ID: 1100916581

View in Genome Browser
Species Human (GRCh38)
Location 12:99430572-99430594
Sequence GGTGGAGGATGTTACTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100916581_1100916587 12 Left 1100916581 12:99430572-99430594 CCATTAGAGTAACATCCTCCACC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1100916587 12:99430607-99430629 CCTTATTAATTTATCCCCTAAGG 0: 1
1: 0
2: 6
3: 53
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100916581 Original CRISPR GGTGGAGGATGTTACTCTAA TGG (reversed) Intronic