ID: 1100927001 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:99559559-99559581 |
| Sequence | CTGAAAACCTATTTTGTTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 328 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 25, 4: 301} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100927000_1100927001 | 18 | Left | 1100927000 | 12:99559518-99559540 | CCAGTTGCATGGTGGGGAAAAGA | 0: 1 1: 0 2: 1 3: 10 4: 183 |
||
| Right | 1100927001 | 12:99559559-99559581 | CTGAAAACCTATTTTGTTGCAGG | 0: 1 1: 0 2: 1 3: 25 4: 301 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100927001 | Original CRISPR | CTGAAAACCTATTTTGTTGC AGG | Intronic | ||