ID: 1100915268

View in Genome Browser
Species Human (GRCh38)
Location 12:99413790-99413812
Sequence TGCAATCCCACATAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100915268 Original CRISPR TGCAATCCCACATAGGAGCA AGG Intronic
900892606 1:5460416-5460438 TGCTGTCCCACACAGAAGCAGGG + Intergenic
901026624 1:6281840-6281862 TTCAATCCCACCAAGGGGCACGG - Intronic
902347577 1:15829674-15829696 TGCACTCCCACCTGGGAACATGG - Intergenic
903756466 1:25665050-25665072 TCCATTCCCACAAAGGTGCACGG + Intronic
908118475 1:60963909-60963931 TGCATTCCCACATGGGAGAGTGG - Intronic
908353327 1:63307825-63307847 TGCACTCCCACATTGCATCAGGG + Intergenic
910223296 1:84911629-84911651 AACAATCCACCATAGGAGCATGG - Intergenic
911717506 1:101150887-101150909 TGCAATCCCACATATCAGCCAGG + Intergenic
915357222 1:155262523-155262545 GGCAATCCCCCCTAGGAGCCAGG + Intergenic
917040649 1:170802745-170802767 TGCATTGCCACAAAGAAGCAGGG - Intergenic
922373406 1:224935087-224935109 AGCAATCACACAAAGGAGGAAGG + Intronic
1063264377 10:4431335-4431357 TGGATTCCCACCTAGGATCATGG + Intergenic
1063748473 10:8914389-8914411 TGGAATCCTACATTGGATCATGG - Intergenic
1064096891 10:12430341-12430363 TGCAAGCCCACCTACCAGCAGGG - Intronic
1068553492 10:58432124-58432146 TGCAATCCCACAAAAGGGCAAGG - Intergenic
1073618173 10:105019312-105019334 TGTCATTCCACATAGGAGAATGG + Intronic
1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG + Intergenic
1084623745 11:70292362-70292384 TGGATTCCCACATTGGAGCGCGG + Intronic
1090885244 11:130870375-130870397 CGCAAACCCACATGGGTGCAGGG + Intergenic
1091719962 12:2805775-2805797 GGGAATCCCAGATAGGAGCCTGG - Intergenic
1093990381 12:25583521-25583543 TGATATCTCAAATAGGAGCAAGG - Intronic
1098387781 12:69936734-69936756 TGCCACCCCAAATAGAAGCATGG - Intronic
1100774126 12:97955784-97955806 AGCAATACAAGATAGGAGCAAGG + Intergenic
1100915268 12:99413790-99413812 TGCAATCCCACATAGGAGCAAGG + Intronic
1102827681 12:115963238-115963260 TGCAGTCCCTCATAGCTGCATGG - Intronic
1104122890 12:125816095-125816117 TGCCATGCCAAATAGGAGGATGG + Intergenic
1106073270 13:26434828-26434850 GGCAATCACACAGAGTAGCAAGG + Intergenic
1109874022 13:68374746-68374768 TGCAATCTCAAAGAGGAGGATGG - Intergenic
1113882999 13:113638699-113638721 TGCAATCCCACAGAGTAGAATGG + Intronic
1120036902 14:79708098-79708120 TGCAATCCCACATATGCAGAGGG - Intronic
1124070896 15:26392366-26392388 TGCCATCCTTCATAGGGGCATGG + Intergenic
1124519259 15:30395331-30395353 TGCACTGCCTCATAGGGGCAGGG + Intergenic
1124882021 15:33651673-33651695 GGCAAGGCCACATAGGGGCAGGG - Intronic
1129497522 15:75999524-75999546 TGCAAGCTCACATAGCAGAAGGG - Intronic
1129691818 15:77718078-77718100 CGCCATCCCCCATGGGAGCAGGG + Intronic
1131459913 15:92610676-92610698 TGCAATCCCACAAAAGACAATGG + Intergenic
1132086031 15:98908953-98908975 TGCCATCACACATGGGAGGAGGG - Intronic
1132546337 16:535079-535101 TGGGAGCCCACATGGGAGCAGGG - Intronic
1133608844 16:7414188-7414210 TGCAATCCCATCTTGGTGCATGG - Intronic
1134062405 16:11206966-11206988 TGCAAAGCCACAGAGGTGCAAGG - Intergenic
1138515442 16:57533355-57533377 TGCACTCCCACATAGACCCAAGG + Intronic
1138921278 16:61532200-61532222 TGCCATCCAAGAGAGGAGCAGGG - Intergenic
1139677560 16:68535262-68535284 TGTAATTCCACATAGGAACCAGG + Intronic
1140859232 16:79004849-79004871 TAAAATCTCACATAGGTGCACGG - Intronic
1144533227 17:16060792-16060814 TGCAATTCCACATAGAATTAAGG + Intronic
1147451153 17:40505314-40505336 TTCAATCCCTGAAAGGAGCATGG - Intergenic
1153179064 18:2412380-2412402 TGCAATTAAACATAGGAGGATGG - Intergenic
1153500577 18:5745357-5745379 TTAAAGCCCACAGAGGAGCAAGG - Intergenic
1153631964 18:7079358-7079380 TTCAAGTCCACATAGGAGGATGG - Intronic
1155699810 18:28730176-28730198 TGCATTCTCACATGGGAGAAGGG - Intergenic
1159782796 18:72678536-72678558 TGCAATCCCACTCGGAAGCAAGG + Intergenic
1161914590 19:7219130-7219152 TGCAATCCAACATCTGAGTAGGG + Intronic
1162393272 19:10402562-10402584 TGCAATACCAAGTAGGAGCAGGG + Intronic
1165731878 19:38151174-38151196 TGTCATCCCTCTTAGGAGCAAGG + Intronic
925341773 2:3142841-3142863 TGCCACCCCACCTGGGAGCAGGG - Intergenic
925341794 2:3142911-3142933 TGCCACCCCACCTGGGAGCAGGG - Intergenic
926210306 2:10864380-10864402 TGCAGTCCCTCATAGTAGCCAGG + Intergenic
926671865 2:15584089-15584111 TGCAATCCCAGCTAGCAGCTTGG + Intergenic
931457468 2:62423542-62423564 TCCAACCCCACACAGGGGCATGG + Intergenic
940180219 2:150923715-150923737 TGGAAACCCAGATAGGAGTAAGG - Intergenic
941984058 2:171492031-171492053 TCCAATCCCCCATAGGTACAAGG - Intergenic
944976302 2:205055526-205055548 TGCAATCACACACAGGATCTTGG - Intronic
1177908261 21:26998385-26998407 TTCCATCCCACATAGTAACAAGG + Intergenic
1179641379 21:42749565-42749587 AGGTATCCCACATAGGAGCAGGG - Intronic
1181378330 22:22478601-22478623 TCCATTCCCACATAGCATCAGGG + Intergenic
1185257686 22:49845088-49845110 TGCAATCCCAGCTACTAGCAAGG - Intergenic
1185346795 22:50313935-50313957 TGCAGCCCCACAGAGGAGCCAGG + Intronic
953854316 3:46489200-46489222 TGTAAGCCGACAAAGGAGCAGGG - Intergenic
955065539 3:55530883-55530905 TTCCATCTCACACAGGAGCACGG + Intronic
957903544 3:86529848-86529870 TTCACTCCCACAAAGGAGCAAGG - Intergenic
960910379 3:122643786-122643808 TGTAATCCCAGCTAGGAGGAAGG - Intergenic
968896784 4:3408979-3409001 TGCAATACCAGAGAAGAGCATGG + Intronic
972122048 4:35715191-35715213 TGCAATCACACAAAGGAGAAAGG + Intergenic
974089438 4:57296017-57296039 TACAGTCTCACATAGGAACAGGG + Intergenic
975041297 4:69747170-69747192 TGTAATCCAACATGGAAGCAGGG + Intronic
979026797 4:115587839-115587861 TCAAATCCCACTTAGGAGTAAGG - Intergenic
982638767 4:157930001-157930023 TGCACCTCCACAAAGGAGCAAGG - Intergenic
982924259 4:161316210-161316232 TGCACTTCCACAGAGGAGAAGGG - Intergenic
985624238 5:976884-976906 TGCATTCCCACAGAGCAGGATGG + Intergenic
986209927 5:5662154-5662176 GGCCATCCCAGAAAGGAGCAAGG - Intergenic
986326831 5:6682125-6682147 TCAAATCCCTCACAGGAGCAGGG + Intergenic
987239457 5:15979546-15979568 TGGAATCCTACATTGGATCATGG + Intergenic
987720809 5:21629765-21629787 AGCAATCACATATTGGAGCAAGG - Intergenic
993848668 5:92978020-92978042 TGCAAAGGCACATGGGAGCAGGG + Intergenic
995723900 5:115165728-115165750 TGCAATTGCACCCAGGAGCATGG - Intronic
996493889 5:124130873-124130895 TGCAAACACACATGGGACCAGGG + Intergenic
996535983 5:124578338-124578360 GACATTACCACATAGGAGCAAGG + Intergenic
1000094148 5:157956152-157956174 TGTAATCCCAGATAGTAGGAAGG - Intergenic
1005685679 6:28251488-28251510 TGAAATCCCAGATCGGAGCGAGG - Intronic
1016387212 6:143540145-143540167 TGGAATCAAAAATAGGAGCAAGG - Intronic
1017393983 6:153975243-153975265 TGCAATCCCACATGCTAGCAAGG - Intergenic
1017908125 6:158770704-158770726 TGCATTTCCACAGAGTAGCAGGG - Intronic
1028773094 7:94649642-94649664 TACAATCCCACAAAAGTGCATGG + Intronic
1032218794 7:129978304-129978326 TGTAATCCCAGTTAGGAGGAGGG - Intergenic
1033570891 7:142627266-142627288 TCCAAGGCCACATACGAGCAAGG + Intergenic
1033596469 7:142863166-142863188 TGCAGCCCCACCCAGGAGCAGGG + Exonic
1034713651 7:153219371-153219393 TGCAATGCCTACTAGGAGCAGGG - Intergenic
1035650930 8:1264258-1264280 TGCAATCCCAGAAAGGGGCCTGG + Intergenic
1035819987 8:2580584-2580606 TGTAAACCCACATAGGGGAAGGG - Intergenic
1038184936 8:25264498-25264520 TCCATTCCCATATAGCAGCAAGG + Intronic
1040912349 8:52531909-52531931 TGCATTCCCACTTAGCAGCATGG + Intergenic
1049329874 8:142044727-142044749 TGCCATCCCACACAGGGGAAAGG + Intergenic
1056673852 9:88656220-88656242 AGCACTCCCACAGAGCAGCAAGG + Intergenic
1057025726 9:91732888-91732910 TGCAAGCCCACATGCGAGCCTGG + Intronic
1058798110 9:108518053-108518075 GGCAACCCCACATAGAAGAAAGG + Intergenic
1061812719 9:133171721-133171743 TGCTATCCCACCTGGGAGCAGGG - Intergenic
1192232025 X:69272008-69272030 TGCTCTCCCACCTGGGAGCACGG - Intergenic
1192572755 X:72220197-72220219 AGCAATCACATATAGGAGTATGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1199684478 X:150254301-150254323 TGCATTCCCACATAGGAACGAGG - Intergenic
1200013648 X:153140950-153140972 TGCACTCCTTGATAGGAGCAGGG + Intergenic
1200025953 X:153258968-153258990 TGCACTCCTTGATAGGAGCAGGG - Intergenic
1200758738 Y:7016434-7016456 TGCAATCCTAAATAAAAGCATGG - Intronic