ID: 1100927000

View in Genome Browser
Species Human (GRCh38)
Location 12:99559518-99559540
Sequence TCTTTTCCCCACCATGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100927000_1100927001 18 Left 1100927000 12:99559518-99559540 CCAGTTGCATGGTGGGGAAAAGA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1100927001 12:99559559-99559581 CTGAAAACCTATTTTGTTGCAGG 0: 1
1: 0
2: 1
3: 25
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100927000 Original CRISPR TCTTTTCCCCACCATGCAAC TGG (reversed) Intronic