACCACTCTGGTGGGGG + Intergenic
918557614 1:185822248-185822270 CAAATGTACCACTCTGGTGGGGG + Intronic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
918833933 1:189435266-189435288 CAAATGTACAACTCCAGTGAGGG + Intergenic
918921768 1:190720989-190721011 CAAATGTGCCACTCTGGTGTAGG - Intergenic
918950992 1:191137286-191137308 CAAATGTAACACTCTGGTGGGGG + Intergenic
919153293 1:193727807-193727829 ACCATGTACCACTCTGGGGGGGG + Intergenic
919633473 1:199981633-199981655 CAAATGTACCACTCTGGTGGGGG - Intergenic
920507748 1:206528601-206528623 CAAATGTACCACTCTGGTGGGGG + Intronic
920805111 1:209225852-209225874 CAAATTTACCACTCTAGTTGGGG + Intergenic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
921243520 1:213212030-213212052 TAAATGTACCACTCTGGTGGGGG - Intronic
921254090 1:213323816-213323838 AAAATGTATCACTCTGGTGGGGG - Intergenic
921289507 1:213644319-213644341 CAAATGTACCTCTCTGGTGGGGG - Intergenic
921537197 1:216366347-216366369 CAAATATACCACTCTGGTGCAGG + Intronic
921582495 1:216911635-216911657 CAAATGTACCACTCTGGTAGGGG + Intronic
921802620 1:219418592-219418614 CAAATGTACTACTCTGGTGGAGG - Intergenic
921826637 1:219679349-219679371 CAAATGTACCACTCTGGTAGGGG + Intergenic
923022902 1:230178718-230178740 CAAATGTACCACTCTGTTGGGGG - Intronic
923247682 1:232148597-232148619 CAAATGTTCCACTCTGGTGCAGG + Intergenic
923252377 1:232189531-232189553 CAAATGGACCACTCTGGTGGAGG + Intergenic
923417027 1:233772959-233772981 CAAATGTACCATTCTGGTGGGGG - Intergenic
923456003 1:234166264-234166286 CAAATGGACCGCTCTGGTGGGGG - Intronic
923627430 1:235625381-235625403 CAAATGGACCACTCTGGTGCAGG - Intronic
923940756 1:238823114-238823136 CAAATGTATCACTCTAGTGGGGG + Intergenic
924378236 1:243435984-243436006 CAATTATACCACTCTGGTGGTGG - Intronic
924664604 1:246058265-246058287 CAAATGTCCCACTCTGGTAGAGG + Intronic
1063104616 10:2982085-2982107 CAAATGGACCGCTCTAGTGGGGG + Intergenic
1063650993 10:7936631-7936653 TAAATGTGCCACTCTGGTGGGGG - Intronic
1064789932 10:18946020-18946042 TAAATGTACTACCCTAGTGGGGG - Intergenic
1064826923 10:19414224-19414246 CACATGGAACACACTAGAGGGGG + Intronic
1065818638 10:29505718-29505740 CAAATGTGCCACTCTGGAGGGGG + Intronic
1065828550 10:29594458-29594480 CGTATGTACCACTCTAGTGGGGG + Intronic
1065954282 10:30678678-30678700 CAAATGTGCCACTCTGGAGGGGG - Intergenic
1066343039 10:34555157-34555179 CAAATGTTCCACTGTGGTGGGGG + Intronic
1066626759 10:37415078-37415100 CAAATGCACCACTCTGGTGGGGG + Intergenic
1067218353 10:44322541-44322563 CAGATGCACCACTGTGGTGGGGG - Intergenic
1067383656 10:45798546-45798568 TAAATGTACCACTCTGGTGCAGG + Intergenic
1067397450 10:45935420-45935442 CAAATGAACCACTCCGGTGGGGG + Intergenic
1067424624 10:46196638-46196660 CAGTTGTACCACTCTGGAGGAGG + Intergenic
1067466547 10:46503346-46503368 CACGTGTCCCACTCCAGTGTAGG - Intergenic
1067620641 10:47881259-47881281 CACGTGTCCCACTCCAGTGTAGG + Intergenic
1067865769 10:49904506-49904528 CAAATGAACCACTCTGGTGGGGG + Intronic
1067880523 10:50040255-50040277 TAAATGTACCACTCTGGTGCAGG - Intergenic
1067891358 10:50139113-50139135 TAAATGTACCACTCTGGTGCAGG + Intergenic
1068295270 10:55062779-55062801 CATATGTACCACTCTAGTGGAGG + Intronic
1068345424 10:55771741-55771763 CAGTTGTACCACTCTGGGGGAGG - Intergenic
1068590915 10:58852209-58852231 GAAATGTACCACTCTGGTGAGGG + Intergenic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1069796540 10:71056278-71056300 CAAATGTACCACTCTGGAGTGGG + Intergenic
1070204299 10:74241325-74241347 CAAATGTACCACTCTGGTGGGGG - Intronic
1070412864 10:76160066-76160088 CAATTGTGCCACTCTGGTGGGGG + Intronic
1070543785 10:77437008-77437030 AAAATGTTCCACTTTAGTGGAGG + Intronic
1071046998 10:81392239-81392261 CGAATGTACCACCCTAATGGTGG - Intergenic
1071585119 10:86812753-86812775 ACAATGTGCCACTCTAGTGGGGG - Intronic
1072201134 10:93159854-93159876 AAAATGTACCTCTCTAGTGGGGG + Intergenic
1072262114 10:93688545-93688567 CAAATGTACCCCTCTGGTGTGGG + Intronic
1072528122 10:96292757-96292779 CAAATGTACCACTCTGGTGGGGG - Intergenic
1072571455 10:96661486-96661508 CAAATGTGCCACTCTGGTGCTGG + Intronic
1072622096 10:97086948-97086970 CAAATGTACGGCTCTGGTGGGGG + Intronic
1072942264 10:99776731-99776753 CAAATGTACCACTCTGGTGGGGG - Intergenic
1073238835 10:102040302-102040324 AACAAATGCCACTCTAGTGGGGG + Intronic
1073638515 10:105224035-105224057 CAAATGTAACACTCTGGTGGAGG - Intronic
1073723926 10:106207984-106208006 CAAATGTACCACTCTCATGGGGG - Intergenic
1074054472 10:109909902-109909924 CAAATGTACTACTCTGGTTGGGG - Intronic
1074150147 10:110751993-110752015 CAAAAGTACCAGTCTGGTGGGGG - Intronic
1074522956 10:114241170-114241192 CAAATGTACCACTGCAGTGGGGG - Intronic
1074557143 10:114501786-114501808 CAAATGCACCACTCTGTTGGGGG - Intronic
1074821258 10:117180599-117180621 CAAATGTACCACTCAAGTGTGGG - Intergenic
1075447432 10:122523479-122523501 CTAATGTACCACTCTGGTGAGGG + Intergenic
1075501397 10:122978500-122978522 CAAATGTATCACTCTGGTGAAGG + Intronic
1076273125 10:129174078-129174100 CAAAAGTACCATTTTAGTGGGGG - Intergenic
1078947644 11:16088242-16088264 CAAATATACCACTCAGGTGGGGG - Intronic
1080338253 11:31224887-31224909 GAGATGTACCACTCTGCTGGTGG + Intronic
1080631649 11:34082604-34082626 CAAATGTACCACTCTGGTTGGGG - Intronic
1081459538 11:43259203-43259225 CAAACGTACCACTCTAGTTGGGG + Intergenic
1081839950 11:46192863-46192885 TAAATGTACCACTCTGGTGTGGG + Intergenic
1082192331 11:49261611-49261633 TGAATGTACCACTCTGGTGGGGG - Intergenic
1082721926 11:56688778-56688800 TAAATGTAACACTCTGGTGGGGG + Intergenic
1083093849 11:60229075-60229097 CAAATGTCCCACTCTGGTGGGGG + Intronic
1084283444 11:68115432-68115454 CAAATGTCCCATTCTGGTGGGGG + Intronic
1084924200 11:72498854-72498876 CAAATGTACCACTCTGGTGGGGG - Intergenic
1084991261 11:72927430-72927452 CAAATGTGCCACTCTGATGGGGG + Intronic
1085001205 11:73037234-73037256 TAAATGTACCACTGTGGTGGGGG - Intronic
1085113672 11:73911078-73911100 TAAATGTACCACTCTGGTGGGGG - Intronic
1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG + Intronic
1085753403 11:79183590-79183612 CAAATGTACCACTCTGGTTTGGG + Intronic
1085938376 11:81178316-81178338 CAGATGTACCACTCTGGTAGGGG - Intergenic
1086011039 11:82103776-82103798 CCAATGTACCACTCTGGTGCAGG + Intergenic
1086066738 11:82753670-82753692 CAAATGCACCACTCTGGTGGGGG + Intergenic
1086172984 11:83857723-83857745 CAAATGTACTTCTCTGGTGGAGG + Intronic
1086266224 11:85001803-85001825 CAAATGTACCACTCAGGTGAGGG + Intronic
1086361317 11:86062595-86062617 CAAATGTACCACTTTCGTGGGGG + Intronic
1086392254 11:86376754-86376776 CACATGTACCACTCCGGTGAGGG - Intronic
1086673794 11:89579348-89579370 TGAATGTACCACTCTGGTGGGGG + Intergenic
1087073132 11:94101554-94101576 CAAATGTACTACTCTGGTGGGGG - Intronic
1087097654 11:94335127-94335149 CAAATGTATCACTCTGGTGGGGG - Intergenic
1087173628 11:95075850-95075872 CAAATGCACCACTCTGGTGGAGG - Intergenic
1087289587 11:96305393-96305415 CAAACATACCACTCTGGTGGAGG + Intronic
1087365649 11:97215276-97215298 AACATGTACCACTGTGGTGAGGG + Intergenic
1087493575 11:98860176-98860198 CAAATGTAGCACTCCAGTTGAGG + Intergenic
1087803800 11:102533873-102533895 CAAATGTACCTCTCTGGTGAGGG + Intergenic
1087869569 11:103275297-103275319 CAAGTGTACCACTCTGGTGCAGG - Intronic
1087987558 11:104703479-104703501 CAAATGGACCACTCTGGTGGGGG - Intergenic
1088110535 11:106256039-106256061 AAAATGTACCACTCTGGTGAGGG + Intergenic
1088523329 11:110723728-110723750 CAAATATACCACTCTGGTGACGG - Intergenic
1088704121 11:112446244-112446266 CAAATGTACCACTCTGGTGAGGG - Intergenic
1088929752 11:114339795-114339817 CAAATGCACCACTCTGGTGGGGG + Intergenic
1089036715 11:115401839-115401861 CAAATGTACCACGCTGGTAGAGG + Intronic
1089394628 11:118128292-118128314 CCCATGTACCACTCTGGTGGGGG - Intergenic
1089438978 11:118498675-118498697 CAAATGCACCACTCTGGTGGGGG - Intronic
1090683474 11:129087778-129087800 CAAATGTACCACTGTGGTGTGGG + Intronic
1090768409 11:129896623-129896645 GAAATGTACCACTCTGGTAGAGG - Intergenic
1090921730 11:131212485-131212507 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1091342905 11:134833025-134833047 CAAATGGACCGCTCTAGTCGGGG + Intergenic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1092775337 12:11940161-11940183 CAAACGTACCACTCTGGTGCTGG + Intergenic
1093095313 12:14965100-14965122 CACATGGACCACTCCACAGGGGG - Intergenic
1093262426 12:16955391-16955413 CAAATGTACCACTTTGTTGGAGG + Intergenic
1093540955 12:20284318-20284340 CAAATGGCCCACTCTGGTGGGGG - Intergenic
1094091055 12:26650484-26650506 TAAATGTACCCCTCTAGTGGAGG + Intronic
1094321890 12:29193195-29193217 CAAATATACCACTCTTGTGTAGG - Intronic
1095522000 12:43077663-43077685 CAAATGTACCACTCTGGTGGGGG + Intergenic
1095522779 12:43086655-43086677 CAAATGTATCATTCTGGTGGTGG + Intergenic
1095825737 12:46529583-46529605 CAAATGTACCACTCTGCTGGGGG + Intergenic
1095862464 12:46933292-46933314 CAAATGTACCACCCTGGTGGGGG + Intergenic
1096307211 12:50488224-50488246 TAAATGTACCACTCTGCTGGAGG + Intergenic
1096321131 12:50613879-50613901 CCCATGTCCCACTAAAGTGGTGG + Intronic
1096564344 12:52464947-52464969 CAAATGTACCACTCTGGTGGGGG + Intergenic
1097912389 12:64984456-64984478 CAAATGTACCTCTCTGGTGGGGG + Intergenic
1098069362 12:66655429-66655451 CAAATGTACCACACTGGTGTGGG - Intronic
1098083951 12:66821047-66821069 CAACTGTACCACTTTGGTGGAGG + Intergenic
1098167778 12:67715793-67715815 AACATGGACCACTCCAGTGATGG + Intergenic
1098285284 12:68900995-68901017 CAAATGTACCACTCTGGTGGGGG + Intronic
1098656398 12:73035708-73035730 CAAATGTACCACTCTAGTGGAGG - Intergenic
1099017315 12:77359365-77359387 GAAATGTACCACTCTGGTGGAGG - Intergenic
1099087393 12:78262258-78262280 CCCCTGTTCCATTCTAGTGGGGG + Intergenic
1099127947 12:78789494-78789516 CAAATGTACCACATTAGCGGGGG - Intergenic
1099242398 12:80153500-80153522 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1099527800 12:83736789-83736811 CAAATGTACCACTCTGGTAAGGG + Intergenic
1099560047 12:84161426-84161448 CATATGTACCAATGTACTGGAGG - Intergenic
1100076430 12:90790168-90790190 CAGATGTACCACTCTGGTGGGGG + Intergenic
1100082819 12:90873983-90874005 CAAATGTACCACTCTGGTGGGGG + Intergenic
1100610950 12:96192161-96192183 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1101279001 12:103231256-103231278 TAAATGTACCACTCTGGTGGGGG - Intergenic
1101430961 12:104626808-104626830 CAAATGGACCACTTCAGTGGAGG - Intronic
1101649440 12:106661493-106661515 CAAATGTACTACTCTGGTGAGGG - Intronic
1102480034 12:113216578-113216600 CAAATGCACCACTCTGGTGGGGG + Intronic
1102896935 12:116605750-116605772 CAAATGTACCACTCTGGGGCAGG - Intergenic
1103295557 12:119883614-119883636 CAAATGTACCACCCTGGTGGAGG - Intergenic
1103364808 12:120374093-120374115 CAAATGTACCACTCTGGTGGGGG - Intergenic
1104203653 12:126616315-126616337 CACATGTAATACTCTTCTGGTGG + Intergenic
1105387860 13:19948726-19948748 AAAACGTACCACTCTGGTGGGGG + Intergenic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1105654259 13:22418465-22418487 CAAATGTACCACTCTGATGGAGG + Intergenic
1105670471 13:22607986-22608008 CAAATGCACCACTCCAGTGCAGG + Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1106631124 13:31474725-31474747 CACATACATCACTCTACTGGTGG - Intergenic
1106771269 13:32962916-32962938 TGAATGTACCACTCTGGTGGGGG - Intergenic
1106790342 13:33149240-33149262 AAAATGTACCAGTCTGGTGGGGG + Intronic
1106939268 13:34759178-34759200 CAAATGTCCCACTCTGGTGCTGG - Intergenic
1106970156 13:35130105-35130127 CAAATGTACCACTCTGGTGAGGG + Intronic
1107995356 13:45854022-45854044 CAAATGCACCCCTATAGTGGGGG - Intergenic
1108097216 13:46915721-46915743 ATAATGTACCACTCTGGTGGGGG - Intergenic
1108103381 13:46982477-46982499 CAAATGTACCACACGGGTGGGGG - Intergenic
1108243226 13:48488595-48488617 CAAATGCACCACTCTGGTGGGGG + Intergenic
1108316124 13:49239335-49239357 CAAATGCACCACTCTGGTGGGGG + Intergenic
1108457164 13:50628034-50628056 CAAATGTACCACCCTCGTGGGGG + Intronic
1108552798 13:51563437-51563459 CAAATGTACCACTGTGGTGGGGG + Intergenic
1109501519 13:63241937-63241959 CAAATATACTACTCTGGTGGGGG + Intergenic
1109563558 13:64080672-64080694 TAAATATACCACTCTGGTGGAGG - Intergenic
1110179904 13:72604256-72604278 CAAATGCACCACTCTGGTAGTGG + Intergenic
1110186689 13:72683290-72683312 CAAATGTATCACTTTGGTGGGGG - Intergenic
1110303925 13:73962522-73962544 CAAATGTACCACTGTCGTGCAGG + Intronic
1110314624 13:74091856-74091878 CATATGTACCACTCTGATAGGGG + Intronic
1110458602 13:75718590-75718612 CCAATGTACCCCTCTGGTGGGGG - Intronic
1110782284 13:79480702-79480724 CACATGTACCACTCTGAGGGGGG + Intergenic
1110884856 13:80619870-80619892 CACATATGCCACTGTGGTGGAGG - Intergenic
1110956918 13:81564428-81564450 CACACGTACCACTCTCATGGGGG - Intergenic
1111386467 13:87535358-87535380 CAAATGTACTACTCTGGTGGAGG + Intergenic
1111489102 13:88946047-88946069 AACATGGACCAATCTACTGGAGG + Intergenic
1111599963 13:90460401-90460423 CAACTGTACCACTCTGGTGGGGG - Intergenic
1111620021 13:90713326-90713348 CAAATGTGCCACTCAGGTGGGGG + Intergenic
1111729740 13:92058457-92058479 AAAATGTACCACTCTGGTGTGGG - Intronic
1112085784 13:96031090-96031112 TATATGTACCACACTAGTGAGGG + Intronic
1112188214 13:97148501-97148523 CAAATGTACCAGTCTTTTGGGGG + Intergenic
1112220085 13:97479756-97479778 CACATGCACCACTCTGGTGCAGG - Intergenic
1112407013 13:99130198-99130220 CAAATGTACCACTCTGGTAGGGG + Intergenic
1112500425 13:99938939-99938961 CAAATGCCCCACTCTGGTGGGGG + Intergenic
1112679416 13:101745303-101745325 CAAGTATACCACTCTAGTGCAGG - Intronic
1112681426 13:101769999-101770021 CAAATGCACCACTCTGGTGGGGG + Intronic
1112833330 13:103480219-103480241 TAAATGTACCACTCTGGTGGGGG + Intergenic
1112959741 13:105108841-105108863 CAAATGTACCACTTTGGTGGAGG - Intergenic
1113237593 13:108297764-108297786 CAAATGTATCACTCTGGTGGGGG - Intronic
1113237628 13:108298158-108298180 TAAATGTATCACTCTGGTGGGGG + Intronic
1114239425 14:20852631-20852653 CAACTGTATCACTCTGGTGGGGG + Intergenic
1114358604 14:21943513-21943535 CAAATGTACCACTCTGGTGGTGG - Intergenic
1114752177 14:25217387-25217409 CATATGTACCACTCTGTTGGGGG + Intergenic
1114764833 14:25359106-25359128 CAAATGTACCACTCTGGTGGAGG - Intergenic
1114846054 14:26323389-26323411 CAAATGCACCACTCTGGTGAGGG - Intergenic
1114920557 14:27322560-27322582 CAAATCTACCACTCTGGTGGTGG - Intergenic
1115093856 14:29611188-29611210 CAAATGTACCACTGTGGTGGGGG + Intronic
1115288070 14:31739611-31739633 CAAATAGACCACTCTGGTGGAGG - Intronic
1115733023 14:36292474-36292496 CACATGTACCACTCTGATGAGGG - Intergenic
1115833944 14:37376136-37376158 CAAATGTACCACTCTGGTGCAGG - Intronic
1115888102 14:37996043-37996065 CAAATGTACCACTGTGGTGAAGG - Intronic
1116093174 14:40334718-40334740 CAAATGTACCACTCTAACTGGGG + Intergenic
1116105124 14:40492842-40492864 CTGATGTACCATTCTGGTGGAGG - Intergenic
1116283554 14:42942663-42942685 CACATATATCACTGCAGTGGAGG + Intergenic
1116315565 14:43386999-43387021 AAAATGTACCATTCTGGTGGGGG + Intergenic
1116379231 14:44244581-44244603 CAAATGTACTACTCTGGTAGAGG + Intergenic
1116574967 14:46562036-46562058 TAAATGTACCACTCTGGTTGGGG + Intergenic
1116703868 14:48271549-48271571 CAAATGCACCACTTTTGTGGGGG + Intergenic
1116839944 14:49809940-49809962 CAAATGTACCGTTCTGGTGGGGG + Intronic
1117195303 14:53334267-53334289 CAAATGTAGCACTCTGGTGCAGG - Intergenic
1117226372 14:53664511-53664533 CAAATATACCACTCTGCTGGGGG + Intergenic
1117417484 14:55510562-55510584 CAAATGTACCACTCTGGTGATGG - Intergenic
1117505155 14:56394822-56394844 CCATTGTACCACTCTAGTGGGGG + Intergenic
1117801910 14:59453273-59453295 CAAATGTACCTCTCTGGTGGGGG + Intronic
1117943727 14:60996070-60996092 CAAATGTACCACTCTGGTGCAGG + Intronic
1118066165 14:62193078-62193100 CAAATGCACCACTCTGCTGGGGG - Intergenic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118177854 14:63460442-63460464 TATATGTACAACTCTAATGGGGG - Intronic
1118304320 14:64642031-64642053 CAAAAGTACCACTCTGGTGTGGG - Intergenic
1118608401 14:67520135-67520157 CAAATATACGACTCTGGTGGGGG - Intronic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1118749189 14:68794270-68794292 CATATGTTCCACTCCGGTGGGGG - Intronic
1119028948 14:71176434-71176456 CATATGTACCAGTCTGGTGGGGG - Intergenic
1119197737 14:72729964-72729986 CAAATGCACCACTCTAGTGGAGG + Intronic
1119303439 14:73589036-73589058 CAAATGTACCATTCTGGTGGGGG - Intergenic
1120118294 14:80646237-80646259 CTAATGTACCACTTTGGTGGGGG + Intronic
1120515898 14:85469785-85469807 TAAATGTATCACTCTGGTGGGGG + Intergenic
1120554639 14:85914622-85914644 CAAGTGTACCACTCTGATGGGGG - Intergenic
1120658499 14:87224810-87224832 CAAATGTACCACCCTGGTGGGGG + Intergenic
1120753775 14:88222588-88222610 CAAATGTACCAGTCTGGTGCGGG + Intronic
1120837513 14:89054744-89054766 CAAATGTACCACTCTGGCGGGGG + Intergenic
1120952568 14:90055630-90055652 CAAATGTACCGCTCTGTTGGGGG + Intergenic
1121150530 14:91629563-91629585 CAAATGTACCACTTTGGTGTGGG + Intronic
1121225234 14:92316932-92316954 CACTTCTACTACTCTGGTGGAGG + Intergenic
1121555998 14:94837793-94837815 CACATGTGCCACTCTGGAGGTGG - Intergenic
1122110465 14:99497045-99497067 CAAATGTACCACTTTGGTCGGGG - Intronic
1122706028 14:103622206-103622228 CGAATGTACCACACTAGTGCAGG + Intronic
1124122472 15:26900652-26900674 CATATGTGCCACTCTGGTTGGGG - Intronic
1124166602 15:27331751-27331773 CAAATGGACCACTCTGGTGGGGG + Intronic
1124402802 15:29364868-29364890 CAAATGCACCACTCTGCTGGCGG - Intronic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124681110 15:31731743-31731765 CAACTGGACCACTCTGGTGGGGG + Intronic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1125060340 15:35413026-35413048 CAAATGTACAACTCTAGCAGGGG + Intronic
1125242306 15:37589381-37589403 CATATGTACCACTCTGATGCAGG - Intergenic
1125278519 15:38019580-38019602 ATAATGTACCACTCTAGTGGGGG - Intergenic
1125330767 15:38580081-38580103 CAAATGCACCAGTCTGGTGGGGG + Intergenic
1126017422 15:44365880-44365902 CAAATGTACCACTTTGGTAGGGG + Intronic
1126408342 15:48345946-48345968 CAAATATACCACCCTGGTGGGGG - Intergenic
1126419192 15:48453694-48453716 CAAATGCACCACTCTGATGGAGG + Intronic
1126596258 15:50386984-50387006 CAAATGTACCGCTCTGGTGGGGG + Intergenic
1126632734 15:50754223-50754245 CAAATGTACCACTCTGCTGTGGG - Intronic
1127163115 15:56212545-56212567 CAACTGTACCACTCTAATGTAGG + Intronic
1127183972 15:56458400-56458422 CAAATGTACCAGTCTAATGGAGG - Intronic
1127641742 15:60922360-60922382 CAAATGTGCCACTCTGGTGGGGG + Intronic
1128023177 15:64411351-64411373 CAAATGTACCACTCTGGTGAGGG + Intronic
1128546119 15:68569088-68569110 CAAATGTACCACTTTGGTGGGGG - Intergenic
1128934612 15:71734686-71734708 CACATGTACCAGTCTGATGTGGG + Intronic
1129047986 15:72753954-72753976 CAAATGTACCACTCTGGTGCAGG + Intronic
1129094203 15:73185322-73185344 TAAATGTACCACTTTAGTGGGGG + Intronic
1129929421 15:79397935-79397957 CAAATATACCACTCTGGTGCAGG - Intronic
1130186269 15:81686615-81686637 CAAATGAACCACTTTGGTGGAGG + Intergenic
1130194657 15:81768161-81768183 CAAATGTACCATTCTGGTGGGGG + Intergenic
1130449838 15:84040275-84040297 CAAATGTACCATTCTGGTGGGGG - Intergenic
1130450812 15:84049991-84050013 CAAATGTACCACTCTGGCTGGGG - Intergenic
1130716378 15:86338942-86338964 CACTTGTAACCCTCTAGTAGAGG - Intronic
1131235646 15:90694506-90694528 TAAATGTAGCACTCTGGTGGGGG - Intergenic
1131633425 15:94204176-94204198 CACATATGCCACTCTTGTGGAGG + Intergenic
1131715084 15:95100680-95100702 CAAGTGTACCACTCCAGTGGAGG + Intergenic
1131790270 15:95957245-95957267 CAAATGTACCACTCTGATGAGGG + Intergenic
1132401763 15:101513497-101513519 CAAATGTACCACCATGGTGGGGG - Intronic
1135351096 16:21729446-21729468 CAAATGTACAACTTTGGTGGGGG - Intronic
1135433626 16:22409049-22409071 CAAAGGTAACACTCTGGTGGGGG - Intronic
1135529013 16:23236633-23236655 CTAATGTACCACTCTGGTGGGGG + Intergenic
1135662019 16:24305153-24305175 CAAATGTGCCATTCTGGTGGGGG + Intronic
1135778213 16:25275775-25275797 CAACTGTACCACTCTGGTGGGGG + Intergenic
1135847892 16:25935267-25935289 CCAACGTACCACTCTGGTGGGGG - Intronic
1136292179 16:29281598-29281620 TGAATGTACCACTCTAGTGAGGG - Intergenic
1137238642 16:46636253-46636275 CAAATGTATCACTCTGGTGGGGG + Intergenic
1137473164 16:48781003-48781025 CAGATGTACCGCTTTGGTGGGGG - Intergenic
1137692621 16:50440145-50440167 CAAATGTACCACTCTGGTGGGGG + Intergenic
1138398412 16:56725839-56725861 GAAATGTACCACTCTGGTGGGGG - Intronic
1138671912 16:58622316-58622338 AAAATGTACCACTCTAGTGGGGG + Intronic
1138897130 16:61220472-61220494 CAATTGTACCACTCTTGTGGGGG + Intergenic
1138983742 16:62301531-62301553 TAAATGTACCACTCTGGTGTGGG - Intergenic
1139119189 16:63994938-63994960 TACATGTAATACTCTAGTTGGGG - Intergenic
1139499959 16:67354706-67354728 CAAATGTACCACTCTGGGGCAGG - Intronic
1139837480 16:69850912-69850934 CAAATGTACCACTCTGGTGGGGG - Intronic
1140709274 16:77661374-77661396 CAAATATACCATTCTAGTGTGGG - Intergenic
1140998770 16:80288186-80288208 CAAAGGTACCACTTTGGTGGGGG + Intergenic
1141336489 16:83160229-83160251 CAAATGTACCACTCTGGTGGGGG + Intronic
1142098068 16:88255551-88255573 TGAATGTACCACTCTAGTGAGGG - Intergenic
1142785499 17:2218867-2218889 CAAATGTCCCACTCTGGTGTGGG + Intronic
1144245295 17:13356805-13356827 CAAATGTACCACCCTGGTGGAGG - Intergenic
1144583305 17:16472428-16472450 CCCACGTACCCCTCCAGTGGGGG - Intronic
1145289630 17:21533067-21533089 GCCATGGAGCACTCTAGTGGAGG + Exonic
1145408540 17:22633551-22633573 CAGTTGTACCACTCTAGGGGAGG - Intergenic
1146281349 17:31546802-31546824 CAGATGTACCACTCTAGTGGAGG - Intergenic
1147506510 17:41023002-41023024 AAAATGTATCACTCTAGTGGGGG - Intergenic
1147897947 17:43763719-43763741 CAAATGCACCACTCTGGTGGCGG - Intergenic
1148034468 17:44648465-44648487 CATATGTACCATTCTAGTGCAGG + Intergenic
1148222663 17:45874901-45874923 GAAATGTACCACTCTGGTGGGGG - Intergenic
1148234511 17:45959234-45959256 CAAGTGTACCACTCTGGTGCAGG - Intronic
1148387791 17:47247394-47247416 CAAATGTACCACTCTGGTGGGGG + Intergenic
1148398532 17:47331528-47331550 CAAATGTACCACTCTGGTACAGG - Intronic
1149314286 17:55423670-55423692 CAGATGTACCACACTGTTGGGGG + Intergenic
1149391373 17:56194780-56194802 CAAATGCACCACTCTGGTGAGGG + Intronic
1149954831 17:61037022-61037044 CACACGTACCACTCTGGTTGGGG - Intronic
1149961789 17:61117809-61117831 CAAATATACTACTCTGGTGGGGG - Intronic
1149999368 17:61423906-61423928 CAAATGTACCCCTCTGGTTGGGG + Intergenic
1150414679 17:64977028-64977050 CACAGGTCCCACGCTAGTGAGGG - Intergenic
1150433312 17:65136222-65136244 CAAATGGGCCACTCCAGTGGAGG + Intergenic
1150543117 17:66124072-66124094 CACATGTACCACTCAAGGGGTGG + Intronic
1150693189 17:67381893-67381915 CTCATTTAACACTCTGGTGGTGG + Intronic
1150796914 17:68246435-68246457 CACAGGTCCCACGCTAGTGAGGG + Intergenic
1150865849 17:68849346-68849368 CAAATGGGCCACTCTGGTGGGGG + Intergenic
1151080059 17:71319050-71319072 CAAATGTTCCACTCTGATGGAGG - Intergenic
1151233258 17:72699979-72700001 CAGAAGTACCACTCTGGAGGAGG - Intronic
1151516038 17:74596532-74596554 CAGATGTCCCACTCTGGTGGGGG - Intergenic
1151753999 17:76060716-76060738 CAAATGCACCCCTCTGGTGGGGG + Intronic
1151891506 17:76953406-76953428 CACATGGACCACTCTGGTAGGGG - Intergenic
1152383955 17:79957733-79957755 CATGTGTCCCACTCTGGTGGGGG + Intronic
1153169470 18:2299286-2299308 CAGATGTACCACTCTGGTGAGGG + Intergenic
1154319287 18:13332359-13332381 CAAATGTACCACTGTGGTGTGGG - Intronic
1154951117 18:21210782-21210804 CAAATGCACCGCTCTGGTGGGGG - Intergenic
1155383014 18:25245372-25245394 CAAATGTACCATTCTGGTGGGGG - Intronic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1155764413 18:29609634-29609656 CAAATGTACCACTCTGATGGAGG - Intergenic
1155856008 18:30835442-30835464 AAAATGTACCACTGTGGTGGGGG + Intergenic
1155995360 18:32325413-32325435 CAAATATACCACTCTGGTGCAGG + Intronic
1156131664 18:33983375-33983397 CAAATGTACCATTCTGGTGAGGG + Intronic
1156187635 18:34681758-34681780 CAAATATACCATTCTGGTGGAGG - Intronic
1156248555 18:35328227-35328249 CAAATATACCACTCTGGTGGGGG - Intergenic
1157037756 18:43996628-43996650 CAAATGTTCCACTCTAATGCAGG + Intergenic
1158534446 18:58295063-58295085 CAAACATACCACTCTGGTGGGGG - Intronic
1158730963 18:60022055-60022077 CAAGCGTACCACTCTGGTGGGGG - Intergenic
1158937333 18:62376560-62376582 CAAATGTACCACTCTAGTGGGGG - Intronic
1159146829 18:64465426-64465448 CAAATGTACCACTCTGGTAGAGG - Intergenic
1159608283 18:70498011-70498033 CACATGTACCACTCTGCTGGTGG - Intergenic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1161127140 19:2564453-2564475 CACCTGTACCACTCGGGAGGCGG + Intronic
1162075298 19:8182775-8182797 CCAATGCACCACTCTAGTGGCGG + Intronic
1162234891 19:9300986-9301008 CAAATTTACCACTCTGGTGGGGG + Intronic
1164765430 19:30762129-30762151 CAAATGTACCACACCAGTGCAGG - Intergenic
1164817193 19:31213606-31213628 CAAAGGTACCACCCTGGTGGGGG + Intergenic
1165613918 19:37182028-37182050 CAAATGTACCACTCTGAAGGGGG + Exonic
1165618750 19:37226304-37226326 TAAATGTACCACTCTGGTGGAGG - Intronic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
1166334472 19:42096831-42096853 CGCTTGTACCACTCTGGTTGGGG + Intronic
1167189681 19:47976068-47976090 CAAATGTTCCACTCTGGTGGAGG - Intronic
1167728301 19:51234231-51234253 CAAATGTACCACTCTGATGGGGG - Intronic
1167977384 19:53240877-53240899 CAAATGTACCACTGTGATGGGGG + Intronic
925562984 2:5218285-5218307 CAAATGTACCACTCCAGTGCAGG - Intergenic
926053608 2:9760591-9760613 CAAATGTACAACTCTGGTGGGGG - Intergenic
926780868 2:16470751-16470773 TAAATGTACCACTCTGGTGGGGG + Intergenic
926900276 2:17743540-17743562 CACATGTACCACGCTGATAGTGG - Intronic
926947663 2:18205761-18205783 GACATGTACCACTATGGTGCAGG - Intronic
927580079 2:24235519-24235541 CAAATGTACTGCTCTGGTGGGGG + Intronic
928366803 2:30709167-30709189 CACATGTGCCACTCTGGTGTGGG - Intergenic
929021665 2:37559570-37559592 TAAATGTACCACTCTGGTGTAGG + Intergenic
929095330 2:38258197-38258219 CACGTGTATCCCTCTTGTGGGGG - Intergenic
929651472 2:43683989-43684011 TAAATGTACCACTCTGGTGTTGG - Intronic
930241764 2:48942849-48942871 CACATGTGCCACTCTGGTGGGGG - Intergenic
930331697 2:49993587-49993609 CAAATGCACTACTCTAGTGGAGG + Intronic
930493000 2:52100347-52100369 CAAGTGTACCACTGTGGTGGGGG - Intergenic
931531921 2:63224935-63224957 CAGATGTACCATTCTAGAAGGGG + Intronic
931900790 2:66785656-66785678 CAAATGTACCACTCTGGTGGTGG + Intergenic
931965495 2:67529197-67529219 AACATGTACCACTGTGGTGCAGG + Intergenic
932470725 2:71953621-71953643 CAAATGTACCGCTCTGTTGGGGG - Intergenic
933493136 2:83014123-83014145 TAAATGTACCACTCTGATGGAGG + Intergenic
933853130 2:86386769-86386791 CAAATGTACCACTCTGGGGCAGG - Intergenic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
933865562 2:86513542-86513564 CAAATGTACCACTCTTGTGTGGG + Intronic
934100634 2:88649951-88649973 CAAATATACCACTCTGGTGTGGG - Intergenic
935209251 2:100924198-100924220 CTAATGCACCACTCTGGTGGGGG - Intronic
935257647 2:101326478-101326500 CAAATGTTCCACTCTGGTGGGGG + Intergenic
935501788 2:103849966-103849988 CAAATACACCACTCTGGTGGAGG + Intergenic
935853644 2:107250045-107250067 CAAATGTGCCACTCTGGTGGTGG - Intergenic
936085438 2:109464766-109464788 CACATGTACCACTTTGGTGTAGG - Intronic
936238238 2:110764689-110764711 CAAATATACCACTCTGGTGGGGG + Intronic
936620567 2:114092756-114092778 CAAACACACCACTCTAGTGGAGG - Intergenic
936919408 2:117672193-117672215 CAAATGTACCACTCTGGTGGGGG + Intergenic
937598069 2:123694225-123694247 CAATTGTACCACTCTAGTGGGGG + Intergenic
937806326 2:126149911-126149933 CAAATGTACTACTCTGGTGAGGG - Intergenic
937857066 2:126680085-126680107 TACATGCACAACTCCAGTGGGGG + Intronic
938722899 2:134082082-134082104 AGCATGTACCACTCTGGTGAGGG - Intergenic
938830301 2:135043557-135043579 CAAATGTACTACTCTGGTGCAGG - Intronic
939172230 2:138709482-138709504 CAAATGCACCACACTGGTGGGGG - Intronic
939664375 2:144932671-144932693 CAAATGTACCACTCTGGTGGGGG - Intergenic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
940425012 2:153521491-153521513 AACATGTACCACTCTGGTACGGG - Intergenic
940539760 2:154997242-154997264 CAAATGTACCATCCTTGTGGGGG + Intergenic
940714290 2:157201912-157201934 CAAATGTACCCCTCTGGTGTGGG + Intergenic
940768669 2:157817573-157817595 TACATGTACTACTCTGGTGTGGG + Intronic
941212381 2:162657104-162657126 CAAATGTACCAATCTGGTGCAGG - Intronic
941339173 2:164284842-164284864 CAAATGTACCACTTTGGTGCAGG + Intergenic
941816675 2:169802793-169802815 GAAATGTACCACTCTGGTGGGGG - Intronic
941837006 2:170034129-170034151 CAAATGTACCACACTGGTGGTGG - Intronic
941956221 2:171207560-171207582 CAGATGTACCACTGTGGTGTGGG + Intronic
942274586 2:174310773-174310795 CACATGTGCCACTGTGGAGGAGG - Intergenic
942287025 2:174429575-174429597 CAAATGTACCATTCTGGTGCTGG - Exonic
942504551 2:176627951-176627973 TAAATGTACCACTCTGGTAGGGG + Intergenic
942530884 2:176909110-176909132 CAGATGTACCCCTCTGATGGGGG + Intergenic
942761716 2:179406590-179406612 CAAAAGTACCACTCTGGTGGGGG - Intergenic
942919022 2:181348281-181348303 CAAACATACCACTCTGGTGGGGG + Intergenic
943089075 2:183352619-183352641 CAAATGCACCACTCTGGTGGGGG + Intergenic
943287915 2:186028275-186028297 CAAATGTACCACTCTGGCGCAGG + Intergenic
943329014 2:186536686-186536708 CATATGTACCACTCTGGTGCAGG - Intergenic
943509655 2:188808749-188808771 CAAATGTGTCACTCTGGTGGAGG + Intergenic
943816123 2:192258058-192258080 TACATGGACCACTCTGGTAGGGG - Intergenic
943952023 2:194142516-194142538 CAAATGTACCACTCTTGTATGGG - Intergenic
944461268 2:199953375-199953397 CAAATATACCACTCTAATGAGGG + Intronic
944482689 2:200174277-200174299 CAAATGTGCCACTCTGGTGGGGG - Intergenic
944559833 2:200925109-200925131 AACTTGTACCACTCAAGTGGAGG + Intronic
944870350 2:203904858-203904880 CAAATGTACCCCTCTGGTGGGGG - Intergenic
945061971 2:205917092-205917114 CAAATGTACCACTCTCATGGGGG + Intergenic
945536876 2:211028081-211028103 CAAATGTACCCCTTTGGTGGGGG - Intergenic
945798500 2:214394685-214394707 CACATGTGCCACTCTGGCAGGGG - Intronic
946671743 2:222112118-222112140 CAAATGTACAACTCTGGTGGAGG + Intergenic
946902002 2:224381726-224381748 CACATGTACCACTCTGATAAAGG + Intronic
947039285 2:225896824-225896846 CAGATGTACCACTCTACAAGGGG + Intergenic
947093290 2:226537738-226537760 CAAATGTACCACTCTGGAGTAGG - Intergenic
947416000 2:229897009-229897031 CAAATGTACCACTTCGGTGGGGG + Intronic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1169292756 20:4366658-4366680 CAAATGTACCACTCTGGTAGGGG - Intergenic
1169833957 20:9856804-9856826 CAAATGTACCACTCTGGTGAGGG + Intergenic
1170417036 20:16155656-16155678 CAAATGTACCACTCTAGTGGAGG + Intergenic
1170636279 20:18107517-18107539 CAAATGTACCACTTTGGTAGGGG - Intergenic
1170651481 20:18246512-18246534 CAAATGTGCGACTCTGGTGGGGG - Intergenic
1170689175 20:18596863-18596885 CAAATGCACCACTCTAGTGGTGG - Intronic
1170710384 20:18785521-18785543 CAAATGTATCACTCTGGTGTTGG - Intergenic
1170855875 20:20053379-20053401 CAAATGTACTGCTCTGGTGGAGG - Intronic
1170867531 20:20172736-20172758 CAAATGTTCCAATCTAGTGCTGG - Intronic
1171384518 20:24761137-24761159 CAAATGTATCACTCTAGTGTGGG + Intergenic
1172553796 20:35822933-35822955 TAAATGTACCACTCTGGTGCAGG - Intronic
1172580124 20:36040836-36040858 CAAATGTACCACTCTGGTCGCGG + Intergenic
1172616365 20:36288096-36288118 CGAATGTACCACTCTGGTGGTGG - Intergenic
1172703557 20:36866559-36866581 CACATGTGCCGCTCAATTGGAGG - Intergenic
1174010910 20:47448938-47448960 CAAATATACCACTCTGGTGCAGG + Intergenic
1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG + Intronic
1175011659 20:55744106-55744128 CACGTGTGCCACTCTGGTGCGGG + Intergenic
1175519707 20:59592399-59592421 CAGATGTACTGCTCTGGTGGGGG - Intronic
1177001118 21:15614474-15614496 CAAATGTACCACTCTCATGGGGG + Intergenic
1177325582 21:19584200-19584222 CCAATGTAGCACTCTGGTGGGGG - Intergenic
1177349654 21:19920580-19920602 CACATGTACCACTCTGATAGAGG + Intergenic
1177389427 21:20447948-20447970 CCAATGTATCACTCTCGTGGAGG - Intergenic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1177568610 21:22857095-22857117 TAAAGGTACCACTCTGGTGGGGG - Intergenic
1177669996 21:24212627-24212649 CAAATGCAGCACTCTGGTGGGGG + Intergenic
1177766083 21:25459085-25459107 CAAATGTACCATTCTGGTGCAGG + Intergenic
1178101702 21:29275875-29275897 CAAATGTACCACTCTGGTAGGGG - Intronic
1178381153 21:32110021-32110043 CAAATGTACTACTCTGATGGGGG + Intergenic
1178861054 21:36290090-36290112 CAAATGTACCACTCTGGTGCAGG + Intronic
1179300486 21:40104741-40104763 CAAATGCACCACTTTATTGGGGG + Intronic
1179348431 21:40583768-40583790 CAAATGTACCACTCTTGCGGGGG + Intronic
1180129612 21:45819195-45819217 CTCATGTACTGCTCTGGTGGCGG + Intronic
1181287848 22:21767292-21767314 CACATGTGGCTCTCTAGTGGAGG - Intronic
1181606760 22:23984686-23984708 ACCATGTGCCACTCTATTGGGGG + Intergenic
1181678704 22:24475748-24475770 CAAATGCACCACTCTGGTGCTGG - Intergenic
1181716616 22:24735305-24735327 CAAATGTACCACACTGGTAGGGG + Intronic
1182003481 22:26940078-26940100 CACATGTGCCTCTTTAGTAGAGG + Intergenic
1182003712 22:26941756-26941778 CACATGTGCCTCTTTAGTAGAGG - Intergenic
1182056530 22:27359907-27359929 CACGTGTACCACAGTGGTGGGGG - Intergenic
1183052760 22:35277807-35277829 CAAATGTACTAGTCTGGTGGGGG - Intronic
1183766450 22:39880519-39880541 CAAATGTACCACTTTGGTTGGGG + Intronic
1183818274 22:40322316-40322338 CAAATGCACCACTCTGGTGGAGG - Intronic
1185421902 22:50739395-50739417 CACAGGTACCACACATGTGGAGG + Exonic
949428848 3:3950492-3950514 CAAATGTACCACTCTGGTACAGG + Intronic
949451284 3:4188090-4188112 CACATGTGCTACTCTGGTGAGGG - Intronic
949693956 3:6672511-6672533 CAGATGTACCATTCTGGTGAGGG + Intergenic
949899998 3:8804867-8804889 CAAATGCACCACTCTGGTGGGGG + Intronic
950149745 3:10677584-10677606 TACATATATCACTCTGGTGGGGG + Intronic
950845683 3:16013577-16013599 CAATTGTACCACTCTGGTGTGGG - Intergenic
951244802 3:20328290-20328312 TAAATGTACCACTCTGGTGGGGG - Intergenic
951265805 3:20564914-20564936 CAAATGTACCAATCTTGTGTGGG - Intergenic
951361615 3:21731451-21731473 CAAATGTACCACTGTGGTGGAGG - Intronic
951367215 3:21798071-21798093 CAAATGTACCTCTCTGGTGGGGG + Intronic
951829685 3:26912231-26912253 CAAATGTACCACTGTGGTGCAGG + Intergenic
951905149 3:27698924-27698946 CAAATGTACCACTGTGGTGGGGG + Intergenic
951969028 3:28422155-28422177 CAAATGTACCACACCAGTGTGGG - Intronic
952566351 3:34663245-34663267 AAAATGTACCACTCTGGTGCAGG - Intergenic
952635027 3:35518823-35518845 TAAATGTACCACTCTGGTGGGGG - Intergenic
952779582 3:37082471-37082493 GAAATGTACCACTCTATTGTGGG - Intronic
952893265 3:38058766-38058788 CAAATGTATCTCTCTAGTGGGGG + Intronic
952917277 3:38256483-38256505 CAAATGTACTACTCTAGTGGGGG - Intergenic
953192661 3:40702109-40702131 CAAATGTACCACTGTGGTGCAGG - Intergenic
953577427 3:44124101-44124123 CCACTGTACCACTCTGGTGGGGG - Intergenic
953753389 3:45626773-45626795 CAAGTGTACCACTCTGGTGGGGG + Intronic
953779817 3:45857831-45857853 CACATGTACCATTCTGGTGGGGG - Intronic
953815957 3:46156707-46156729 AAAATGTACTACTCTGGTGGAGG - Intergenic
954555236 3:51512489-51512511 CAAATGTACCACTCTGTTGTAGG + Intergenic
955169780 3:56551926-56551948 CAAATGTACTACTCTAGTCGGGG - Intergenic
955479350 3:59373798-59373820 CAAATGTACCACTCTGGTGGGGG + Intergenic
955528960 3:59852477-59852499 CAAATGTACCAGTCTGGTGGGGG - Intronic
955677966 3:61469225-61469247 CAAATGTACCACTCTAGTGCAGG - Intergenic
955677980 3:61469350-61469372 TAGATGTACCACTCTGGTGCAGG - Intergenic
955877067 3:63502343-63502365 CAAATGCACTACTCTGGTGGGGG - Intronic
956035394 3:65085175-65085197 CAAATGTACCAGTCCGGTGGAGG - Intergenic
956115855 3:65917967-65917989 CAAATGTACCACCTTGGTGGGGG + Intronic
956861749 3:73331144-73331166 CAAATTGACCACTCTGGTGGGGG + Intergenic
956973264 3:74551427-74551449 CAAATGTACCACCCTGGTTGGGG - Intergenic
957005423 3:74940209-74940231 CAAATGTACCACTCTGATGTGGG + Intergenic
957413924 3:79876428-79876450 AAAATGTACCACTCTGGTGAAGG + Intergenic
957459987 3:80504071-80504093 AACATGTTCCACTCTGGTTGGGG - Intergenic
957664895 3:83215291-83215313 CAAATGCACCACTCTGGTGGGGG + Intergenic
957736260 3:84207321-84207343 CAAATGTAACACTCTGGTAGGGG + Intergenic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
958146136 3:89628106-89628128 CAAATGTACCATTCTGGTGGGGG + Intergenic
958264319 3:91420027-91420049 CACATGTACCAGTGTGGTGTGGG + Intergenic
958533603 3:95366585-95366607 CAAATGTACCACTCTGTTGGGGG - Intergenic
959112388 3:102137245-102137267 CATATGTACCACTCTGGTGTGGG - Intronic
959485124 3:106919847-106919869 CAAATGTACCACTTTGGTGGGGG + Intergenic
959771152 3:110098237-110098259 CAAATGTGCCACTCTGGTGGGGG - Intergenic
959778018 3:110192579-110192601 CAAATGTACCACTCTGGTAGGGG - Intergenic
960438154 3:117653060-117653082 CAAATGTACCACTTTGATGGTGG + Intergenic
960717360 3:120590010-120590032 CAAATGTACTAGTCTGGTGGAGG + Intergenic
960834112 3:121886734-121886756 CAAATGTGCCACTCTGGTGTGGG - Intergenic
960904555 3:122586751-122586773 CAAATGTACCACTCTGGCGCTGG - Intronic
961003498 3:123389622-123389644 CACATGTGCCGCTCTGCTGGGGG - Intronic
961026037 3:123558449-123558471 CAAATGTACTACTCTGGTTGGGG + Intronic
962658768 3:137579197-137579219 CAAGTGTACCACTCTACTGAGGG + Intergenic
962718142 3:138146060-138146082 CAAATGTACTACTCTGGTGGAGG + Intergenic
963015183 3:140817217-140817239 CAAATATACCACTCTGGTGGGGG + Intergenic
963587962 3:147217472-147217494 CAAATATACCACTCTGGTGTGGG + Intergenic
963731374 3:148976723-148976745 CAAATGTACCAGTCTGGTGAGGG - Intergenic
963824943 3:149943350-149943372 CAGATGGACCACTCTAGTGCAGG - Intronic
963824956 3:149943475-149943497 CAGATGTACCACTCTGGTGCAGG - Intronic
964361297 3:155899558-155899580 CAAATGTATCACTCTGGTGTGGG - Intronic
964413761 3:156426426-156426448 CAAATGTGCCACTCTGGTGAAGG - Intronic
964662876 3:159140102-159140124 CAAATGTACCACTCAGGTGTGGG - Intronic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
965181689 3:165412147-165412169 CAAATGTACCACTCTGATGTGGG + Intergenic
965426367 3:168528930-168528952 AAAATGTACCACTCTGGTGGAGG - Intergenic
965641524 3:170833760-170833782 CAAATGTACCACTCTGGTGGGGG - Intronic
965848827 3:172996603-172996625 CAAATATACCACTCTGGTGAGGG - Intronic
966249394 3:177846151-177846173 CAAATGCACCACTCTGGTGGGGG + Intergenic
966399367 3:179532682-179532704 CAAATATACCACTCTGGTGTGGG - Intergenic
966497554 3:180598487-180598509 CAAATGTACCACTCAGGTGGGGG + Intergenic
966635197 3:182125136-182125158 CACATTTCCTACTGTAGTGGAGG + Intergenic
966736545 3:183191286-183191308 CAAATGTGCCTCTCTGGTGGGGG - Intronic
966765342 3:183456928-183456950 CCCATGTACCATTCTGGTGTGGG - Intergenic
966949996 3:184807715-184807737 CTAATGTAGCACTCTGGTGGAGG - Intergenic
967110910 3:186293074-186293096 CAAATGTACCACTCTGGTGGGGG - Intronic
967806542 3:193719265-193719287 CACATGTACCACACTGGTGAGGG + Intergenic
967911109 3:194543224-194543246 CAAATGTACCATTGTGGTGGAGG - Intergenic
968044420 3:195616051-195616073 CAAATGTGCCACTCTGGTGGGGG - Intergenic
968060209 3:195722102-195722124 CAAATGTGCCACTCTGGTGGGGG - Intronic
968227351 3:196981873-196981895 CAAATGTACCACTCTGGTGCAGG + Intergenic
968527762 4:1072446-1072468 CACATGGACTGCTCTGGTGGAGG + Intronic
970319116 4:14858143-14858165 CAAATGTATCACTCTGGTGAGGG + Intergenic
970448523 4:16144304-16144326 CAAATGCACCACCCTGGTGGGGG + Intergenic
970762388 4:19506687-19506709 CAAATGCACCACTCTGTTGGGGG - Intergenic
971577535 4:28295042-28295064 CAAATGTATCACTCTGGTGAAGG + Intergenic
971630477 4:28986968-28986990 CAAATGCACCACTCTGGTAGGGG - Intergenic
971639701 4:29116656-29116678 CAAATTTACCACTCTGGTGGGGG - Intergenic
971752779 4:30672567-30672589 CAAATGTACCACTGTGGTGAGGG + Intergenic
971904668 4:32711002-32711024 CAAATGTACCAGTCTGGTGGGGG - Intergenic
971991723 4:33906739-33906761 CAAATGTACCACTCCGGTGGAGG + Intergenic
972036753 4:34532768-34532790 CAGATATGCCACTCTGGTGGAGG + Intergenic
972309129 4:37863734-37863756 CAAATGTATCACCCTGGTGGGGG - Intergenic
972445505 4:39139581-39139603 CAAATGTAGCACTCTGGCGGGGG + Intergenic
972460933 4:39301475-39301497 CAGATATACCACTGTGGTGGGGG + Intronic
972807263 4:42542067-42542089 CAAATGTACCACTCTGGTGGGGG + Intronic
972911915 4:43827674-43827696 CAAATATACCATTCTAGTGTAGG + Intergenic
974071731 4:57130149-57130171 CAAATGTACCACTTTGCTGGGGG - Intergenic
974394020 4:61311931-61311953 CAAATGTACCACTCTCATGTGGG + Intronic
974445825 4:61980104-61980126 CAAGTGTACCTCTCTGGTGGAGG - Intronic
974670936 4:65029081-65029103 CAAATATGCCACTCTGGTGGGGG - Intergenic
974843565 4:67324448-67324470 CAAATATACCACTCTGGTGAGGG + Intergenic
974854967 4:67450295-67450317 CAAATGTACCACTCTCTTGGGGG + Intergenic
975666134 4:76736873-76736895 CAAATGTACTACTCTGGTGGGGG - Intronic
975977110 4:80112112-80112134 CAAATATACTACTCTGGTGGGGG + Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976133406 4:81908994-81909016 CAAATGTACCACTCTGGTGCAGG + Intronic
976172646 4:82319937-82319959 CAAATGTACCATTCTAGTGCAGG + Intergenic
976357912 4:84141981-84142003 CAAATGTACCATTCTGGTGAAGG + Intergenic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977763358 4:100767130-100767152 CAAATGTACCACTCTGGTGAAGG + Intronic
977822196 4:101486068-101486090 CAAATGTACCACTGTGGTGCAGG - Intronic
977839167 4:101680817-101680839 CAAAGGTACTACTCTGGTGGGGG - Intronic
977940859 4:102857091-102857113 CAAATGTACCACACTAATGCAGG + Intronic
978026712 4:103885559-103885581 CAAATGTCCCACCCTGGTGGTGG + Intergenic
978033012 4:103958987-103959009 CAAATGTACCACTGTGGTGGGGG + Intergenic
978207377 4:106093947-106093969 CAAATGTACCACTCTGATGGGGG + Intronic
978243662 4:106547395-106547417 CATAGGTACCACTCTGGTGTGGG + Intergenic
978399990 4:108321262-108321284 CAAATGTACCCCTCTGCTGGGGG + Intergenic
978415642 4:108473063-108473085 TAAATATACCACTCTTGTGGGGG + Intergenic
978675698 4:111312788-111312810 CAAATGTACCACTCTGGTAATGG - Intergenic
978893771 4:113860369-113860391 CATATGTACCACTCTGGTGCTGG - Intergenic
978920048 4:114173191-114173213 CAAATGTACCACTCTGTTGGGGG - Intergenic
978998716 4:115189452-115189474 CAAATGTACCACTGTGGTTGGGG - Intergenic
979028811 4:115612614-115612636 TAAATGTACCTCTCTTGTGGGGG + Intergenic
979162938 4:117486801-117486823 CAAATGCACCACTCTGGAGGGGG - Intergenic
979532184 4:121780647-121780669 CAAATGTACAGCTCTGGTGGGGG - Intergenic
979560652 4:122097789-122097811 CAAAGGTACCACTCTGGTGGAGG - Intergenic
979706674 4:123727884-123727906 CAAATGTACCACTCTGGTGCAGG - Intergenic
979830373 4:125293209-125293231 CAAATTTACCACTCTGGTGGAGG + Intergenic
979991243 4:127378337-127378359 CAAATGTACCACTCTGGTGGGGG - Intergenic
980061127 4:128131186-128131208 CTAATGTATCACTCTAGTGCAGG + Intronic
980063782 4:128159584-128159606 CAAATGTACCACTGTGGTAGGGG - Intronic
980378897 4:131984826-131984848 CAAATGTACCCCTCTTGTTGGGG - Intergenic
980391074 4:132147408-132147430 CAAATCTACCACTCAAGTGCAGG + Intergenic
980533830 4:134089348-134089370 CGCATATAGCACTCTGGTGGAGG - Intergenic
980595605 4:134950453-134950475 CTAATTTACCACTCTAGTGCAGG + Intergenic
980600029 4:135010943-135010965 CAAATGTACCACTCTGGTGGGGG - Intergenic
981309103 4:143278769-143278791 CAAATGTGCCACTCTTGTAGGGG + Intergenic
981438206 4:144751068-144751090 CAAATGTACCTCTTTGGTGGGGG - Intergenic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
981509850 4:145544147-145544169 CAAATGTGCCACTCTGGTGGGGG + Intronic
981523063 4:145684643-145684665 CAAATGTACCACTGTGGTGGGGG + Intronic
982058613 4:151579292-151579314 CAAATGTAGCACTCTGGTAGGGG + Intronic
982125640 4:152181711-152181733 CAAATGTGCCACTCCAGTGGGGG - Intergenic
982188460 4:152827364-152827386 CGAATGTACCACTCTAGCGAGGG - Intronic
982429245 4:155303688-155303710 CAAATGTATCATTCTGGTGGGGG + Intergenic
982491247 4:156032148-156032170 CAGATGTACCACTCTGGTAGAGG - Intergenic
983074793 4:163312780-163312802 CAAATGTTCCACTCTGGTGTGGG - Intergenic
983110709 4:163745966-163745988 CAAATGTACCACTCTGGTGGGGG - Intronic
983580456 4:169304674-169304696 CAGATGTACCACTCTGTTGAAGG + Intergenic
984008546 4:174342924-174342946 TAAATGTACCACTTTGGTGGAGG - Intergenic
984027723 4:174564554-174564576 CAAATGTATCACTCTAGTGTAGG - Intergenic
984100126 4:175474313-175474335 CAAATGTACCACTCTGGTGGGGG + Intergenic
984114640 4:175664380-175664402 CAAATGTACCACTCTGGTGAGGG + Intronic
984313613 4:178097349-178097371 CAAATGTTTCACTCTTGTGGGGG + Intergenic
984404587 4:179311537-179311559 CAAATGTACCACTGTGGTGCGGG - Intergenic
985308093 4:188565759-188565781 CACATTTACCACTCTTGTGGGGG - Intergenic
985330440 4:188825873-188825895 CAACTGTACCATTCTGGTGGGGG - Intergenic
985953379 5:3240700-3240722 CAAATGTTCCACTCTGGTAGGGG - Intergenic
986021818 5:3811800-3811822 CTAATGAACCACTCTGGTGGGGG + Intergenic
986877422 5:12128336-12128358 CAATTGTACCACTTTGGTGGGGG + Intergenic
986942156 5:12966893-12966915 CACATGCACCATTCTAGTGAGGG - Intergenic
986951827 5:13097226-13097248 CTAATGTACCACTCAGGTGGGGG + Intergenic
987196705 5:15534124-15534146 CAAACATACCACTCTGGTGGGGG - Intronic
987265050 5:16244810-16244832 CAAGTGTACCTCTCTGGTGGGGG + Intergenic
987808359 5:22800505-22800527 CAAATGTACCACTCTTTTTGGGG - Intronic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988007555 5:25436693-25436715 AAAATGTAGCACTCTGGTGGGGG + Intergenic
988517897 5:31920398-31920420 CAAATGCACCACCCCAGTGGGGG - Intronic
988720665 5:33875369-33875391 CAAATGTACTACTCCGGTGGGGG + Intronic
989154488 5:38331203-38331225 CAAATGTACCACTCTGATAGGGG - Intronic
989277342 5:39604693-39604715 CAAATCTACCACTCTGGTGCAGG - Intergenic
989711865 5:44407945-44407967 CAAATGTACTACTCTGGTGCAGG + Intergenic
990173601 5:53082622-53082644 CAAATATACCACTCTTGTGCGGG - Intronic
990722806 5:58717005-58717027 CAAATGCACCACTCGGGTGGGGG + Intronic
990800357 5:59594920-59594942 AAAATGTACCACTTTTGTGGGGG + Intronic
990896789 5:60708342-60708364 CAAATGCACCACTGTGGTGGAGG - Intergenic
991149856 5:63355126-63355148 CAAATGTGCCACTCTGGTGGGGG - Intergenic
991338464 5:65577837-65577859 CAAATGGACCACTCTGGTGGGGG - Intronic
991699603 5:69304931-69304953 AAAATGTACCACTCTGGTGGGGG + Intronic
991707864 5:69376602-69376624 CAAATGTACTACTCTGGTGAGGG - Intronic
992033809 5:72751451-72751473 CAAATGCACCACTCTGGTGAAGG + Intergenic
992315945 5:75555096-75555118 CAAATGTACCCCTCTGGTGGGGG - Intronic
992495009 5:77283291-77283313 CAAATGTACCACTCTGGTGGGGG - Intronic
993348435 5:86815901-86815923 CAGTTGTACTATTCTAGTGGGGG + Intergenic
994306890 5:98215725-98215747 CGTATGTGCCACTCTAGTGTGGG + Intergenic
994611031 5:102039755-102039777 CAAGTATACCACTCTAGTGCAGG - Intergenic
994703513 5:103168631-103168653 CAAATGCACCATTCTTGTGGGGG - Intronic
995205468 5:109474997-109475019 CACATGTAGCAATATAGTGCTGG + Intergenic
995466488 5:112454565-112454587 CAAATGTACCACTCTGGTGGGGG - Intergenic
995576994 5:113547534-113547556 AAAATGTTCCACTCTGGTGGGGG + Intronic
995709091 5:115016499-115016521 CAAATGTCCCACTCTGGTGGGGG + Intergenic
995821351 5:116236855-116236877 CAAATGTACTACTCTGGTGGGGG + Intronic
995886055 5:116895102-116895124 CAAATGTACCACTGCAGTGGGGG - Intergenic
996026715 5:118654540-118654562 CAAATGTACCACTCCGGTGGGGG - Intergenic
996752166 5:126899870-126899892 CACATGTACCACTGTGGTGTGGG - Intronic
997054948 5:130431091-130431113 TGCATGTACCACTCTGGTGGGGG + Intergenic
997058356 5:130471251-130471273 CAAATATACCACTCAGGTGGGGG - Intergenic
997247504 5:132362948-132362970 CACAGTTACCACTCTAGTTCAGG + Intergenic
997406197 5:133648818-133648840 CCAATGTCCCACTCTTGTGGGGG - Intergenic
997871774 5:137512234-137512256 CAAATGTACCACTCTGGTAGGGG + Intronic
998187097 5:139988827-139988849 TGTATGTACCACTCTCGTGGGGG + Intronic
998259701 5:140620569-140620591 CAAATGTACTACTCTGGTGGGGG + Intergenic
998311115 5:141133336-141133358 CAAATGAACCACTCTGGTGGAGG + Intronic
998361883 5:141595358-141595380 CAAATGTACCACGCTAGTGGGGG + Intronic
998893077 5:146767686-146767708 CAAATGAACCACTGTGGTGGAGG - Intronic
999373570 5:151070973-151070995 AAAATCTACCACTCTGGTGGAGG + Intronic
999845439 5:155474464-155474486 CAAATCTACCACTCTTTTGGGGG - Intergenic
999846140 5:155482664-155482686 CAAATGTACCATTCTGGTGGTGG + Intergenic
1000002554 5:157152724-157152746 CAAATGAACCACTCTGGTGCAGG - Intronic
1000224770 5:159249904-159249926 CAAACGTACCACTCCAATGGGGG - Intergenic
1000423730 5:161066310-161066332 CAAATGTGCCACTCTGGTGAGGG - Intergenic
1001373719 5:171233928-171233950 CAAATGCACCACTCTAGTGGGGG + Intronic
1001501082 5:172234954-172234976 TGAATGTACCACTCTGGTGGAGG + Intronic
1001658246 5:173370693-173370715 CCCATCTCCCACTCTAGTGGTGG + Intergenic
1002084517 5:176764234-176764256 CAAATGCACCAGTCTGGTGGGGG - Intergenic
1003162573 6:3648880-3648902 CACATGAACAGCTCTAGGGGTGG + Intergenic
1003237247 6:4306597-4306619 CAAATGTGCCACTCTGGTGGAGG - Intergenic
1003358374 6:5397486-5397508 CAAGTGTACCACTCTGGTGGAGG + Intronic
1003522102 6:6867053-6867075 CAAATGGACCACTGTGGTGGGGG - Intergenic
1003843157 6:10143538-10143560 CAAATGTGCCACTCTGGTGGGGG + Intronic
1004471480 6:15933374-15933396 CAAATGCACCATTCTGGTGGGGG - Intergenic
1004952010 6:20683666-20683688 CAAATGTACCATTCTGATGGGGG - Intronic
1005523046 6:26617003-26617025 CAAATGTACCACTCTGGTACAGG + Intergenic
1005728811 6:28675866-28675888 CAAATGTACCACTTTGGTGCAGG + Intergenic
1005823168 6:29614868-29614890 CAAATGTACCACTCTGGCGGAGG + Intronic
1006421575 6:33937466-33937488 CACATGTACCACTCTGGTGCAGG - Intergenic
1006642301 6:35495726-35495748 CACATGTTCCACCCCAGTGCTGG - Intronic
1006873144 6:37271465-37271487 CAAATGTACCACTGTGGTGGCGG + Intronic
1006992629 6:38228451-38228473 CAAATGTACCACTCTGGTGGAGG + Intronic
1007365006 6:41385073-41385095 CAAATGTGCCACTCCAGTGCAGG - Intergenic
1007830571 6:44635199-44635221 CAAATGTAGCACTCCAGTGGGGG - Intergenic
1008169038 6:48179744-48179766 CAAATGGACCAGTCTGGTGGGGG + Intergenic
1008991124 6:57602959-57602981 CACATGTACCAGTGTGGTGTGGG - Intronic
1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG + Intergenic
1010375534 6:75164686-75164708 CAAATGTACCACTTTGGTGAAGG - Intronic
1010649100 6:78429921-78429943 CAAATACGCCACTCTAGTGGAGG - Intergenic
1010828676 6:80503960-80503982 CAAATATACCACTCTGGTGCAGG + Intergenic
1011031428 6:82928086-82928108 CAAATGTACCAATCTGGTGAGGG + Intronic
1011169274 6:84487987-84488009 CAAATGTACCACTCTGATGGGGG + Intergenic
1011350508 6:86417915-86417937 CAAATGTACCACTTTGGTGGAGG - Intergenic
1011658295 6:89571720-89571742 CAAATGTATCACTCTGGTGGCGG - Intronic
1011741460 6:90364682-90364704 CAAATGCACCTCTTTAGTGGTGG + Intergenic
1011880309 6:92015816-92015838 CAAATGTACTACTCTGGTGGGGG - Intergenic
1012090228 6:94883477-94883499 CAAATATACCACTCTAGTCTGGG - Intergenic
1012310068 6:97712660-97712682 CAAAAGTACCACTCTGGTAGAGG - Intergenic
1012328246 6:97951157-97951179 CAAATGTACCATTCTAGTGTGGG - Intergenic
1012385587 6:98678323-98678345 TAAATGTACCACTCTGGTGGGGG + Intergenic
1012418311 6:99034060-99034082 CAAATGTACCACTCTGGTGGGGG + Intergenic
1013306739 6:108854688-108854710 CCAATGTACCACTCTGGTGGGGG - Intronic
1013517751 6:110904086-110904108 CAAACGTGCCACTCTGGTGGGGG - Intergenic
1013544637 6:111144025-111144047 CAAATGTACTACTCTGGTGGGGG + Intronic
1013566607 6:111370818-111370840 CACATGTACCACTCTGGTAGGGG - Intronic
1014156275 6:118113431-118113453 TAAATGTACCACTCTGGTGGTGG + Intronic
1014171511 6:118283967-118283989 CACTTCTACCACGCTAGAGGGGG + Intronic
1014324287 6:119972529-119972551 CATATGTACCACTCTGGTGGTGG + Intergenic
1014404393 6:121031473-121031495 CATATGTACCTCACTAATGGAGG + Intergenic
1014701047 6:124688429-124688451 CAAATGTATCACTCTGGTGGAGG - Intronic
1014711924 6:124816469-124816491 TAAATGTACCATTCTAGTGTAGG + Intronic
1014716437 6:124869807-124869829 CAAATGTACCATTTTGGTGGAGG + Intergenic
1015038436 6:128686579-128686601 CATATGTACCACTTTAATGAAGG + Intergenic
1015049475 6:128821884-128821906 CAAATGTACCATTCTAGTGAAGG + Intergenic
1015067832 6:129052581-129052603 CAAATGTAGCACTCTGGAGGGGG - Intronic
1015069787 6:129078048-129078070 CAAATGTACTACTCTACTGGGGG + Intronic
1015621248 6:135134350-135134372 AAAATGTACCACTCTGGTCGAGG + Intergenic
1015694200 6:135962033-135962055 CAAATGGACCACTCTGATGGGGG + Intronic
1015767456 6:136733746-136733768 AAAATGTACCACTCTGGTGGGGG - Intronic
1016101401 6:140105644-140105666 CAAATGTACCACTCTGGTGGGGG - Intergenic
1016125583 6:140398825-140398847 CACATGTCCCACTCTGGTGGGGG - Intergenic
1016221337 6:141673993-141674015 CAAATGTACCTCTCTGGTGTGGG + Intergenic
1016222644 6:141693783-141693805 CAAATGTACCACTCTGGTGGGGG + Intergenic
1016264465 6:142214726-142214748 CAAATATACCACTCAAGTTGGGG + Intronic
1016283941 6:142451584-142451606 CAAATGTTCTACTCTGGTGGGGG - Intergenic
1016430300 6:143977124-143977146 CAAATGTACCACTCTAGTGGGGG - Intronic
1016678456 6:146799669-146799691 TATATGTACCACTCTGGTAGGGG + Intronic
1017189035 6:151631900-151631922 CAAATGTGCCACTCTGGTGCAGG - Intergenic
1017478752 6:154827967-154827989 TATACGTACCACTCTGGTGGAGG - Intronic
1017555651 6:155563852-155563874 CAAATGTACAACTCTGGTAGGGG - Intergenic
1017828411 6:158100888-158100910 CAAATGTACCAGTCTGGTGGGGG - Intergenic
1018289613 6:162278481-162278503 AAAATGTACCGCTCTGGTGGGGG + Intronic
1019903279 7:4041402-4041424 GAAAGGTACCACTCTGGTGGGGG - Intronic
1020544735 7:9512770-9512792 CAAATGTATCACTCTGGTGTGGG - Intergenic
1020770364 7:12384539-12384561 CAAATGTAGCACTCTGGTGGGGG + Intronic
1020866331 7:13568681-13568703 CAAAGGTACCACTCAGGTGGGGG - Intergenic
1020874974 7:13681799-13681821 GAAATGTACCACTCTGATGGGGG + Intergenic
1021079036 7:16341296-16341318 AACAGGTACCACTCTGGTAGGGG + Intronic
1021087890 7:16445185-16445207 CAAATGTACCACTTTGGTGCAGG + Intergenic
1021620594 7:22547938-22547960 CACATGTACAATTATCGTGGAGG - Intronic
1021643685 7:22766126-22766148 CAAATTTACCACTGTGGTGGGGG - Intergenic
1021664056 7:22956643-22956665 CAAACGTACCACTCTGGTGCGGG + Intronic
1022420813 7:30221709-30221731 CGAATGTACCACTCTGGTGTGGG + Intergenic
1022480059 7:30737179-30737201 CAAATGTACCACTCTGGTGGGGG - Intronic
1022658237 7:32341042-32341064 CACATGTACCACTCCAGTGGGGG + Intergenic
1022689097 7:32628402-32628424 CAAATGTACCACTCTGGTGCGGG + Intergenic
1022916675 7:34962803-34962825 CAAATGTACCACTCTGGTGCGGG + Intronic
1023379430 7:39591629-39591651 CATATGTACCAATCCGGTGGTGG - Intronic
1023473251 7:40548626-40548648 CAAATGTACAACTCTGGGGGTGG - Intronic
1023633837 7:42189037-42189059 CCAATGTACCTCTCTGGTGGAGG + Intronic
1023642853 7:42278252-42278274 CAAATGCACCACTCTGGTGGGGG + Intergenic
1024035964 7:45507646-45507668 CAAATGTACCATTCTGGTGGGGG - Intergenic
1024794028 7:53001918-53001940 CAAATGTGCCCCTCTGGTGGGGG + Intergenic
1024899659 7:54304267-54304289 CAAATGCAGCACTCTGGTGGGGG + Intergenic
1026184224 7:68069493-68069515 CTGATGTACCACTCTGGTGCAGG + Intergenic
1027334872 7:77139559-77139581 CAAATGTGCCACTCTGGTGGAGG + Intronic
1027393656 7:77730351-77730373 CAAATGTACCACTCTGATAGGGG - Intronic
1027684166 7:81261025-81261047 AACATGTACCACTCATGTGTGGG - Intergenic
1027714150 7:81648239-81648261 CAAATGTACCACTCTGTGGGAGG + Intergenic
1027982830 7:85249021-85249043 CAAATGTACCACTCTGATAGGGG + Intergenic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1028586175 7:92454064-92454086 CAAGTGTACCACTCTAGTGGTGG + Intronic
1028599587 7:92587855-92587877 CAAATGTACCACTCTGGTGAAGG + Intronic
1028770182 7:94610399-94610421 CAAATATACCACTCTGGTGGGGG + Intronic
1028897685 7:96060672-96060694 CAAATGCACCACTCTGGTAGGGG + Intronic
1029000641 7:97151090-97151112 CAAATGTACTACTCCAGTGGGGG - Intronic
1029780923 7:102731552-102731574 CAAATGTGCCACTGTGGTGGAGG - Intergenic
1029846118 7:103413930-103413952 CAGATGTGCCACTCTGGTGGGGG - Intronic
1030049548 7:105525510-105525532 CAAATGTACCACTTTGGTGAGGG + Intergenic
1030224784 7:107138280-107138302 CAAATATGCCACTCCAGTGGAGG + Intronic
1030290524 7:107867657-107867679 AACATGTACCACTCTTGTGGGGG + Intergenic
1030577413 7:111306345-111306367 CAAATGTACCAGTTTGGTGGGGG + Intronic
1030596867 7:111550491-111550513 CAAACGTACCATTCTGGTGGGGG + Intronic
1030723945 7:112902672-112902694 CAAATGTACCACTCTAGTGCTGG + Intronic
1030966883 7:116004493-116004515 CAAATGAACCACTCTGGTGAAGG + Intronic
1031116067 7:117670183-117670205 CAAATGTACTACTTTAGTGTGGG - Intronic
1031225329 7:119029847-119029869 CTAATGTACCACTCTAGTGGGGG + Intergenic
1031379000 7:121061499-121061521 CACATGGCCCACTCTGGTGGGGG + Intronic
1031639973 7:124150596-124150618 CAAATTTACCACTCTAGTGGGGG - Intergenic
1031668238 7:124512071-124512093 CGAATGTACCACTCTAGTGTGGG + Intergenic
1031695006 7:124840111-124840133 CAAATGTACCACGCTGGTAGAGG - Intronic
1032015314 7:128376330-128376352 CAAATGTACCATTCTGGTGAGGG - Intergenic
1032142659 7:129347329-129347351 CAGATGTACCACTCTGGTGCAGG + Intronic
1032178452 7:129653398-129653420 CAAATGTACCACTCTGGTGCAGG - Intronic
1032457312 7:132083219-132083241 CACTTGTTCCTCTCTGGTGGCGG + Intergenic
1032948571 7:136880742-136880764 CAAATGTATCACTCTGGTGGGGG - Intronic
1032957654 7:136990171-136990193 CAAATGTACCACTCTGATAGAGG - Intronic
1033369355 7:140694904-140694926 CAAATGTAACCCTCCAGTGGTGG + Exonic
1033467841 7:141612578-141612600 CAAATGTGCCACTCTGGTGAAGG + Intronic
1033870580 7:145749993-145750015 TACATGTACCACTTCAGAGGGGG - Intergenic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1034609209 7:152349827-152349849 CAAATGTACCACTCTAGTATAGG + Intronic
1035148902 7:156849871-156849893 CAAATTTTCCACTCTGGTGGGGG + Intronic
1035487783 7:159241133-159241155 CAAAGGCACCACTCTGGTGGTGG + Intergenic
1035525828 8:312430-312452 CAAATGCATCACTCTGGTGGGGG - Intergenic
1036204565 8:6795497-6795519 CAAATGCACCACTCTGGTGGGGG - Intergenic
1036622587 8:10434620-10434642 CAAATGCACCACTCTGGTGGGGG - Intergenic
1036667662 8:10758097-10758119 CAAATGTACCACTCTGGTGGGGG - Intronic
1036918545 8:12829678-12829700 CAATTGTACTACTCTTGTGGGGG - Intergenic
1037120328 8:15277461-15277483 CAAATTTTCCACTCTGGTGGAGG + Intergenic
1037449372 8:19001427-19001449 CAAATGTACCGCTCTGGTGGGGG - Intronic
1037631370 8:20659663-20659685 CAAATGCAGCACTCTGGTGGGGG + Intergenic
1037935215 8:22910985-22911007 CAAATGCACCGCTCTGGTGGGGG + Intronic
1038031108 8:23641232-23641254 CAAATGGACCACTCTGGTGGGGG - Intergenic
1038044477 8:23754474-23754496 CAAATGCTCCACTCTAGTGGGGG - Intergenic
1038084911 8:24185369-24185391 CAAATGTACCCCTCTGGTGGGGG + Intergenic
1038144079 8:24877767-24877789 CAAATGCACAACTCTGGTGGAGG + Intergenic
1038473884 8:27848243-27848265 CAAATGCACCACTCTGGTGGGGG - Intergenic
1038961775 8:32527973-32527995 CACATGTACCAGTCAAGGGGAGG - Intronic
1039095789 8:33883550-33883572 TAAATGTACCACTCTGGTGTGGG + Intergenic
1039163109 8:34644722-34644744 CAGATATACCACTCTGGTGGGGG - Intergenic
1039291848 8:36104271-36104293 CAAATGTACCACACTGGTGGAGG + Intergenic
1039312890 8:36338102-36338124 CAAATGTACCACTCTGATGAGGG + Intergenic
1039722907 8:40184180-40184202 CAAGTGTACCACTCTGGTGGGGG + Intergenic
1039734972 8:40322025-40322047 CACATATACTACTCTAGAGCAGG - Intergenic
1039862938 8:41474806-41474828 CAAATGTACCATTCTGGTGTGGG - Intergenic
1039925132 8:41923171-41923193 CAAATGTACCACTGTGGAGGAGG + Intergenic
1039940951 8:42090681-42090703 CACAGGTACTGCTCTGGTGGGGG + Intergenic
1040406210 8:47105732-47105754 CAACTGTACCACTCTAGTGAGGG + Intergenic
1040430005 8:47330310-47330332 CAAATATACCATTCTGGTGGGGG - Intronic
1040591982 8:48801836-48801858 CAAATGTGCCACTCTGTTGGAGG + Intergenic
1041093282 8:54324911-54324933 CAGATGTACCACTCTGTTGGGGG + Intergenic
1041299864 8:56399725-56399747 CAAATGGACCACTCTGGTGGGGG - Intergenic
1041941582 8:63393897-63393919 CAAATGTCCCACTCTGGTGTGGG - Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1042253762 8:66782431-66782453 CATATGTACCACTCTGGTGGGGG - Intronic
1042477996 8:69271405-69271427 TATATGTACCACTCTTGTGGGGG + Intergenic
1042501249 8:69511662-69511684 CAAATGCACCACCCTAGTGGTGG - Intronic
1042780769 8:72488919-72488941 TAAATGTACCACTCTGGTGTGGG + Intergenic
1043413638 8:80027032-80027054 CTGATGTACCGCTCTGGTGGGGG - Intronic
1043642906 8:82479294-82479316 CAAATGTACCACTCAGGTGTAGG + Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1043830887 8:84987441-84987463 AAAATGTCCCACTCTGGTGGAGG - Intergenic
1043987693 8:86713969-86713991 CAAAGGTACCACTCTCTTGGGGG - Intronic
1044050342 8:87494429-87494451 CAAATGCACCACTCTGATGGAGG - Intronic
1045037614 8:98188158-98188180 CAAATGTACCACTCTGGTGGGGG + Intergenic
1045271924 8:100669499-100669521 CAAAAGTACCACTCTGGTGGGGG - Intergenic
1045350920 8:101338886-101338908 AAAATGTACCACTCTGGTGTGGG - Intergenic
1045568704 8:103347860-103347882 TACATGCCCCACTCTGGTGGTGG - Intergenic
1046065622 8:109193720-109193742 CAAAGGAAGCACTCTAGTGGGGG - Intergenic
1046227457 8:111302716-111302738 CAAATGTACCACTCTGGTGGAGG + Intergenic
1046552614 8:115735389-115735411 CAAATATACCACTTTACTGGTGG + Intronic
1046952379 8:120030899-120030921 CAAATGTACCACTCAGGTAGGGG + Intronic
1046983554 8:120362640-120362662 CAAATGTACCACTCTGATGGAGG + Intronic
1047980905 8:130181008-130181030 CAATTGTACCACTCTGGTGGGGG + Intronic
1048666087 8:136662926-136662948 CACATGGACCATGCTGGTGGAGG + Intergenic
1048697286 8:137041829-137041851 CACATGCAGCATTCTAGAGGAGG + Intergenic
1048726599 8:137392622-137392644 AAAATGTACCACTCTGGTGAGGG - Intergenic
1048778704 8:137977660-137977682 CAAATGCACCACTCTGGTGGAGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1050777348 9:9282267-9282289 CAAATGTACCATTCTGTTGGGGG + Intronic
1050804514 9:9656807-9656829 CAAATGTACTTCTCTGGTGGGGG + Intronic
1050859237 9:10404031-10404053 CAAATCCACCACTCTGGTGGAGG + Intronic
1051288167 9:15517410-15517432 AAAATGTAACACTTTAGTGGGGG - Intergenic
1051746714 9:20301695-20301717 CAAATGTACCACGCTGGTGGGGG - Intergenic
1051797817 9:20893819-20893841 CAAATATACCACTCTGGTGGGGG - Intronic
1052133086 9:24874664-24874686 CAAATGTATCATTCTGGTGGGGG - Intergenic
1052166574 9:25337773-25337795 CAAATGTACCACTTTGGTGCGGG + Intergenic
1052234603 9:26194824-26194846 CAAATGTACCACTCTGATGAAGG - Intergenic
1052523810 9:29586181-29586203 CAAATGTACTACTCTACTGGGGG + Intergenic
1052582542 9:30377482-30377504 CAAATTTACCACTCTGGTGGAGG + Intergenic
1052613484 9:30807599-30807621 CAAATGCACCACTCTGGTGAGGG + Intergenic
1052783872 9:32810817-32810839 CAAATGTACCACTCTGGTGGGGG + Intergenic
1053187876 9:36034445-36034467 CAAATGTACCATTCTGGTGCAGG + Intergenic
1053541700 9:38980285-38980307 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1053573505 9:39334242-39334264 CAAATGCAGCACTCTGGTGGGGG - Intergenic
1053624766 9:39857839-39857861 CAAATGCACCACTCTGGTGGGGG - Intergenic
1053806043 9:41802917-41802939 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1053838124 9:42162798-42162820 CAAATGCACCACTCTGGTGGGGG - Intergenic
1053880104 9:42585389-42585411 CAAATGCACCACTCTGGTGGGGG + Intergenic
1053892557 9:42708920-42708942 CAAATGCACCACTCTGGTGGGGG - Intergenic
1054095073 9:60892926-60892948 CAAATGCAGCACTCTGGTGGGGG - Intergenic
1054116542 9:61168852-61168874 CAAATGCAGCACTCTGGTGGGGG - Intergenic
1054123639 9:61284767-61284789 CAAATGCAGCACTCTGGTGGGGG + Intergenic
1054219129 9:62392859-62392881 CAAATGCACCACTCTGGTGGGGG + Intergenic
1054231584 9:62516314-62516336 CAAATGCACCACTCTGGTGGGGG - Intergenic
1054591217 9:67013708-67013730 CAAATGCAACACTCTGGTGGGGG + Intergenic
1054624439 9:67383626-67383648 CAAGTGTACCACTCTGGTGAGGG + Intergenic
1055072774 9:72184160-72184182 CAAATGTAGCATTCTGGTGGGGG - Intronic
1055296161 9:74835905-74835927 CAGATGTACCAGTCTCCTGGGGG - Intronic
1055527013 9:77145179-77145201 ACAATGTACCACTCTGGTGGGGG + Intergenic
1055538632 9:77277380-77277402 CAAATGTACCACTCTAGTGGAGG - Intronic
1055781507 9:79826259-79826281 CACATGTACTACTCTGGTGGAGG + Intergenic
1055863536 9:80784674-80784696 CAAATGTACTACTCTGGTGGTGG - Intergenic
1055972252 9:81923269-81923291 CAAATGTACCACTCTAGTATGGG + Intergenic
1055974005 9:81938341-81938363 CAAATGTACCACTCTAGTATGGG + Intergenic
1055981036 9:82001000-82001022 CAAATGTACCATTCTGGTGGAGG - Intergenic
1055992940 9:82127645-82127667 CAAATGTACCATTCTCGTGTGGG + Intergenic
1055997465 9:82175760-82175782 CAAATGTACCACTCAGGTGCTGG - Intergenic
1056212449 9:84377257-84377279 CAAGTGTACCACCCTGGTGGGGG - Intergenic
1056466586 9:86861789-86861811 CAAATGCAGCACTCTGGTGGGGG + Intergenic
1057462453 9:95275535-95275557 CAAATGTACCACTCTGGTGGGGG + Intronic
1057873621 9:98736298-98736320 CCCATGTAACAGTCCAGTGGGGG - Exonic
1058254278 9:102741969-102741991 TAAATGTATCACTCTAGTGTGGG - Intergenic
1058654216 9:107205087-107205109 CAAATGGACCACTCTGGTGGGGG + Intergenic
1058772720 9:108252619-108252641 CAAATGTACCACTCTGGTGAGGG + Intergenic
1059089763 9:111343363-111343385 CAAATGTACCACCCTGGAGGGGG + Intergenic
1059203961 9:112445933-112445955 CAAATGTACCACTCTGGTAGAGG - Intronic
1059275606 9:113094274-113094296 CAAATGTACCACCCTGGTGAGGG + Intergenic
1059507769 9:114815198-114815220 CACATGTGCAAATCTAGTGTTGG + Intergenic
1059892716 9:118821929-118821951 CAAATGTACCACTCTGGTACAGG - Intergenic
1060169403 9:121448766-121448788 CAAATGTATCACTCTGGTGCAGG - Intergenic
1060714980 9:125917328-125917350 CAAATGAACCCCTCTGGTGGGGG - Intronic
1060769058 9:126317687-126317709 CAAATGTACCACTCTGGTGGTGG + Intergenic
1061298774 9:129692352-129692374 CGAATGTAACACTCTGGTGGGGG - Intronic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1185814110 X:3138194-3138216 CAAATGCGCCACTCTAGTGGGGG - Intergenic
1185819236 X:3185638-3185660 CAAATGTACTGCTCTAGTCGGGG + Intergenic
1185949516 X:4415995-4416017 AAAATGTACCACTCTGGTGGGGG - Intergenic
1185957526 X:4507794-4507816 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1186347245 X:8706589-8706611 CAAATGTCCCACTCTGGTGGGGG + Intronic
1186533391 X:10320464-10320486 CAAATGTTCCACTCTAGTGGGGG - Intergenic
1186677368 X:11832794-11832816 CGAATGTACCACTCTGGTGATGG - Intergenic
1186699542 X:12075298-12075320 CAAATGTACCACTCTGGTGAAGG + Intergenic
1187291350 X:17956656-17956678 AAAATGTACCACTCTAGTATTGG - Intergenic
1188043758 X:25401961-25401983 CAAATGTACTACTCTGGTGGGGG - Intergenic
1188088576 X:25934083-25934105 CAAATGTACCACTTTGGTGGGGG + Intergenic
1188269056 X:28116111-28116133 CAAGTGTACCACTCTGGTGGGGG - Intergenic
1188342881 X:29026988-29027010 CAACTGTACCACTCTGGTAGAGG - Intronic
1188502189 X:30839631-30839653 CAAACGTACCACTCTGGTGTAGG + Intronic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189001221 X:36949383-36949405 TAAATGTACCTCTCTGGTGGGGG - Intergenic
1189058446 X:37726161-37726183 AAAATGTACCACTCTGGTGGGGG + Intronic
1189158617 X:38786790-38786812 CAAATGCACCACTCTGGTGCAGG + Intergenic
1189158620 X:38786826-38786848 CAAATGCACCACTCTGGTGCAGG + Intergenic
1189411662 X:40778247-40778269 CAAATATACCACTCTGGTGGGGG - Intergenic
1189464963 X:41271619-41271641 CAAATATACCACTCTGGTGGGGG + Intergenic
1189727234 X:43979818-43979840 CAAATGTACCACTCTGGTGCAGG + Intergenic
1189775359 X:44465471-44465493 CAAATGTACCACTCTGGTAGGGG - Intergenic
1189804226 X:44719312-44719334 CAAATGTACCTCTCTGGTGATGG - Intergenic
1190365056 X:49684889-49684911 CAAATGTACCACTCCTTTGGGGG - Intergenic
1190617666 X:52252832-52252854 CAAATGTACTACTCTGGGGGGGG - Intergenic
1192419167 X:71013671-71013693 CAAATATACCACTCTGGTGTGGG + Intergenic
1192540418 X:71964948-71964970 CAAATGTACCACTCTGGTGCAGG + Intergenic
1192903646 X:75525689-75525711 CAAATGTACTACTCTGGTGGGGG - Intergenic
1193700442 X:84754067-84754089 CAAATGTAGCACTCTGGTGCAGG - Intergenic
1194184438 X:90756491-90756513 CAAATGTACCACTCTGGTGGGGG + Intergenic
1194278767 X:91921266-91921288 CAAATGTGTCACTCTGGTGGGGG - Intronic
1194280277 X:91943301-91943323 CAAATGTACCACTTTGGTGGGGG + Intronic
1194359566 X:92932738-92932760 CAAATGTACCACTGTGATGGGGG + Intergenic
1194440023 X:93920798-93920820 CAAATGTATCACTTTGGTGGGGG + Intergenic
1194890985 X:99378388-99378410 CAAATGTACCACTTTGGTGGGGG - Intergenic
1194908162 X:99605018-99605040 CATTTGTACCACACTACTGGAGG - Intergenic
1195003424 X:100664383-100664405 AAAATGTACCACTCTGGTGGGGG - Intronic
1195587477 X:106581793-106581815 CAGATGTACCACTCTGGTGGAGG + Intergenic
1195952697 X:110292883-110292905 CAAATGTACCACTCAGGTGTGGG + Intronic
1196140582 X:112258331-112258353 CAAATGTACCACTGCGGTGGCGG + Intergenic
1196313703 X:114197988-114198010 TAAATGTACCACTCTGGTTGGGG + Intergenic
1197297568 X:124737764-124737786 TACAAGTAGCACTCTAGTTGGGG - Intronic
1198134724 X:133737398-133737420 CAAATGTACCACTCTGGTGAGGG + Intronic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198410839 X:136365986-136366008 CAAACATACCACTCTGGTGGGGG - Intronic
1198550169 X:137736843-137736865 CAAATGTACCACTGTAGTGGAGG - Intergenic
1198617632 X:138477191-138477213 CAAATGTCCCACTGTAGTAGAGG + Intergenic
1198738486 X:139813978-139814000 CAAATGTACCATTCTGGTGTGGG + Intronic
1198786481 X:140294256-140294278 CAAATGTACTACTCTGGTGGGGG - Intergenic
1199999478 X:153050627-153050649 CAAATGTACCACTCTGGTGCAGG + Intergenic
1200021105 X:153209881-153209903 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1200531027 Y:4338404-4338426 CAAATGTACCACTCTGGCGGGGG + Intergenic
1200596250 Y:5144768-5144790 CAAATGTGTCACTCTGGTGGGGG - Intronic
1200597754 Y:5166795-5166817 CAAATGTACCACTTTGGTGGGGG + Intronic
1200667766 Y:6048570-6048592 CAAATGTACCACTGTGATGGGGG + Intergenic
1200733190 Y:6765056-6765078 CAAATGTACCACCTCAGTGGGGG - Intergenic
1201267597 Y:12223287-12223309 CAAATGCACCACTCTAGTAGGGG + Intergenic
1201419660 Y:13784558-13784580 CAAATATCCCACTCTGGTGGGGG - Intergenic