ID: 1100933060

View in Genome Browser
Species Human (GRCh38)
Location 12:99632584-99632606
Sequence CATTCTGCACAAACTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100933060_1100933063 -4 Left 1100933060 12:99632584-99632606 CCCACATCAGTTTGTGCAGAATG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1100933063 12:99632603-99632625 AATGCTAGTCATGGAGTCAAAGG 0: 1
1: 0
2: 8
3: 227
4: 1929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100933060 Original CRISPR CATTCTGCACAAACTGATGT GGG (reversed) Intronic
901892945 1:12283652-12283674 CATTCTGCACAACGTGAAGTTGG + Exonic
905135762 1:35798435-35798457 CATTCTCCACAAACTGACACAGG - Intergenic
905223860 1:36466824-36466846 CATCCTGCACACAAGGATGTGGG + Exonic
906021296 1:42631822-42631844 CATTCACCACAAGCTGATTTAGG - Intronic
906336350 1:44934959-44934981 CCCTCTGCACTAACAGATGTTGG - Intronic
906892195 1:49729630-49729652 CATACGGAAGAAACTGATGTCGG + Intronic
907024320 1:51100589-51100611 CATTCTGCACAAACTCTAATTGG - Intergenic
909414594 1:75391319-75391341 AATTCTGCAAAAAATGGTGTTGG - Intronic
912719623 1:112008807-112008829 CATAGTGAACAAGCTGATGTGGG - Intergenic
913746894 1:121916046-121916068 GATTCTGCACAAAGTGTTTTTGG + Intergenic
916455947 1:164971174-164971196 CATTAGGGAGAAACTGATGTGGG - Intergenic
918355350 1:183702679-183702701 CATGGGGCACATACTGATGTGGG + Intronic
919012247 1:191980351-191980373 AATTCTGTAAAAAATGATGTTGG + Intergenic
919373575 1:196763401-196763423 CATTCACCACAAACTGACTTAGG - Intergenic
919380015 1:196848078-196848100 CATTCACCACAAACTGACTTAGG - Intronic
922622764 1:227003106-227003128 CATTCAGCAAATACTGATTTTGG - Intronic
923091202 1:230742655-230742677 AACTCTGCATACACTGATGTGGG - Intergenic
923266544 1:232319825-232319847 CCTGCTCCACAAAATGATGTGGG + Intergenic
1063195297 10:3735856-3735878 AAGTCTGGAGAAACTGATGTGGG + Intergenic
1063355077 10:5391326-5391348 CATTCTGCACAGACTCTGGTTGG - Intergenic
1067533752 10:47093068-47093090 CTTTCTTCACAAACTCTTGTGGG - Intergenic
1069711887 10:70494786-70494808 CATTCTGCAGACAGTGAAGTAGG + Intronic
1071184752 10:83028907-83028929 CATTCTTAGCAAACTGATGCAGG + Intergenic
1074849272 10:117426007-117426029 CATTCTGCGAAAACTGAGGAAGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1085714052 11:78856118-78856140 GATTCTGGAGAAATTGATGTGGG - Exonic
1086180227 11:83941959-83941981 CACTCTCCACACACTGGTGTTGG + Intronic
1086199034 11:84178172-84178194 CATTCTGCTCCAAATGAAGTTGG - Intronic
1087704608 11:101476168-101476190 CATTCTTCAGATACAGATGTTGG + Intronic
1089273649 11:117318116-117318138 CATTATTCAAAAACTGTTGTTGG + Intronic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1092919566 12:13219029-13219051 CATTTGGGACAAAGTGATGTTGG - Exonic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1094764268 12:33574123-33574145 AATTCTGCCCCTACTGATGTAGG - Intergenic
1098478632 12:70936386-70936408 CATTCTGCATAAACTCCAGTTGG - Intergenic
1100933060 12:99632584-99632606 CATTCTGCACAAACTGATGTGGG - Intronic
1101569893 12:105944057-105944079 CATTCTGCATAAACTAAAATGGG + Intergenic
1105948409 13:25209066-25209088 CATTCTGAGCATAATGATGTAGG + Intergenic
1106119724 13:26850022-26850044 CTGTCTGCACAAACTTATTTTGG - Intergenic
1108342742 13:49514008-49514030 CTTTCTGCACCAACTGCTGGGGG + Intronic
1108795703 13:54027448-54027470 CATTCTTAACAAACTAATGCAGG + Intergenic
1109096453 13:58123245-58123267 TATTCTAAACAAACTAATGTAGG + Intergenic
1109586625 13:64412720-64412742 CATTCTGTGCAAACTCTTGTTGG + Intergenic
1112137813 13:96602402-96602424 CATTCTTCATACACTGATTTTGG + Intronic
1112697532 13:101967418-101967440 TATACTGCAGAAACTGATATTGG - Intronic
1115724687 14:36200260-36200282 CATGCTGCACTAACTCTTGTTGG - Intergenic
1116805250 14:49488193-49488215 CATTCTTAGCAAACTAATGTAGG - Intergenic
1117757428 14:58990277-58990299 CATTCAGCAGAAACTGCTGTGGG + Intergenic
1118126260 14:62908066-62908088 CATACTACACAAACTTTTGTGGG + Intronic
1118522899 14:66606500-66606522 AATTTTGCAAAAAATGATGTTGG + Intronic
1122501511 14:102203106-102203128 CATTCTGCACCTACTGCTGGGGG + Intronic
1123954179 15:25316691-25316713 GAATCTGCACACACTGATGATGG + Intergenic
1124011563 15:25843285-25843307 GCCTCTGCACACACTGATGTGGG - Intronic
1126051810 15:44693033-44693055 CATTCTGAGCACACTCATGTTGG - Intronic
1128230811 15:66033681-66033703 CAGTCTGGACACACTGGTGTGGG - Intronic
1128609461 15:69062351-69062373 CATCCTCCACACACTGCTGTGGG + Intronic
1129160610 15:73745637-73745659 CATTCTGCAAACACAGCTGTTGG + Intronic
1129612034 15:77068751-77068773 CATCCTCAACAAACTGATGCAGG - Intronic
1130699258 15:86162585-86162607 CATGCTGCACACACTTGTGTTGG + Intronic
1130732710 15:86515752-86515774 AATTCTTCACAAACAGTTGTTGG + Intronic
1130892687 15:88146621-88146643 CATTCTGCACAAACAAAGGAAGG - Intronic
1132414042 15:101607943-101607965 CATCCTGCTGAAACTGATTTGGG + Intergenic
1132910263 16:2306646-2306668 CATTCTGCAAAGCCTGCTGTGGG - Intronic
1133724282 16:8522944-8522966 CATTCTCCACCCACTCATGTTGG + Intergenic
1133845275 16:9447700-9447722 CATTCTTCCCAGACTCATGTGGG - Intergenic
1134819644 16:17236468-17236490 CAGTGTGGAAAAACTGATGTGGG + Intronic
1135460753 16:22640674-22640696 CATTCTTAGCAAACTAATGTGGG + Intergenic
1137821551 16:51450238-51450260 CATTCTGGAAAAACTGATCAAGG + Intergenic
1141811749 16:86380605-86380627 CATTCTGCACAGACAGTCGTTGG + Intergenic
1147310031 17:39590260-39590282 TATTCTCCACAAACTAATGCAGG + Intergenic
1147968360 17:44206372-44206394 GATTCACAACAAACTGATGTGGG + Exonic
1148774949 17:50090029-50090051 AATTCTGGACAGACAGATGTTGG + Intronic
1149090090 17:52767721-52767743 AATTCTGTAAAAAATGATGTTGG - Intergenic
1150466595 17:65398433-65398455 CGTGGTCCACAAACTGATGTTGG + Intergenic
1152205249 17:78971236-78971258 CTTTCTGTACAAACAAATGTAGG + Exonic
1153108467 18:1556250-1556272 AAATCTGTAAAAACTGATGTTGG + Intergenic
1156548445 18:37989453-37989475 AATTTTGCAAACACTGATGTGGG - Intergenic
1156721309 18:40073288-40073310 AATTTTGCAGAAACTGAGGTGGG + Intergenic
1157374928 18:47153659-47153681 CATCCTTAACAAACTAATGTAGG - Intronic
1157618658 18:49002807-49002829 CATTCTTCACAAAGGCATGTGGG - Intergenic
1157900703 18:51513990-51514012 CAGTCAGCGCAAACTGATGTTGG - Intergenic
1159292649 18:66441793-66441815 CATTCTTCACAAATTTATTTAGG + Intergenic
1161897313 19:7092188-7092210 CATTCTGCACAAACTCCATTTGG + Intergenic
1164722471 19:30442286-30442308 CATTCTGCACAGGCTGAAGAGGG + Intronic
925814569 2:7735163-7735185 AATTCTGCAAAAACTGATTGAGG + Intergenic
928212194 2:29331604-29331626 CTTTCTGCACACACTGGTGCTGG + Intronic
928948012 2:36789572-36789594 TATTCAGCAGAAACTGCTGTTGG + Intronic
929352465 2:40974559-40974581 CATTCTGAATAAATTGAAGTGGG + Intergenic
930341067 2:50115399-50115421 TCTTCAGCACAAACTGATTTTGG + Intronic
932540815 2:72650229-72650251 ATTTTTCCACAAACTGATGTAGG - Intronic
933307204 2:80616552-80616574 CATTCTGACCAGACAGATGTAGG - Intronic
934065499 2:88337040-88337062 AATGCAGCAGAAACTGATGTTGG + Intergenic
935635312 2:105245309-105245331 CAGTCTGAACAAACTGATATAGG - Intergenic
936547356 2:113404220-113404242 CCTTCTGGAGTAACTGATGTAGG - Intergenic
936722250 2:115266622-115266644 CATTCTGGACAAAATCATATGGG - Intronic
937783595 2:125869014-125869036 CTTACTGGAGAAACTGATGTGGG + Intergenic
942267360 2:174242025-174242047 AATTCTGGACAAAGGGATGTTGG + Intronic
943517053 2:188901884-188901906 AATTCTGCTCAAACATATGTGGG + Intergenic
948681283 2:239636368-239636390 GATTCTGCACAATGTGCTGTGGG - Intergenic
1168940195 20:1704263-1704285 CAGTCTTCAAAAACTGGTGTTGG + Intergenic
1172935945 20:38620325-38620347 CATGCTGCAAAATGTGATGTTGG + Intronic
1175048430 20:56129285-56129307 CTTTTTGGACAAACTGCTGTGGG + Intergenic
1176804730 21:13469398-13469420 AATTCTGCAAAAAATGTTGTTGG - Intergenic
1177348377 21:19901541-19901563 CATTCTCAACAAACTAACGTGGG - Intergenic
1177380933 21:20343492-20343514 CATTCTTTACAAACTAGTGTAGG - Intergenic
1177631316 21:23732313-23732335 CTTTCAGCAAAAACTGATTTTGG - Intergenic
1178004297 21:28198976-28198998 AATTCTGCAAAAAATGACGTTGG - Intergenic
1183196989 22:36360376-36360398 CAATATGCACAAAATGTTGTAGG + Intronic
1184973711 22:48046078-48046100 CATTCCGCAAAAACAGAAGTTGG - Intergenic
951285320 3:20804835-20804857 CATTCTGTGAAAACTGATGTTGG + Intergenic
951522883 3:23625900-23625922 CATTCTGGGCACACTGGTGTGGG + Intergenic
952980575 3:38731656-38731678 CATTCTGCACAAACTCCAGTCGG - Intronic
954410341 3:50367870-50367892 CCTTCTGCACAACCTGATCTTGG - Exonic
956921455 3:73934024-73934046 CATTCTGCACAACATCATGAGGG - Intergenic
958512506 3:95066356-95066378 AATTCTGCAAAGAATGATGTTGG + Intergenic
958890922 3:99781995-99782017 CATTCAGCAAATATTGATGTAGG - Intronic
959433456 3:106284104-106284126 CATCCTGGACAAACTGGAGTGGG - Intergenic
959570783 3:107881033-107881055 CAATATGGAAAAACTGATGTGGG + Intergenic
964144614 3:153443908-153443930 CATTCTGCATAAACTCCAGTTGG - Intergenic
968815094 4:2818006-2818028 CAGGCTGCACCAACAGATGTGGG + Intronic
968888624 4:3353311-3353333 CAGTGTGCACACACTGATCTAGG - Intronic
969162728 4:5275632-5275654 CGTGCTGCAGAAACTGATGGGGG - Intronic
969259274 4:6023317-6023339 AAATATGAACAAACTGATGTCGG - Intergenic
969504026 4:7572603-7572625 CATTCTGCACAAAGATGTGTAGG + Intronic
969562034 4:7955236-7955258 CACTGTGCCCAAACTGATGCTGG - Intergenic
970544001 4:17108138-17108160 CATTCTTAACAAACTAATGCAGG - Intergenic
971327156 4:25654135-25654157 CGTGCTGCACACACTGCTGTCGG - Intergenic
971583293 4:28371201-28371223 AATTCTGTGAAAACTGATGTTGG + Intronic
971924556 4:32990531-32990553 CATTTTGCACAAACCAATTTGGG - Intergenic
972527869 4:39933204-39933226 CATTCTCAGCAAACTGATCTGGG - Intronic
975371814 4:73597841-73597863 CATTCTTAGCAAACTGATGCAGG + Intronic
975585780 4:75947209-75947231 CATTCTGCAAATTTTGATGTTGG + Intronic
976949130 4:90807862-90807884 AATTCTGCAAAAAATGACGTTGG - Intronic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
978200019 4:106015023-106015045 CATTCTGCTCTAGCTGATGCTGG - Intergenic
979456160 4:120927991-120928013 CATCCTGAGCACACTGATGTAGG - Intergenic
980411147 4:132421028-132421050 TATTCTGCAACAAATGATGTAGG - Intergenic
981215137 4:142156386-142156408 CATTTTGGACAAACTAATCTTGG + Intronic
982201285 4:152963422-152963444 CACTGTGCACAAACTCCTGTTGG - Intronic
982891730 4:160862097-160862119 CATTCTGATAAAACTGGTGTGGG - Intergenic
983717754 4:170806082-170806104 CATTCTGCAAATTTTGATGTGGG + Intergenic
984320101 4:178184864-178184886 CGTTCTGGTCACACTGATGTAGG + Intergenic
984368829 4:178834751-178834773 CAATCTGCAGAAAATGATTTCGG + Intergenic
985159092 4:187025371-187025393 CATTCTACACAACATGATGATGG + Intergenic
985900799 5:2789049-2789071 CCTTGTGCACAAGCTCATGTGGG + Intergenic
987866374 5:23544709-23544731 AATTCTGCGAAAAATGATGTTGG + Intergenic
987892076 5:23892200-23892222 CATTCTGAACAAACTAACATAGG - Intergenic
988031279 5:25766595-25766617 AATGCTGCACAAAGTAATGTCGG + Intergenic
989507316 5:42242433-42242455 AGTTCTGCATCAACTGATGTTGG + Intergenic
989944983 5:50212929-50212951 CTTTCTGCAGAAACTGCAGTTGG - Intergenic
991137277 5:63196852-63196874 AATTCTGTGAAAACTGATGTTGG - Intergenic
991310087 5:65229008-65229030 CATTCTCCCCCAACTGCTGTAGG + Intronic
991351868 5:65727588-65727610 CATGCTGTACAATCTGAGGTAGG - Intronic
991552813 5:67860794-67860816 CATCCTTAACAAACTAATGTAGG + Intergenic
992044578 5:72872940-72872962 CATTCTACAAACACTGATTTTGG + Intronic
993593212 5:89821859-89821881 AATTCTGTGCAAAATGATGTTGG + Intergenic
994760076 5:103841145-103841167 CATTCCCCACAGACTGCTGTGGG + Intergenic
995997070 5:118313786-118313808 CATTCTACACAAACAACTGTTGG + Intergenic
997773085 5:136571902-136571924 AATTCTGTAAAAAATGATGTTGG + Intergenic
1000954038 5:167521079-167521101 CATTCTGGAGAGACTGAGGTTGG + Intronic
1001461795 5:171922177-171922199 CATTTTGTAAAAACTGATATAGG + Intronic
1001791469 5:174460924-174460946 CAGTCTGGACATACTGGTGTTGG + Intergenic
1004085050 6:12439230-12439252 CATTCTCCACAAACTGGTGAAGG - Intergenic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1005949097 6:30617960-30617982 CATTTTGCACAACCTCAAGTTGG + Intronic
1006997886 6:38279464-38279486 TATTCTGAAAAAACTGATGAAGG - Intronic
1011630847 6:89322574-89322596 AATTCTGCAAAAAATGATGTTGG - Intergenic
1013472838 6:110479864-110479886 GATTCTGCACAAACTGTTCAAGG + Intergenic
1014331587 6:120073540-120073562 CAGTAAGCACAAACTGAAGTAGG + Intergenic
1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG + Intronic
1019571860 7:1716589-1716611 CATTCTGCACACACAGGTGTAGG + Intronic
1021055141 7:16037459-16037481 CATTCTGCACAATATAATCTAGG + Intergenic
1023856108 7:44185378-44185400 CATTCTGGCCCATCTGATGTGGG - Intronic
1026555000 7:71400265-71400287 CATTCTGAGCAAACTAATGCAGG - Intronic
1027485673 7:78758812-78758834 CATTCTTCAAAATCTTATGTAGG + Intronic
1027754750 7:82198508-82198530 CATTCTGAATTAAGTGATGTGGG - Intronic
1030361657 7:108601557-108601579 GATTGTGCACAAATTGATTTGGG + Intergenic
1030929139 7:115500590-115500612 CATTCTGTGAAAAATGATGTTGG - Intergenic
1031503837 7:122556556-122556578 CATTCTGCAAATGCTGATGATGG + Intronic
1031919276 7:127589111-127589133 AATCCTGTACAAACTGAAGTTGG + Exonic
1032341685 7:131079717-131079739 CCTCCTGCACAAACTGCTCTGGG - Intergenic
1035631269 8:1108245-1108267 CATTCAGCACATACTGAGTTTGG - Intergenic
1037060726 8:14506244-14506266 CATGCTGCACAAACATATGGTGG - Intronic
1037088832 8:14887095-14887117 CATTCTCCACATCCTTATGTTGG + Intronic
1037131425 8:15411950-15411972 CATTCTGGAATCACTGATGTTGG + Intergenic
1038354063 8:26810281-26810303 CATTCTGTAGAAACTGCTTTGGG - Intronic
1040763446 8:50877723-50877745 CATTCTCCACAAACTAATGCAGG + Intergenic
1041967843 8:63701290-63701312 GATTCTGCACCAACTGAAGGAGG - Intergenic
1042428221 8:68673437-68673459 CATTCACCACAAGCTGATGGAGG + Intronic
1043789021 8:84439110-84439132 AATTCTGTAAAAAATGATGTTGG + Intronic
1044462083 8:92457451-92457473 CATTCTGAACTGACTGAAGTGGG + Intergenic
1045441890 8:102221980-102222002 AATCCTGCCAAAACTGATGTAGG - Intronic
1046094190 8:109538914-109538936 CAATTTGCATAAACTGATTTTGG + Intergenic
1048571534 8:135661024-135661046 CATTCTGGACACACTGGGGTAGG + Intergenic
1049458588 8:142709287-142709309 CATTCTGGACACACTGGGGTGGG + Intergenic
1050018021 9:1256047-1256069 CATTCTGCACATCCTGAAATGGG - Intergenic
1051398529 9:16654047-16654069 CAGTCTGCACAGAGTGATCTGGG + Intronic
1058810651 9:108635650-108635672 TATTCTTCCCAAACTGAGGTGGG - Intergenic
1059718272 9:116933739-116933761 CATCCTGTACAGACTCATGTGGG - Intronic
1196053834 X:111333871-111333893 CTTTCTGCACAAAGAGATGAGGG + Intronic
1196340878 X:114595822-114595844 TATTCTGCAGAAAATGATTTGGG - Intronic
1196805954 X:119586238-119586260 AATTCTGCACGTGCTGATGTGGG + Intergenic
1197157786 X:123289145-123289167 CATTCTCAGCAAACTGATGCAGG + Intronic
1198547750 X:137710947-137710969 ACTTCTGCACAAAGTGCTGTTGG - Intergenic
1199159820 X:144596299-144596321 CATTCTGAACAACCTGAAGCTGG + Intergenic
1199193036 X:144994531-144994553 GATTCTGCAAAAAATGATGTTGG + Intergenic
1200008173 X:153101729-153101751 CTTTCCGGACACACTGATGTGGG + Intergenic
1200152440 X:153957859-153957881 CAATCTGGGCAAAGTGATGTCGG - Exonic