ID: 1100911881

View in Genome Browser
Species Human (GRCh38)
Location 12:99373484-99373506
Sequence TTGGACCAAATCTACATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100911881_1100911884 2 Left 1100911881 12:99373484-99373506 CCAAGAATGTAGATTTGGTCCAA 0: 1
1: 0
2: 0
3: 20
4: 159
Right 1100911884 12:99373509-99373531 CAGGCAAGTCAGACACTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 172
1100911881_1100911885 3 Left 1100911881 12:99373484-99373506 CCAAGAATGTAGATTTGGTCCAA 0: 1
1: 0
2: 0
3: 20
4: 159
Right 1100911885 12:99373510-99373532 AGGCAAGTCAGACACTTCATGGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100911881 Original CRISPR TTGGACCAAATCTACATTCT TGG (reversed) Intronic
904251744 1:29230021-29230043 TTTGACCAAATATAGATACTTGG + Intronic
909902064 1:81150201-81150223 TTGGAGCAACTTTACCTTCTTGG + Intergenic
911763587 1:101645101-101645123 TTGGACAAAGTCAACATTCTTGG + Intergenic
912105134 1:106264356-106264378 TTGCACCAGATCCACATCCTGGG + Intergenic
914997336 1:152556322-152556344 TTGAACCAACTCTGCATTCCAGG - Intronic
915000804 1:152588411-152588433 TTGAACCAAACCTACATGCCAGG - Intronic
916610915 1:166390651-166390673 TGGGACCAAGACTGCATTCTTGG - Intergenic
921313457 1:213868874-213868896 ATGGGCCAAATCTAGCTTCTGGG - Intergenic
924516874 1:244773546-244773568 TTGGATCAAATCTTCATCATTGG - Intergenic
1063152472 10:3349745-3349767 TTGTTCCAAATCCACACTCTGGG + Intergenic
1064807507 10:19153146-19153168 TTAAACCAAACCTACATTCTTGG + Intronic
1068925597 10:62534003-62534025 TTGAACCAATTCTGCATTCCTGG - Intronic
1070061380 10:72986484-72986506 TTGAACCATCTTTACATTCTTGG + Intergenic
1070582173 10:77730362-77730384 TTAGACCAACTCTGCATTCTGGG - Intergenic
1076058446 10:127394407-127394429 TTGGAGCAAATTTCCATTTTTGG + Intronic
1077149546 11:1064211-1064233 TTAGACCAACTCTGGATTCTTGG - Intergenic
1077854750 11:6112610-6112632 TTGCTGAAAATCTACATTCTAGG + Intergenic
1078028050 11:7718305-7718327 TGGAACCAAATATACATTTTTGG - Intergenic
1079764419 11:24373487-24373509 GTGGACCAAAGCTTCATTATGGG + Intergenic
1080862499 11:36162135-36162157 TTGAACCAAATATAAATTCCTGG + Intronic
1080991582 11:37543385-37543407 TTGGATCAAAAATACATTCCAGG - Intergenic
1086174742 11:83877658-83877680 TTGTTCCAAATCTACATGCTAGG - Intronic
1088578295 11:111293753-111293775 ATGGACCAAATGTTCACTCTAGG + Intergenic
1089951548 11:122532584-122532606 GTGCACCAAATATTCATTCTAGG + Intergenic
1093290126 12:17309209-17309231 TTGGATTAAAGCTACATTATTGG + Intergenic
1093505835 12:19864923-19864945 TTGGACCTAATCTTCATTGTAGG + Intergenic
1095414118 12:41957006-41957028 TTGGAACAAATCAACATCATAGG + Intergenic
1095781036 12:46059727-46059749 TTGAACCACCTCTACATTCCAGG - Intergenic
1097825889 12:64174184-64174206 TTGGATCAAATCTGAATTCATGG - Intergenic
1098235432 12:68413647-68413669 TTGGATCAAAACTTCATTATTGG + Intergenic
1100911881 12:99373484-99373506 TTGGACCAAATCTACATTCTTGG - Intronic
1100959449 12:99946240-99946262 TTGCCCCAATTCTCCATTCTTGG + Intronic
1101135961 12:101743345-101743367 TTGGGCCAAATTTGCATTCCTGG + Intronic
1101273430 12:103172828-103172850 TTTGACAAAATTTAGATTCTAGG - Intergenic
1101302891 12:103499583-103499605 CAGGACAAAATCCACATTCTTGG - Intergenic
1103636312 12:122309349-122309371 TTACACCAAATCTATATTCTTGG + Intronic
1103950784 12:124549912-124549934 ATGAACAAAATCTACATGCTGGG + Intronic
1108825225 13:54405706-54405728 CAGGAGCATATCTACATTCTGGG - Intergenic
1109152884 13:58865931-58865953 TAGAACCAAATATAAATTCTAGG + Intergenic
1111300623 13:86345044-86345066 TTAGACAAAATCTACTTTCTTGG - Intergenic
1112843108 13:103604708-103604730 TTAGACCAAATCGACATTTATGG + Intergenic
1112954302 13:105040189-105040211 TTGGTCAAAAACTACAGTCTTGG - Intergenic
1115415719 14:33131107-33131129 TTGGAGCAAGTCTACATACCAGG + Intronic
1117750184 14:58913805-58913827 TTCTACCTAATCTTCATTCTGGG - Intergenic
1121480603 14:94268481-94268503 GTGGACCATATCTACTCTCTTGG - Intronic
1202872314 14_GL000225v1_random:176398-176420 TCAGACCAAATCTACTCTCTGGG - Intergenic
1123389678 15:19857918-19857940 TTTGACTCAAGCTACATTCTAGG + Intergenic
1123863387 15:24491189-24491211 TTGAACCAAATTTGCATTCCTGG + Intergenic
1125344751 15:38707855-38707877 TTGGTACAAATCAACATCCTGGG + Intergenic
1126836332 15:52669824-52669846 ATGGAACAAATCTAAATTCTGGG + Intronic
1130161480 15:81405304-81405326 TTGGACTTCATCTATATTCTTGG + Intergenic
1135947004 16:26873910-26873932 TTGGACCAGATCCACATGCCGGG - Intergenic
1139214719 16:65116086-65116108 TTGGACCAGTTATTCATTCTTGG - Intronic
1140867958 16:79080618-79080640 CTGGACCAAATGTAGATACTGGG - Intronic
1141149222 16:81552612-81552634 TGGGACCAACTCGACAATCTGGG + Intronic
1141493780 16:84392906-84392928 TTGCACCAAGCCTCCATTCTAGG - Intronic
1147659891 17:42111876-42111898 TAGGACCGAAGCTCCATTCTGGG + Exonic
1149386762 17:56150185-56150207 GTGGACCACATCTAGTTTCTGGG - Intronic
1149615998 17:57999429-57999451 TTGTAACAAATCTAGGTTCTGGG - Intronic
1153742045 18:8139141-8139163 TTGGTCCAAAACTAAACTCTTGG + Intronic
1154094918 18:11404624-11404646 TTATACCTAATCTACATTTTTGG - Intergenic
1155212839 18:23618141-23618163 TTGGACCAAAGAGGCATTCTCGG + Intronic
1155309865 18:24512881-24512903 TTGGACCAGAACTACATCATCGG + Intergenic
1155561290 18:27080064-27080086 TTGGACCAATTATACATTTGTGG - Intronic
1155834523 18:30563262-30563284 TTAATCCAACTCTACATTCTTGG + Intergenic
1156815206 18:41302002-41302024 TTGAACCAAACTTACATTCCAGG + Intergenic
1157971964 18:52280818-52280840 TTGGACCAAAGCCACACTCAGGG - Intergenic
1158450627 18:57561139-57561161 TTGGAGCAAATTTATCTTCTAGG - Intronic
1159367396 18:67486097-67486119 TTTGACAAAATTTACATGCTTGG - Intergenic
1162399111 19:10433928-10433950 TGGGTTCAAATCCACATTCTAGG + Intronic
1164769751 19:30799438-30799460 TTGGAGCAGGTCTGCATTCTGGG + Intergenic
1165424567 19:35738760-35738782 TTGTACAATATCTACATCCTGGG - Exonic
926962731 2:18376600-18376622 TTGAACCAACCTTACATTCTTGG - Intergenic
932035372 2:68240876-68240898 TTGGACCAAACCTACATCAAAGG + Intronic
938123127 2:128647571-128647593 TTGAACCCAATCTACATCCCAGG + Intergenic
940580066 2:155567802-155567824 ATGTACCATATCTACATTTTAGG + Intergenic
940743274 2:157536898-157536920 TTAAACCAAATATACATTCTTGG - Intronic
944386942 2:199177073-199177095 TTGAACCAACCTTACATTCTTGG - Intergenic
946504947 2:220289128-220289150 TTGGACCAACTCAGCATTCAAGG - Intergenic
947921223 2:233876080-233876102 TTGCAACAAATGTACCTTCTTGG - Intergenic
1173428456 20:42963362-42963384 TGAGACCAAATCTAGAATCTGGG - Intronic
1173567251 20:44050780-44050802 TATGAGCAAACCTACATTCTAGG - Intronic
1173994384 20:47326532-47326554 TTTAACCAAATCTTCAGTCTTGG + Intronic
1177515160 21:22139997-22140019 TTGAACAAAGTCTACATTTTCGG + Intergenic
954333408 3:49902697-49902719 TTGGAGCAAATCTGCAGTCGAGG + Exonic
956965985 3:74461166-74461188 TTAGACCAAACTTGCATTCTTGG + Intronic
957515886 3:81250453-81250475 TTATATGAAATCTACATTCTTGG + Intergenic
957746070 3:84345108-84345130 TTGGACCAACTTTTCATCCTGGG + Intergenic
957977345 3:87463673-87463695 TTGGACTAAATCTACACTATAGG + Intergenic
958632608 3:96701899-96701921 CTGGATCAATTCTACATTGTCGG - Intergenic
958641103 3:96806097-96806119 TCGCACAGAATCTACATTCTAGG - Intergenic
959293505 3:104504625-104504647 TTGGACCTAATCTAAACTATAGG + Intergenic
959463269 3:106652469-106652491 TTGAACCAAACCTACATCCCAGG - Intergenic
960068183 3:113397983-113398005 ATGTACCAAATCTACTGTCTTGG + Intronic
960607887 3:119527067-119527089 TAAGACCAAATCTAAAGTCTTGG + Intronic
962215157 3:133514733-133514755 TAGGATCAAATCCACATTCTTGG - Intergenic
964019965 3:151998098-151998120 TTAGACCAAATATATCTTCTGGG + Intergenic
964028596 3:152108746-152108768 TTGAACCAAATTTAAATCCTAGG - Intergenic
965800391 3:172486788-172486810 GTGAACCATTTCTACATTCTTGG + Intergenic
966459374 3:180158957-180158979 TTGGACCAACTTTGCATTCTTGG + Intergenic
966480488 3:180402993-180403015 TTGGACTAAAACTACACTGTTGG + Intergenic
967570714 3:191025280-191025302 TTGGACTAGAACTACATTATAGG + Intergenic
967667744 3:192193932-192193954 TTCTACCAAATATACATACTGGG + Intronic
967707452 3:192668063-192668085 TTAAACCAATTCTCCATTCTTGG - Intronic
967837932 3:193980252-193980274 TTGGACCATATGTACTTCCTTGG - Intergenic
972050527 4:34726819-34726841 TTAGACCAAATGTAGTTTCTAGG + Intergenic
975745134 4:77467885-77467907 TTGGACCAGCTCTGGATTCTAGG + Intergenic
978697365 4:111598011-111598033 TTGAACCACACCTTCATTCTTGG + Intergenic
979795269 4:124838475-124838497 TTTGACCAAATGTATGTTCTTGG + Intergenic
981012610 4:139941060-139941082 CTAGACCAAATCTACATTGTAGG - Intronic
982666263 4:158268395-158268417 TTGTTCCACATCTTCATTCTGGG + Intergenic
982973116 4:162016213-162016235 TTTGGCCAAAACTAAATTCTGGG + Intronic
984124828 4:175795213-175795235 TTGAATCAACTCTACATCCTTGG - Intronic
984211564 4:176855872-176855894 TTAAAACAAATCTACATTATTGG - Intergenic
985157340 4:187003240-187003262 TTGGACCAGATTTGCATCCTGGG - Intergenic
985751947 5:1685538-1685560 TTGGACAAAATCACCATCCTCGG - Intergenic
990085806 5:51975151-51975173 TTGCAGAATATCTACATTCTAGG + Intergenic
991978781 5:72210502-72210524 TTGGACCAAAAGTAAATTCCAGG + Intergenic
992617435 5:78558437-78558459 TGGAACCAAATCTACCTGCTGGG + Intronic
995274930 5:110267295-110267317 TTGTACCAAATCTTCATTTTGGG - Intergenic
996252857 5:121358785-121358807 TTGCATCAAATCTACAGTTTTGG + Intergenic
998496655 5:142596105-142596127 TTTTAAAAAATCTACATTCTAGG - Intronic
998742959 5:145225850-145225872 CTGAAGCAAATTTACATTCTTGG + Intergenic
999970375 5:156855011-156855033 CTAGAACAAATCTACATTCTTGG + Intergenic
1001584539 5:172824553-172824575 CTGGAGCAAATCAGCATTCTAGG - Intergenic
1006518086 6:34555706-34555728 CTGGGCCAACTCTACATGCTGGG - Intronic
1008329684 6:50229837-50229859 TAGTCCCAAATCCACATTCTCGG + Intergenic
1008889261 6:56466971-56466993 TTGTAGCATATCTACATTATTGG - Intronic
1010533033 6:76990680-76990702 CTGGATCAATTCTACACTCTTGG - Intergenic
1014560791 6:122887835-122887857 TTGGAACACATATGCATTCTGGG + Intergenic
1014840537 6:126215209-126215231 TTGGACTTAATCTGCATCCTAGG - Intergenic
1018132326 6:160743978-160744000 TTGAACCAAGCTTACATTCTGGG + Intronic
1018691764 6:166351424-166351446 TTGAACCAACTTTGCATTCTTGG + Intergenic
1019787620 7:2987599-2987621 TTGGACAAAATCTACAATGATGG + Intronic
1020867089 7:13579176-13579198 TTGTCCCAAATCCACATTCAGGG - Intergenic
1021451900 7:20790396-20790418 TGGGACCTAATTTACATCCTGGG + Intergenic
1022562071 7:31359709-31359731 TTGCACCAAATCTTCATATTGGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024720882 7:52136485-52136507 TTGGACTGAGTCTTCATTCTGGG + Intergenic
1027489053 7:78799549-78799571 GTGGAACAAATCTATATCCTTGG - Intronic
1030867039 7:114712424-114712446 TTTTACCAAAGCTACATTGTAGG - Intergenic
1037252658 8:16915016-16915038 TTCGACCAAATGAACAATCTGGG + Intergenic
1037959680 8:23086713-23086735 TTTGAACACATTTACATTCTTGG - Intronic
1039747340 8:40440902-40440924 TTGGAAGAAATCTAGATTTTAGG - Intergenic
1041542280 8:58998697-58998719 GTGGACCAGATATACCTTCTAGG - Intronic
1041560816 8:59215758-59215780 TTGGGACAAATCTAGCTTCTTGG - Intergenic
1041604510 8:59764862-59764884 TTGAGCCAAATTTACATTCTTGG - Intergenic
1043262142 8:78215228-78215250 GGGGACCAAATCTAAATTCATGG + Intergenic
1043351510 8:79366569-79366591 TTGGATCACATCTACATTTTAGG - Intergenic
1043423428 8:80123782-80123804 TAGAACCAAGACTACATTCTTGG - Intronic
1043692695 8:83175552-83175574 TTGGACCAAATCTAGTTTGCAGG - Intergenic
1046691592 8:117291695-117291717 TTGGAACAAATCAACATCATAGG + Intergenic
1046831968 8:118756151-118756173 TAGGACCAACTGGACATTCTAGG + Intergenic
1048805691 8:138239115-138239137 TGGGATCACATCTACCTTCTAGG - Intronic
1050306514 9:4310942-4310964 TTGGACCCATTCTGCATTCAGGG + Intronic
1051843330 9:21423464-21423486 TTGAACCAAATTTACATCCCAGG + Intronic
1051976383 9:22954854-22954876 TTGAACCAGCTTTACATTCTTGG - Intergenic
1055144579 9:72917354-72917376 CATGATCAAATCTACATTCTTGG - Intronic
1060708661 9:125833674-125833696 TTAGACTAAATTTACTTTCTAGG + Intronic
1203732139 Un_GL000216v2:100142-100164 TCAGACCAAATCTACTCTCTGGG + Intergenic
1186059792 X:5691655-5691677 TTCTACCAAGTCCACATTCTAGG + Intergenic
1186322008 X:8437789-8437811 ATGTACCAAATATATATTCTAGG + Intergenic
1186875497 X:13812497-13812519 TTGGACCAAATGTACATACATGG - Intronic
1188556397 X:31417144-31417166 TTGGAACAAATGAACATTCCTGG - Intronic
1188851223 X:35134823-35134845 TTGAACCAACTTTGCATTCTGGG + Intergenic
1190413359 X:50158515-50158537 TTGTACCAGCTCTACATTCTAGG + Intergenic
1190595187 X:52045704-52045726 TTGAACCAACTTTACATTCCTGG - Intergenic
1190613637 X:52208369-52208391 TTGAACCAACTTTACATTCCTGG + Intergenic
1192607456 X:72533690-72533712 TTAAACCAAACCTGCATTCTTGG - Intronic
1193425172 X:81333548-81333570 TTGAACCAACTTTACATCCTAGG + Intergenic
1193687070 X:84590728-84590750 TTGGACCAAACTTGCATCCTGGG - Intergenic
1193742658 X:85236510-85236532 TTGAACCATAATTACATTCTGGG - Intergenic
1195276956 X:103290846-103290868 TTGGTCCAAATCTTCCTTGTTGG + Intergenic
1196468485 X:115996952-115996974 TTGGACCAAACTTGCATCCTGGG + Intergenic
1197448246 X:126579478-126579500 TTGGAACACATGTACATTGTTGG + Intergenic
1197485684 X:127048035-127048057 TTGAACCAACTTTACATTCTTGG + Intergenic
1197740348 X:129887273-129887295 TTGAACCAAGTTTACATTCCTGG - Intergenic
1199108253 X:143898439-143898461 TTGAACCATCTTTACATTCTAGG + Intergenic
1201017050 Y:9615822-9615844 TTGGAATATATCTACATTTTTGG - Intergenic
1202046613 Y:20742077-20742099 GTGGACCACATCTGCAATCTTGG - Intergenic