ID: 1100916581

View in Genome Browser
Species Human (GRCh38)
Location 12:99430572-99430594
Sequence GGTGGAGGATGTTACTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100916581_1100916587 12 Left 1100916581 12:99430572-99430594 CCATTAGAGTAACATCCTCCACC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1100916587 12:99430607-99430629 CCTTATTAATTTATCCCCTAAGG 0: 1
1: 0
2: 6
3: 53
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100916581 Original CRISPR GGTGGAGGATGTTACTCTAA TGG (reversed) Intronic
910084984 1:83390043-83390065 GGGGCAGGATGTAACTCCAAAGG + Intergenic
911057811 1:93722878-93722900 AGTGAAGGATTTTACTCTCAGGG - Intronic
917863234 1:179168728-179168750 GGAAGAGGATGTGACTCTAAAGG - Intronic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
919130413 1:193443360-193443382 GGTGAAGATAGTTACTCTAAGGG + Intergenic
1063025096 10:2170342-2170364 GGTGAAGGATGTAAATTTAATGG - Intergenic
1063442435 10:6083846-6083868 GGGGGAGGATGTAACTTGAAAGG + Intergenic
1073402399 10:103269209-103269231 GTGGGAGGATGTAACTATAAAGG - Intergenic
1079138196 11:17788392-17788414 GGTGGAGTGTGTTACTCTTGGGG - Exonic
1080545261 11:33310844-33310866 GGTAGATCATGTTATTCTAAGGG + Intronic
1085285234 11:75355344-75355366 GGTGGAGGATGTGACACAAATGG - Intergenic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092125734 12:6073915-6073937 GATGGAAGATGTTCATCTAAGGG - Intronic
1092811558 12:12275641-12275663 GGTGGAGTAAGAAACTCTAAGGG + Intergenic
1092976786 12:13753088-13753110 TGTGTTAGATGTTACTCTAAGGG - Intronic
1093864537 12:24209205-24209227 GGTGGAGGAACTAACTCTTATGG + Intergenic
1096314298 12:50550671-50550693 TGTGGAGGCTGTTACTCCAGAGG + Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101222418 12:102655233-102655255 GGTGGACGTGGTTACTGTAATGG + Intergenic
1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG + Intergenic
1105943984 13:25174399-25174421 TCTGGAGGATGGTACTCAAAAGG + Intergenic
1110253834 13:73409914-73409936 GAGGGATGATGTTAGTCTAAAGG + Intergenic
1111295838 13:86276713-86276735 GATGGAGGAACTAACTCTAAAGG + Intergenic
1115809385 14:37089864-37089886 GATGGAAGATGTCACTTTAAAGG - Intronic
1116176671 14:41479513-41479535 GGAGGATGATTTTACTCTATTGG + Intergenic
1125072942 15:35577645-35577667 GTTGGAGAATGTTTCTCTAGGGG - Intergenic
1125199891 15:37094315-37094337 GGAGGAGGAGGCTACTTTAAAGG + Intronic
1125926393 15:43566689-43566711 GGTGGAGGAAGTTGCTGTATAGG - Intronic
1125939537 15:43666239-43666261 GGTGGAGGAAGTTGCTGTATAGG - Intronic
1126699383 15:51354430-51354452 TGTGAAGGATTTTCCTCTAAAGG - Intronic
1126961908 15:54005946-54005968 GGTGGAGGATATTACTTTAGGGG + Intergenic
1130978262 15:88793779-88793801 GGTGGAGGGTTTTACTCTATAGG + Intergenic
1131380422 15:91959133-91959155 GCTGGAGGCTGTTATTCTAAGGG + Intronic
1137482370 16:48863273-48863295 AGGGGAGGATGTGACTGTAAAGG + Intergenic
1140490842 16:75334517-75334539 GGTGGAGGAGGTTTCTATAAAGG + Intronic
1145286574 17:21510846-21510868 GGGGGAAGATGTTAGTCAAAGGG - Intergenic
1148207967 17:45791405-45791427 GGTGGATGATTTCACTCTTACGG + Intronic
1148762704 17:50015549-50015571 GGAGTAGGGTGTTACTATAAAGG - Intergenic
1150026878 17:61685450-61685472 AGTGGTAGATGTTATTCTAAAGG - Intronic
1155717689 18:28967464-28967486 AGTGGAGGATGTTCCTATAAGGG + Intergenic
1155943734 18:31825274-31825296 GGTGGAGCATGCCACTCCAATGG - Intergenic
1156022941 18:32620468-32620490 GGTTGAGGATGTTGCTGTAAGGG + Intergenic
1159405692 18:67999922-67999944 GGTTTAGGCTGTTTCTCTAAAGG + Intergenic
1163050351 19:14678622-14678644 GGTGGAGGTTGTTGTTATAATGG + Intronic
1164610891 19:29630982-29631004 GAAGGAGGCTGTTCCTCTAAAGG + Intergenic
1165824051 19:38695502-38695524 GGGGGAGGAAGTTTCTCTCAGGG + Intronic
1165918884 19:39279685-39279707 GAGGGAGGATGTGACTGTAAAGG - Intergenic
927670748 2:25066673-25066695 GCTGCATGCTGTTACTCTAAGGG + Intronic
931147502 2:59535200-59535222 GGTGAAGGATGTGACTTTTAGGG - Intergenic
934048746 2:88192551-88192573 GGGGGATGATGTTTCTCAAATGG - Intergenic
940249065 2:151653750-151653772 AGTAGAGCATCTTACTCTAATGG + Intronic
944136568 2:196406106-196406128 GCTGGAGGAGGTTACCCTGAAGG - Intronic
1170335968 20:15270460-15270482 AGGGGAGGATGTGACTGTAAAGG + Intronic
1170807416 20:19644704-19644726 GGTGGAGGAGGTTAAACTAATGG - Intronic
952571471 3:34722690-34722712 GTTGGAGGAAGTTTCCCTAAGGG + Intergenic
954873786 3:53787388-53787410 GGTGATGGATGTTACTGAAATGG - Intronic
957950691 3:87122186-87122208 GGTGGAGGTTGTTAGGGTAAGGG + Intergenic
960033245 3:113076929-113076951 GGTGGATGTGGTTACTGTAATGG + Intergenic
960162498 3:114365632-114365654 TGTGCAGGATGTTACAGTAACGG + Intronic
968315426 3:197720293-197720315 CCTGGAGGATGTTACCTTAAGGG - Intronic
968489288 4:881429-881451 GGAGGAGGCTGTTTCTCAAACGG - Intronic
968970370 4:3790539-3790561 GGAGGAGGCTGTGTCTCTAATGG + Intergenic
974588309 4:63910544-63910566 AGTGGATGAGGTTACTGTAATGG - Intergenic
975888244 4:78991828-78991850 GGCTGGGGATGTTACGCTAATGG + Intergenic
976361641 4:84185566-84185588 GCTGGAGGCCGTTATTCTAAGGG - Intergenic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
978300540 4:107264988-107265010 GGTGGGTGTTATTACTCTAATGG + Intronic
979053598 4:115968668-115968690 AGTGAAGGAAGTTACTCAAAAGG - Intergenic
982376822 4:154700643-154700665 CCTGGAGGATGTTATACTAAGGG + Intronic
983250698 4:165342876-165342898 AGTGGAGTATTTTAGTCTAAAGG + Exonic
983682425 4:170369372-170369394 GATGGAGCATGTTACTCTGGTGG + Intergenic
986250147 5:6048138-6048160 GGAGGTGGTGGTTACTCTAATGG + Intergenic
986760830 5:10878191-10878213 TGTGGAGGATATTTCTCAAATGG + Intergenic
989627399 5:43443562-43443584 GGTGAAGGAAGTTAGTCTAGAGG + Intergenic
990315039 5:54575819-54575841 GGTGAAGGATGTAAAACTAATGG - Intergenic
991327990 5:65459198-65459220 TTAGGAGGATGTTAGTCTAAAGG - Intronic
991406423 5:66304951-66304973 GGAGGAGGATGTTTCCCTGAAGG + Intergenic
994890560 5:105628944-105628966 AGTGGAGGATGATACTATCAAGG - Intergenic
995381979 5:111545518-111545540 AGTAGGGGATGTTACTCTGAAGG - Intergenic
997847492 5:137301174-137301196 GGTGGAGGAGGTCCCTCTATAGG - Intronic
998074122 5:139222355-139222377 GGAGGAGGATGCTGCTCTGAGGG + Intronic
1000223472 5:159236041-159236063 GGTGGATGTAGTTACTATAATGG - Intergenic
1000694585 5:164364689-164364711 GTTGGCGGATGCTACTTTAAGGG - Intergenic
1001788582 5:174435307-174435329 GGTGGAGTTTGAGACTCTAAGGG - Intergenic
1005625571 6:27659172-27659194 GGTGGAGGATTTTGCTCTTTGGG - Intergenic
1006050138 6:31335928-31335950 GGTGGGGGATGTTGGTCTACTGG + Intronic
1008824434 6:55676177-55676199 TGTGCAGGATTTTACTTTAATGG - Intergenic
1017257533 6:152350671-152350693 GGTGCAGGACGTCACTTTAAAGG - Exonic
1020564856 7:9782319-9782341 ACTGGAGGATGTTACTATAGTGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1023626794 7:42123131-42123153 AGTGGAAGATGTTAATTTAAGGG - Intronic
1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG + Intronic
1027508482 7:79049067-79049089 GGTGGAGCATGTCACTCCTATGG - Intronic
1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG + Intergenic
1031417388 7:121509920-121509942 GGTGGAGGAAGGTGGTCTAAAGG + Intergenic
1031472068 7:122177588-122177610 GGAGAAGGATGTTACTGTTACGG - Intergenic
1031813276 7:126399461-126399483 GGTGAGGGATGTTATTCTGATGG + Intergenic
1032884901 7:136126978-136127000 GGGGGAGGATGGTTCTCAAAAGG - Intergenic
1037297302 8:17414140-17414162 GGTGGAGCATTGTACTCTTAGGG - Intergenic
1038982521 8:32775449-32775471 GCTGGAGGCTGTTATCCTAAGGG - Intergenic
1039131772 8:34272971-34272993 GGTTGAGGATTTCACTCTATAGG + Intergenic
1042117758 8:65450660-65450682 GGTGGAGGAAGCTGCTCTGAGGG - Intergenic
1042262244 8:66871358-66871380 GGTGGATGCTGCTGCTCTAATGG - Intronic
1042280612 8:67052390-67052412 GGTGAAGGATGTTACACAAAAGG + Intronic
1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG + Intronic
1044753899 8:95442200-95442222 GGTTAAGGAAGTTACTCAAAAGG - Intergenic
1049034561 8:140064335-140064357 GCTGGAGGTTGCCACTCTAAGGG + Intronic
1059779430 9:117510558-117510580 GGAGGAGGATTTTACACTAGTGG + Intergenic
1185764821 X:2716800-2716822 GGTGGAGGCTGTAAGACTAAGGG - Intronic
1187281687 X:17861718-17861740 GGTGGAGGATGCTTCTCACAAGG + Intergenic
1190729698 X:53217479-53217501 GGTGGAGGAAGTGACTGGAAGGG - Intronic
1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG + Intergenic
1193480547 X:82022413-82022435 GGTGGTGGCAGTTATTCTAAAGG - Intergenic
1195589139 X:106603667-106603689 GGTCAAGGGTGTTAATCTAATGG - Intergenic
1202088497 Y:21163715-21163737 GATGGAGGAAGGTAGTCTAAAGG + Intergenic