ID: 1100927000

View in Genome Browser
Species Human (GRCh38)
Location 12:99559518-99559540
Sequence TCTTTTCCCCACCATGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100927000_1100927001 18 Left 1100927000 12:99559518-99559540 CCAGTTGCATGGTGGGGAAAAGA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1100927001 12:99559559-99559581 CTGAAAACCTATTTTGTTGCAGG 0: 1
1: 0
2: 1
3: 25
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100927000 Original CRISPR TCTTTTCCCCACCATGCAAC TGG (reversed) Intronic
900230638 1:1555284-1555306 TCTCATCCCCGCCATGCACCAGG - Intronic
903277688 1:22232292-22232314 TCTTTTTCTGACCATGCACCTGG + Intergenic
903497143 1:23776968-23776990 TCTTTTCCCCACCAGGGAGTAGG + Intergenic
903802690 1:25981534-25981556 TCTTCTCCCCGCCATCCATCTGG + Intronic
905443700 1:38010688-38010710 TCTTTTCCACCACATGAAACAGG - Intronic
905552700 1:38856835-38856857 TCTTTTTCCCACCAGGAAAGAGG + Intronic
907219234 1:52893434-52893456 TCTTTTCCCCGCTCTCCAACAGG - Exonic
908414414 1:63898924-63898946 TCATTTCCCCATCAGACAACAGG - Intronic
908498071 1:64714985-64715007 TATTTTCCCCAGCATTCACCTGG + Intergenic
912342013 1:108925690-108925712 CTTTGTCCCCACCATGCCACTGG - Intronic
914821445 1:151107326-151107348 TCTTTGCCCCAACTTGCATCTGG - Intronic
915089608 1:153415477-153415499 CCTTTTCCTCACCATGCCCCAGG + Intergenic
915218222 1:154353881-154353903 TCTTCTTCCCACCATGCCCCAGG + Intergenic
916434872 1:164768709-164768731 TCATCTCCCCACCATGGACCTGG + Intronic
916626089 1:166556677-166556699 TCTTTTACCAATCATTCAACTGG - Intergenic
916849178 1:168685312-168685334 TCTTTTCAGTACCATGCAAGAGG - Intergenic
917169525 1:172155402-172155424 TCTTTTCTCCACCATAAAGCAGG - Intronic
917322711 1:173800319-173800341 TGTTTTCCCCACCATGCCTTTGG - Exonic
917656782 1:177134478-177134500 TCTGTTCCCCACCAACCCACTGG + Intronic
919340566 1:196301305-196301327 TGATTGCCCCACCATGCAATGGG - Intronic
922322760 1:224502835-224502857 TCTGTTCCCCACCATTCATATGG - Intronic
922555066 1:226526824-226526846 TCTTCGCCCCACCTTGCAAGTGG - Intergenic
922819722 1:228475901-228475923 TGGTTACCCCACCATGCAATGGG - Intergenic
923725115 1:236498977-236498999 TTTTTTACACACCATGCAACAGG + Intergenic
1063959204 10:11292886-11292908 TCATTTCCCTCCCAGGCAACAGG + Intronic
1063994052 10:11600118-11600140 TGTTTTTCACACCATCCAACAGG + Intronic
1064384904 10:14881403-14881425 TCTATTCCCCATCTTTCAACTGG - Intronic
1065525208 10:26613338-26613360 TCTATTCCACACCATGAAAAGGG + Intergenic
1065877951 10:30013302-30013324 TTTTTTCCCCCCCTTGAAACAGG - Exonic
1070722763 10:78768186-78768208 TGGTGTCCCCACCCTGCAACAGG + Intergenic
1070724877 10:78780997-78781019 TGTTATCCTCACCATGGAACAGG - Intergenic
1074265277 10:111895873-111895895 TCTTTTGCCCACTTTGTAACTGG - Intergenic
1074379031 10:112963499-112963521 CCATTTCCCCTCCTTGCAACAGG - Intronic
1075464872 10:122643579-122643601 TCTTGACCTCACCCTGCAACGGG - Exonic
1075873366 10:125787248-125787270 TATTTTCCCTGCCCTGCAACAGG + Intronic
1077768892 11:5192950-5192972 TCTTTTGCCCACTTTGCAATTGG + Intergenic
1082087989 11:48065768-48065790 TCTTCTCTCCACCCTGTAACAGG - Intronic
1085704972 11:78778747-78778769 TATTTTCCCCACCATGGCATAGG - Intronic
1087642079 11:100765732-100765754 TCTTTTCACAACCATGCAGAAGG - Intronic
1088455773 11:110031321-110031343 TCTTTTCCCCACCCTCCTTCAGG + Intergenic
1091921963 12:4311876-4311898 TCTCTTCCCCACTAAGTAACAGG + Intergenic
1095767783 12:45915775-45915797 TGTTTTCCCCACCAAGCATATGG + Intergenic
1100927000 12:99559518-99559540 TCTTTTCCCCACCATGCAACTGG - Intronic
1101572465 12:105966421-105966443 TCTTTTCTCCAATATGCAAATGG + Intergenic
1102657901 12:114498571-114498593 TCTTTTCCCTTCCATGGAAACGG - Intergenic
1104647432 12:130507100-130507122 TCATTCCCCCAGAATGCAACTGG - Intronic
1104835259 12:131786185-131786207 ACTTTTAACCAACATGCAACTGG - Intronic
1105905508 13:24806034-24806056 TCTTGTCCCCACCCCACAACAGG + Intronic
1108434390 13:50387359-50387381 TCAGTTCACCACCATGCAACAGG + Intronic
1114044470 14:18710958-18710980 TCTTTTCTCCACCATTCTATAGG - Intergenic
1114048755 14:18901409-18901431 TCTTTTCTCCACCATTCTATAGG - Intergenic
1114113759 14:19500237-19500259 TCTTTTCTCCACCATTCTATAGG + Intergenic
1114115458 14:19617984-19618006 TCTTTTCTCCACCATCCTATAGG + Intergenic
1114369909 14:22075346-22075368 TCTTTTCCCCAGCTTGCAGATGG + Intergenic
1114685276 14:24524377-24524399 TCAGCTCCCCACAATGCAACTGG - Intergenic
1116377366 14:44220545-44220567 TCTGTTACCTACCATGTAACAGG + Intergenic
1117285428 14:54282217-54282239 TTTTATCCCCACCATTCAGCAGG + Intergenic
1120402343 14:84047893-84047915 TCTTTTCCCCACCATTTCTCAGG - Intergenic
1120485272 14:85105077-85105099 TCTTTTCCCCATTATCTAACAGG - Intergenic
1121434667 14:93911170-93911192 TCCCTTCCCCACCATCCAGCAGG + Intergenic
1124140024 15:27069000-27069022 TTGTTTCCCCACCTTGCAAATGG + Intronic
1125450748 15:39804148-39804170 TCTGTTTCCCAACATGTAACGGG - Intronic
1128138193 15:65279709-65279731 TCATTTCCTCACCATCCAGCAGG + Intronic
1129699262 15:77758220-77758242 TCTCTCTCCCACCATGCATCTGG + Intronic
1130308169 15:82729318-82729340 TCCCTTCCCAACCAAGCAACAGG + Intergenic
1130772086 15:86934784-86934806 TATTTTCCTCACCATGTATCTGG - Intronic
1134279076 16:12802141-12802163 TCCCTTCCCCACCATGCCCCAGG - Intronic
1135132136 16:19861906-19861928 TCTTTTCCCCAAGCTGCCACTGG + Exonic
1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG + Intronic
1138068810 16:53970089-53970111 TACTCTCCTCACCATGCAACAGG - Intronic
1139992974 16:70954643-70954665 TCAATTCTCCACCATGCAGCTGG + Intronic
1141155241 16:81592720-81592742 CCTTTTCTCCTCCATGGAACTGG + Intronic
1141601020 16:85126518-85126540 ACTTTTCCCCACCATCCACGAGG + Intergenic
1142223036 16:88864653-88864675 ACACTTCCCCACCATGCCACTGG + Intronic
1142863671 17:2777904-2777926 TTTACTCCCCACCCTGCAACAGG - Intronic
1143703049 17:8675647-8675669 TCTTCTTCCCACCATTCAAATGG + Intergenic
1144586374 17:16490215-16490237 TGTTTCCCCCACCCTGCAATGGG - Intronic
1145019012 17:19415683-19415705 TCTTTTCCCCTCCCTGTCACAGG + Exonic
1146241374 17:31230820-31230842 TCTTTTCTCCACCATTCTATAGG + Exonic
1147459611 17:40559863-40559885 TCCTTCCCCCACACTGCAACAGG - Intronic
1150646736 17:66983321-66983343 CCTTTTCCCCAGCGTGCAGCAGG - Intronic
1155177075 18:23310261-23310283 TCCTTTCCCCAGGATGCACCTGG - Intronic
1157024812 18:43830043-43830065 TCTTTTCACCACCAACCAAAGGG - Intergenic
1157618536 18:49002079-49002101 TCTGTCACCCACCCTGCAACGGG - Intergenic
1158750761 18:60257311-60257333 TCTTTTGCCCACCTTTCAATGGG - Intergenic
1166129559 19:40737814-40737836 TGGTTTCCCCTCCATGCACCTGG - Intronic
925732032 2:6926145-6926167 CCTTTGCCCCATCATGCAAAAGG + Intronic
927296654 2:21462740-21462762 TCTTTTCACCTCCATGCACAGGG + Intergenic
930303421 2:49646746-49646768 TCTTTTCCCCACTATTTAAAGGG + Intergenic
934699964 2:96431150-96431172 TTTTAGCCCCACCATTCAACAGG - Intergenic
936613324 2:114023344-114023366 TCTTTTCCCCACCCTCTGACAGG + Intergenic
938426118 2:131189917-131189939 TCTTTTCTCCACCATTCTATAGG - Intronic
939644764 2:144684014-144684036 TCTTTTCCATGCCATACAACTGG - Intergenic
939693817 2:145298898-145298920 TATTTTACCCACCAAGCATCAGG - Intergenic
940816892 2:158306671-158306693 CCCTTCCCCCACCCTGCAACAGG - Intronic
941422388 2:165298605-165298627 TCTTTTTCCCCACATGCTACTGG - Intronic
943670344 2:190653613-190653635 TCTTCTCCCCTCCATGCTATGGG - Intronic
947031230 2:225798223-225798245 TCTTTTCCCCAACAGTAAACAGG + Intergenic
947039161 2:225895524-225895546 TCTTTTCCCCACCACACTGCAGG - Intergenic
1172333588 20:34094856-34094878 TTTTTTCCCCAAAATGCAATAGG + Intronic
1173427097 20:42952844-42952866 TCTTTTTCCCACCATTAAAATGG + Intronic
1175210337 20:57350383-57350405 CATTTTCCCCACCATGCAGCAGG + Intergenic
1175261472 20:57676886-57676908 TCTATTCTCCACCCTGCAGCCGG + Intronic
1177418385 21:20824487-20824509 TGATTTTCCCACCATGCAATAGG + Intergenic
1178085090 21:29104450-29104472 TGTTCTGTCCACCATGCAACTGG - Intronic
1178385030 21:32142120-32142142 TCTCAGCCCCACCATGCATCCGG + Intergenic
1180467290 22:15624069-15624091 TCTTTTCTCCACCATTCTATAGG - Intergenic
1182109009 22:27709787-27709809 TCTTTGCCCCTCCATGCAGAAGG + Intergenic
1182359312 22:29737529-29737551 TGCTTTCCCCATCTTGCAACGGG - Intronic
1182829500 22:33293541-33293563 TGTCTTCCCAACCTTGCAACTGG + Intronic
1184678702 22:46057871-46057893 TCTTTTCCACACGATGACACTGG - Intronic
1185242151 22:49752332-49752354 TCTTATCCCCAGCATGCACTTGG + Intergenic
951315573 3:21185907-21185929 TGATCTCCCCACCATGCACCTGG - Intergenic
953805269 3:46062730-46062752 TCCTTTCCCCAGGAGGCAACAGG + Intergenic
957331887 3:78776085-78776107 TCTTTTCCCCACCCTTCTATGGG + Intronic
958615061 3:96482738-96482760 CCTTTTCCCCACCCCCCAACAGG + Intergenic
959207773 3:103334235-103334257 TCTCTTCCCTCCCATGAAACGGG - Intergenic
960977827 3:123193553-123193575 ACTTTTCTCCTCCATGCAATGGG - Intronic
963009427 3:140755371-140755393 TCTTTTCCACCCCTTGCACCTGG - Intergenic
964689054 3:159429632-159429654 TTTTCTCCCCACCATGAAGCAGG + Intronic
966898174 3:184461403-184461425 TCTTTCCCCTACAAGGCAACAGG + Intronic
969959603 4:10930473-10930495 TACTTTCCCCACAATGCAGCAGG + Intergenic
969990150 4:11253762-11253784 CCTTTTACCCTCCATGGAACTGG + Intergenic
970174885 4:13329600-13329622 TTTTTCCCCCATCCTGCAACTGG + Intergenic
971491887 4:27221415-27221437 ACTTTTACTCACCATGGAACTGG - Intergenic
974587905 4:63903508-63903530 TCATTTCCACACAATGCCACAGG - Intergenic
976698183 4:87940538-87940560 TTTTTTCTCCATTATGCAACTGG - Intergenic
979692256 4:123572674-123572696 TCTTTGCAGCACCATGCAGCTGG + Intergenic
981269324 4:142826203-142826225 TCTTTTCCCCAGAATTCAGCTGG + Intronic
981545191 4:145886240-145886262 TCATTTCCTCACCGTGCAAAGGG + Intronic
982123982 4:152168786-152168808 TCTTATCCCCTCCCTGCAAATGG + Intergenic
983542295 4:168924933-168924955 CCTTTTCTCCAGCATGCACCAGG + Exonic
984609988 4:181827077-181827099 TCTTTTCCCTACCTTCCAAGGGG + Intergenic
985019430 4:185671652-185671674 TCTCTTCCCTACCCTGCTACTGG - Intronic
986022769 5:3820453-3820475 TCCCTTCCCCTCCAGGCAACAGG - Intergenic
986171213 5:5316315-5316337 TTTTTCACCCACCATGCACCAGG + Intronic
988120073 5:26950099-26950121 TTTCTTCCCCATCATGCAACTGG + Intronic
989087913 5:37695410-37695432 TCATTTCCCCACCATGCCTTTGG + Intronic
989333688 5:40289577-40289599 AATTTTCCACACCATTCAACTGG - Intergenic
990628466 5:57641059-57641081 TCTCTTCAACCCCATGCAACCGG + Intergenic
991280181 5:64904560-64904582 TCTTCTCCCCACCATACCAAAGG - Intronic
991726499 5:69540953-69540975 TCTCTTCCTCACCATGCTAGTGG + Intronic
991868458 5:71086921-71086943 TCTCTTCCTCACCATGCTAGTGG - Intergenic
993889140 5:93451766-93451788 TTTTTTCCCTACCAAGCACCTGG + Intergenic
994788684 5:104196712-104196734 TCATTTCCCCAGCATACAATAGG + Intergenic
995498275 5:112772888-112772910 TCTTTTTCCCACCTTGGACCTGG + Intronic
1001795369 5:174497993-174498015 TCTTTCCACCACCATGTAAGAGG + Intergenic
1001822116 5:174718626-174718648 CTTATTCCCCACCAGGCAACTGG + Intergenic
1003825840 6:9950609-9950631 TCTTTTGCCCATCCTGTAACTGG - Intronic
1004164191 6:13241269-13241291 TCTGTTCCCCACATTGCAACAGG - Intronic
1005437286 6:25828145-25828167 TATTTTTCCCACCTTGGAACTGG - Intronic
1007085991 6:39145882-39145904 TCTTATCCCCATCCTGAAACTGG + Intergenic
1007582967 6:42970098-42970120 CCTTTTCCCCACCATGACTCGGG - Intronic
1008206821 6:48670186-48670208 TCTTTTCTCCCCCCTGCATCAGG - Intergenic
1009900021 6:69798808-69798830 ACTTTCCCCCACCCTACAACAGG + Intergenic
1010093548 6:72012323-72012345 TCTTTCCCCCACCCTACAACAGG - Intronic
1011385515 6:86793628-86793650 TCTTTTGCCCACTTTGCAACTGG + Intergenic
1018238884 6:161753395-161753417 TTTTTTCCCCTCCATCCCACTGG - Intronic
1019564402 7:1672257-1672279 TCCCTTCCCCACCATGCCCCAGG + Intergenic
1023189494 7:37564349-37564371 TTTGTTCCCCACCCTCCAACAGG + Intergenic
1028539963 7:91931953-91931975 CCTTTCCCCCACCCTGCCACAGG - Intergenic
1028808187 7:95053394-95053416 TAATTTTCCCACAATGCAACTGG + Intronic
1031066396 7:117110419-117110441 ACTCTTCCCCACCGTACAACAGG + Intronic
1033411443 7:141121760-141121782 TCTTTTCCTCCCCATGAACCTGG + Intronic
1034529635 7:151687787-151687809 TCTTCTCCCCAACATTCCACAGG - Intronic
1037170248 8:15883529-15883551 TCTTTTGCCCACTATTCCACTGG + Intergenic
1042959914 8:74292526-74292548 TCTTTTCCCCCATATGCAGCTGG - Intronic
1046990092 8:120443302-120443324 TTTTTTCCCCCCCAAGCAATGGG - Exonic
1048426367 8:134327739-134327761 TTTTCTCCCCACCATGCCCCTGG + Intergenic
1048992719 8:139770753-139770775 TGTTTTCCCCACCACGCTAAGGG - Intronic
1051488712 9:17637007-17637029 TCCTTTCCCTTCCAGGCAACTGG - Intronic
1052057323 9:23920142-23920164 TCTTCTCCAGACCATCCAACAGG - Intergenic
1052192146 9:25673410-25673432 TCTTTTCCACACAAGGCAAATGG + Intergenic
1053397139 9:37785327-37785349 TCGTATCCCCACGATGCGACCGG - Intronic
1057139859 9:92719825-92719847 TCTTTCCCCAACCATGCTACAGG + Intronic
1058646364 9:107134961-107134983 TCTTTTCCCAACCATAGGACTGG - Intergenic
1058729949 9:107840177-107840199 TCTTTTCCCCCACAATCAACAGG - Intergenic
1060188331 9:121577212-121577234 TCTTTTCCCCAGAATCCCACTGG - Intronic
1060877146 9:127091626-127091648 TCTTTTCCCTACCCTGCACCTGG + Intronic
1061786269 9:133030472-133030494 CCTTTTCCCCACCAAGCAGGCGG + Intergenic
1186527290 X:10260537-10260559 TCACTACCCCACCCTGCAACCGG + Intergenic
1187751271 X:22467890-22467912 TCATTTCCCCATCTTTCAACTGG + Intergenic
1188262180 X:28034777-28034799 TCTTTTCCACAGCAGGCACCAGG + Intergenic
1192178601 X:68901509-68901531 TCTGTTTCCCACTATACAACTGG - Intergenic
1193908763 X:87277031-87277053 CCTTCTCCCCACCCTGCGACAGG + Intergenic
1195041518 X:101019206-101019228 TCTTTTCCACACCATGCTACGGG - Intronic
1196562725 X:117169819-117169841 CCTTTTCCCCACCCCACAACTGG - Intergenic
1197573182 X:128175468-128175490 TCTTTTCCCCACCTTTTAAAGGG - Intergenic
1197942737 X:131806422-131806444 TCTCCTCCCCATCCTGCAACAGG + Intergenic
1198500146 X:137236355-137236377 TCTTTTCCCCAGCTGGCATCAGG - Intergenic
1199340002 X:146666491-146666513 CCTTGTCCCCACCCTCCAACAGG - Intergenic
1201308796 Y:12575531-12575553 CCTTTCCCCCACCCCGCAACAGG - Intergenic
1202243301 Y:22791877-22791899 TCTTCTCCAAACCATCCAACAGG + Intergenic
1202396288 Y:24425627-24425649 TCTTCTCCAAACCATCCAACAGG + Intergenic
1202474496 Y:25244465-25244487 TCTTCTCCAAACCATCCAACAGG - Intergenic