ID: 1100935634

View in Genome Browser
Species Human (GRCh38)
Location 12:99661899-99661921
Sequence TTCAATCAGCAGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 480}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100935634_1100935637 -5 Left 1100935634 12:99661899-99661921 CCTTCCTCTTCCTGCTGATTGAA 0: 1
1: 0
2: 4
3: 42
4: 480
Right 1100935637 12:99661917-99661939 TTGAATGCTAATGAAATAGCTGG 0: 1
1: 0
2: 1
3: 39
4: 314
1100935634_1100935639 15 Left 1100935634 12:99661899-99661921 CCTTCCTCTTCCTGCTGATTGAA 0: 1
1: 0
2: 4
3: 42
4: 480
Right 1100935639 12:99661937-99661959 TGGAGCTGGAGCATTTGTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 207
1100935634_1100935640 16 Left 1100935634 12:99661899-99661921 CCTTCCTCTTCCTGCTGATTGAA 0: 1
1: 0
2: 4
3: 42
4: 480
Right 1100935640 12:99661938-99661960 GGAGCTGGAGCATTTGTCCTGGG 0: 1
1: 0
2: 3
3: 22
4: 209
1100935634_1100935638 1 Left 1100935634 12:99661899-99661921 CCTTCCTCTTCCTGCTGATTGAA 0: 1
1: 0
2: 4
3: 42
4: 480
Right 1100935638 12:99661923-99661945 GCTAATGAAATAGCTGGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100935634 Original CRISPR TTCAATCAGCAGGAAGAGGA AGG (reversed) Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901752140 1:11416841-11416863 TTCAAACAGCAGGACCAGCATGG - Intergenic
903044539 1:20554867-20554889 TTCTCCCAGCAGGATGAGGAAGG + Exonic
905961340 1:42045023-42045045 TTGAACCAATAGGAAGAGGAGGG - Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906047420 1:42842740-42842762 GTCAGTGAGCAGGAAGGGGAAGG + Exonic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
907908665 1:58808379-58808401 AGCAATGAGCAGGAAGAGTAGGG - Intergenic
908301229 1:62762281-62762303 ATCAATCAGCAGGATGTGGGTGG + Intergenic
909553403 1:76925171-76925193 TTCACTCATCACCAAGAGGATGG + Intronic
909784482 1:79593887-79593909 ATCAATCAGCAGGATGTGGGAGG + Intergenic
910459231 1:87431071-87431093 ACCAATCAGCAGGAAGTGGGCGG + Intergenic
910672206 1:89784751-89784773 TTCTAACAGCAGGAAAAGGCAGG - Intronic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
912092709 1:106101140-106101162 TTCAATTAACAGGATGAGAAGGG + Intergenic
912408363 1:109461569-109461591 ATCAATCAGCAGGATGTGGGTGG - Intergenic
912519538 1:110235594-110235616 TTCAGGCTGCTGGAAGAGGAGGG + Intronic
912980460 1:114366433-114366455 TTCATACAGCAGAAAGGGGATGG - Intergenic
913012411 1:114697413-114697435 TTCAGGCAGGAAGAAGAGGAAGG - Intergenic
914411393 1:147431689-147431711 TTCATACAGCAGGAAGTGGGAGG + Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
914844767 1:151276511-151276533 TTAAATCAGCAGGAATGGGCCGG - Intergenic
915341998 1:155181728-155181750 TTCAGTCACCAGGAACAGGCAGG - Intronic
915670074 1:157481494-157481516 TTCAATGTGCAGGAAGAGCTAGG - Intergenic
915749857 1:158196193-158196215 TTCAAACAACAGCAAAAGGAAGG - Intergenic
916573217 1:166045298-166045320 TCCAATCAGAAGGAACAGTAGGG + Intergenic
917311808 1:173686419-173686441 TTCGTACAGCAGGAAGGGGATGG - Intergenic
917492523 1:175509834-175509856 TTCAATCCTCAGGAAAAAGAAGG - Intronic
918749699 1:188257601-188257623 ACCAATCAGCAGGACGAGGGTGG - Intergenic
918842801 1:189565353-189565375 TTCACTCATCACCAAGAGGACGG + Intergenic
919237147 1:194859766-194859788 ATCAATCAGCAGGATGTGGGTGG + Intergenic
919631062 1:199960347-199960369 ATCAATCAGCAGGATGTGGGTGG + Intergenic
919787580 1:201269657-201269679 TCCACCCAGCAGGAAGAAGAAGG + Intergenic
919869264 1:201808289-201808311 TTCAATCAGCATGAGAAGAAAGG - Intronic
920145102 1:203853553-203853575 TATAATCAGGAGGAAGAGGAAGG + Exonic
920286166 1:204881367-204881389 TACAATCAGAAAAAAGAGGAGGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920658078 1:207891185-207891207 TGCACTCAGCAGGTGGAGGAAGG - Intronic
920883625 1:209903325-209903347 TTCATTTATCAGCAAGAGGATGG + Intergenic
921692564 1:218166434-218166456 TGAAATCAGCAGAGAGAGGAGGG + Intergenic
921820198 1:219608452-219608474 TATAATCAGGAGGAAGAGGAAGG - Intergenic
922036551 1:221853854-221853876 TTCTATCTGCAGGAAGAAGGAGG + Intergenic
922936869 1:229429981-229430003 TTCAATAAGCCAGAAGATGAGGG + Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923524217 1:234759861-234759883 TTCAATCACCAGGAAAAGTTTGG + Intergenic
923908056 1:238407972-238407994 TTCAGACAGAAGAAAGAGGATGG + Intergenic
924703178 1:246474852-246474874 GTCAAGTAGCAGGAAGGGGAAGG + Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1062993127 10:1838604-1838626 ACCAATCAACAGGAAAAGGAGGG + Intergenic
1063318594 10:5032079-5032101 ACCAATCAGCAGGATGTGGATGG - Intronic
1063769820 10:9184073-9184095 ACCAATCAGCAGGATGTGGATGG + Intergenic
1063990808 10:11560334-11560356 ATCACTCAGCAGGTACAGGACGG + Intronic
1064407683 10:15079098-15079120 CTCAAAGAGCAGGAAGAGGAAGG + Intronic
1065269256 10:24010405-24010427 TTAAAACAGCAGGAAGAGATGGG - Intronic
1065480027 10:26183684-26183706 TTCAGTTGGCAGGAAGAGAAAGG + Intronic
1068241027 10:54300830-54300852 ACCAATCAGCAGGATGTGGATGG + Intronic
1069559613 10:69420209-69420231 CTCAAACAGCAGGAAGGGCATGG - Intergenic
1070246878 10:74740363-74740385 ATCAAACAGCTGGAAGATGAGGG + Intergenic
1070799023 10:79234147-79234169 TTGCCTCAGCAGGTAGAGGAGGG + Intronic
1071037320 10:81264150-81264172 ACCAATCAGCAGGATGTGGATGG - Intergenic
1071055415 10:81503572-81503594 TCCAATCAGCAGGATGTGGGTGG + Intergenic
1071816875 10:89241145-89241167 GTTAACCAGGAGGAAGAGGAGGG + Intronic
1072808418 10:98440816-98440838 TTCAATAAAGAGGAAGAGAAAGG + Intronic
1073842031 10:107508773-107508795 TTCAGGCAGCAGGAAGAGAGTGG - Intergenic
1073887702 10:108059548-108059570 ATAAATGAGAAGGAAGAGGAAGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074105975 10:110389974-110389996 TTCCATCATGAGGGAGAGGAGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074627996 10:115215059-115215081 CTCTAGCAGCAGGAACAGGAAGG - Intronic
1074931962 10:118137025-118137047 TGCAAACAGCAGGAAAATGATGG - Intergenic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076718543 10:132381577-132381599 TTCAAACAAAAGGAAGGGGAAGG + Intergenic
1079567622 11:21902104-21902126 TCCAATCAGCAGGTAGTGGTAGG + Intergenic
1081421056 11:42874916-42874938 ACCAATCAGCAGGAAGTGGGTGG + Intergenic
1082104597 11:48208003-48208025 TACTGTCAGCAGGAAGAAGAAGG + Intergenic
1082912199 11:58390162-58390184 ACCAATCAGCAGGATGTGGATGG - Intergenic
1083591778 11:63899710-63899732 TTCAATCAGCGTGAATAGGCTGG - Intronic
1084259249 11:67964003-67964025 ACCAATCAGCAGGATGTGGATGG + Intergenic
1085982676 11:81744165-81744187 ATCAATCAGCAGGATGTGGGTGG - Intergenic
1086223856 11:84483654-84483676 TTAAATCTGTAGGAAGAGGGTGG + Intronic
1086484643 11:87285789-87285811 ACCAATCAGCAGGATGAGGGTGG - Intronic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087893988 11:103567186-103567208 TCCAACCAGCAGGAAGAAGAGGG - Intergenic
1087960235 11:104339406-104339428 ACCAATCAGCAGGATGTGGATGG + Intergenic
1087966415 11:104421765-104421787 ACCAATCAGCAGGATGTGGATGG - Intergenic
1088610418 11:111571141-111571163 TTAGATCAGCAGGAAGATGCTGG - Intergenic
1088778893 11:113114440-113114462 TTTAAGCAGCAGGAAAAGAAAGG + Intronic
1089728673 11:120506049-120506071 CTCAAACAGGAGGAAGAGGTCGG - Intergenic
1090035389 11:123245539-123245561 TTCATTCAGCAGGAATAGGGTGG - Intergenic
1090154281 11:124421094-124421116 TTCAAGCAGCAGGAAGACACAGG - Intergenic
1092798648 12:12140550-12140572 TTCAATGAGAAGGAAGGGAAGGG + Intronic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1093443629 12:19229749-19229771 ATCAATCAGCAGGATGTGGGTGG - Intronic
1093795682 12:23307775-23307797 GTCCATCACCAGGAGGAGGATGG - Intergenic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094320923 12:29182324-29182346 ACCAATCAGCAGGATGTGGAAGG - Intronic
1094457619 12:30655544-30655566 TTTAGTTAGCAGGAAGTGGAGGG - Intronic
1095333418 12:40996968-40996990 TTCAATCAGCATAATGAGGCTGG - Intronic
1095642517 12:44501436-44501458 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1097128805 12:56795314-56795336 ATCAATCAGCAGGATGTGGGTGG - Intergenic
1099559504 12:84154758-84154780 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101510345 12:105387454-105387476 TTCCAACAGAAGGAAGAGAAAGG - Intronic
1101929974 12:109005942-109005964 TTCAAGTAGCAGCAAGAGGGTGG + Intronic
1102309887 12:111836431-111836453 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1102487711 12:113269423-113269445 TTCCATGAGCAGGATGTGGAAGG - Intronic
1102766988 12:115442270-115442292 TGCAACCAGCAGGAAGAGCATGG + Intergenic
1102983244 12:117258970-117258992 TTCCATCATCAGGAAGAAGTAGG - Intronic
1103263331 12:119608462-119608484 TTCAATGAGAAGGAAAATGAAGG + Intronic
1103921928 12:124403673-124403695 TCCAAGCAGATGGAAGAGGAGGG + Intronic
1105763239 13:23532375-23532397 GCCAATCAGCAGGAAGTGGGTGG + Intergenic
1105773117 13:23631731-23631753 TTAAAGGAGAAGGAAGAGGAGGG + Intronic
1105837327 13:24223157-24223179 TTCCACCAGTCGGAAGAGGACGG + Exonic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1107352275 13:39528303-39528325 TTCAGTCAGAGGGGAGAGGAAGG - Intronic
1107630610 13:42338995-42339017 CTCATTCACCAGGAAGAGCACGG - Intergenic
1107750167 13:43556988-43557010 TTCAATCAGTAGGAAAAGCCTGG + Intronic
1107790934 13:44001666-44001688 ACCAATCAGCAGGATGTGGATGG + Intergenic
1108138202 13:47388001-47388023 ATCAATCAGAAAGAAAAGGATGG + Intergenic
1109145518 13:58774049-58774071 ACCAATCAGCAGGATGTGGATGG + Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1110751281 13:79119270-79119292 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1110940163 13:81340365-81340387 ACCAATCAGCAGGATGTGGATGG - Intergenic
1111445747 13:88345084-88345106 ATCAATCAGCAGGATGTGGGAGG - Intergenic
1111929480 13:94498987-94499009 ACCAATCAGCAGGAAGTGGGTGG + Intergenic
1112288545 13:98125164-98125186 TTCAATCAGCTGGAACAGAGCGG - Intergenic
1112844087 13:103616896-103616918 CTCAATCTTAAGGAAGAGGAAGG + Intergenic
1113111562 13:106829251-106829273 TACAATCAGTTGAAAGAGGAAGG - Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1114651112 14:24285044-24285066 TACATTAAACAGGAAGAGGATGG - Intergenic
1114786315 14:25603852-25603874 ATTAATCAGGGGGAAGAGGAGGG - Intergenic
1115060736 14:29186843-29186865 ACCAATCAGCAGGATGTGGACGG + Intergenic
1115078318 14:29418182-29418204 TTCAACCAACAGGAATAGCAAGG - Intergenic
1115619892 14:35131241-35131263 TTCAATCAGAAAGAAAAGGATGG - Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1117183506 14:53216866-53216888 ACCAATCAGCAGGATGTGGATGG - Intergenic
1118571375 14:67199023-67199045 TTCAAAAGGCAAGAAGAGGATGG + Intronic
1121591533 14:95116543-95116565 TTCAATCTAAAGGAAGAGCAAGG - Exonic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122382764 14:101321387-101321409 TTCGAACAGCAGAGAGAGGATGG + Intergenic
1122874245 14:104656215-104656237 TTCCAACAGCAGGAAAAGGGAGG + Intergenic
1123755479 15:23394661-23394683 TTCCTCCTGCAGGAAGAGGACGG - Intergenic
1124934486 15:34157332-34157354 TTCAAACAGCAGAAATGGGATGG - Intronic
1125482013 15:40087640-40087662 ATCATTCAGCTGGAGGAGGAGGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126426338 15:48530627-48530649 TGCAAACAGCTGAAAGAGGATGG + Intronic
1127920976 15:63493856-63493878 TTCAGGGGGCAGGAAGAGGAGGG + Intergenic
1128480578 15:68034284-68034306 TTATCACAGCAGGAAGAGGACGG + Intergenic
1128884709 15:71275967-71275989 TTCTATCAGCAGCATGAGAACGG + Intronic
1129118719 15:73381759-73381781 TTCATTGAGCAGGAAGAGCAGGG - Intergenic
1129532334 15:76278468-76278490 CTTAATCAGCCGGAAGAGGGAGG - Intronic
1131445158 15:92492757-92492779 TTCCATCTGCAGGATGAGGCTGG + Intronic
1131518129 15:93092967-93092989 CTCAAACAGCTGGGAGAGGAGGG + Intergenic
1134863908 16:17587309-17587331 TTGAATCAGCGGAAAGAGCAGGG - Intergenic
1136498444 16:30658181-30658203 AACAAACAGCAGGAAGAGGCGGG + Intergenic
1136684655 16:31986980-31987002 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1136785279 16:32930516-32930538 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1136884503 16:33923288-33923310 ATCAACCAGCAGGATGAGGTGGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137949094 16:52765132-52765154 TTCCAACAGCAGGGAGAAGAGGG + Intergenic
1138743172 16:59334014-59334036 ACCAATCAGCAGGATGTGGATGG - Intergenic
1138954012 16:61949383-61949405 ACCAATCAGCAGGAAGTGGGTGG + Intronic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1203087936 16_KI270728v1_random:1194525-1194547 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1143872108 17:9964456-9964478 CTAAATCAGCAGGAATAGGGAGG - Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144276518 17:13673890-13673912 TTCCTTCAGCAGTAAGAGAAAGG + Intergenic
1146497514 17:33336248-33336270 TTCCTTCAGAGGGAAGAGGAAGG + Intronic
1147705196 17:42421423-42421445 TCCCTTCAGCAGGGAGAGGAAGG + Intronic
1148244842 17:46023939-46023961 TTCAATCTGCAAGAAGAGGAAGG - Exonic
1148817787 17:50343045-50343067 GTCAATCAGAAGGAACTGGATGG + Intergenic
1149055989 17:52366494-52366516 TCCAAGCAGAAGGAAGAGAATGG + Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1150778415 17:68100164-68100186 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1152538029 17:80961559-80961581 TTTAAACAGCTGGAAGGGGATGG + Intronic
1152609803 17:81309975-81309997 TTCTAACAGCAGGAAAGGGAAGG - Intergenic
1152745288 17:82036020-82036042 GTCACTCAGCAGAAAGAGGATGG + Exonic
1153300466 18:3587526-3587548 ATCAATCAGCAGGACGTGGGCGG + Intronic
1153326353 18:3824294-3824316 TTCTATTGGCAGCAAGAGGAAGG - Intronic
1154386307 18:13895527-13895549 TTTATTCAGCAGGAAGGGGCAGG + Intronic
1154931080 18:20997007-20997029 TTCATTAAGCAGAAACAGGAAGG + Intronic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1156610372 18:38717873-38717895 ACCAATCAGCAGGAAGCGGGTGG - Intergenic
1157818457 18:50748381-50748403 TTCAAGCAGTAGGAGGAGGCAGG - Intergenic
1158085927 18:53651964-53651986 GTCAGTCAGGAGGTAGAGGAAGG + Intergenic
1159091818 18:63858584-63858606 TTCAATCTGAAAGAAAAGGATGG - Intergenic
1159153329 18:64549334-64549356 TAAAATCAGTAGTAAGAGGAAGG - Intergenic
1159260352 18:66005334-66005356 ACCAATCAGCAGGATGTGGATGG - Intergenic
1159496645 18:69216192-69216214 TTCAATAAGAAGGAAGGGGAGGG - Intergenic
1159508934 18:69370978-69371000 TTAAATCGAGAGGAAGAGGATGG + Intergenic
1159586117 18:70285217-70285239 TTGAATCACCAGGACTAGGATGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160099530 18:75907039-75907061 CTCCATCAGATGGAAGAGGAAGG + Intergenic
1160345965 18:78131924-78131946 ATCAATTAAGAGGAAGAGGAAGG - Intergenic
1162111925 19:8404070-8404092 ATCAATCAACAGGCAGAGGTGGG - Exonic
1162205592 19:9053880-9053902 ACCAATCAGCAGGAAGTGGTTGG + Intergenic
1162597815 19:11642305-11642327 TTCAGTGAGCAGGATGGGGATGG + Intergenic
1163394524 19:17051626-17051648 CTCAAGCAGCTGGAAGAGAAAGG - Intronic
1163759839 19:19130208-19130230 GGCCAGCAGCAGGAAGAGGAAGG + Exonic
1165590965 19:36969461-36969483 TTCCCTCAGCAGGAAGAGGTTGG - Intronic
1166135038 19:40771311-40771333 ATCAATCAGCAGGATGTGGGTGG - Intergenic
1167214943 19:48158286-48158308 TTCTGCCAACAGGAAGAGGAGGG - Intronic
1167624780 19:50580326-50580348 CTAAATCAGCAGGACAAGGAAGG - Intergenic
1167790579 19:51676589-51676611 ACCAATCAGCAGGATGAGGGTGG + Intergenic
924967486 2:91741-91763 ATCAATCAGCAGGATGTGGGTGG + Intergenic
925077199 2:1026819-1026841 GGCAAAGAGCAGGAAGAGGAAGG - Intronic
925174367 2:1771841-1771863 TAGAATCTGCAGGAAGAGGGTGG + Intergenic
925712626 2:6756817-6756839 TAAAATGAGCTGGAAGAGGAAGG + Intergenic
926118814 2:10229871-10229893 TTCAGGCAGCATGAAGAGAAGGG + Intergenic
926201192 2:10799373-10799395 TTTAATCAGCATGAAGCTGAGGG + Intronic
927137305 2:20106357-20106379 TCCAATCAGCAGGATGTGGGTGG - Intergenic
928646464 2:33357712-33357734 TTCAATTTGCATGAAGAGGCTGG - Intronic
929030442 2:37645877-37645899 ATCAAGCTGCAGGGAGAGGAGGG + Exonic
929765398 2:44839837-44839859 TGCAATCAGCAGGGAGAAAATGG - Intergenic
930152347 2:48071283-48071305 TTCAGTCTGCAGGCAAAGGAAGG - Intergenic
932129893 2:69178225-69178247 TGCAATCCCCAGGAAGAGAAGGG - Intronic
932633003 2:73362817-73362839 TACAATGAGCAGGGACAGGAGGG - Intergenic
932983397 2:76697959-76697981 ACCAATCAGCAGGATGTGGATGG - Intergenic
933230972 2:79806747-79806769 TTCAAGCAGGAGGAAGGGGCAGG - Intronic
933270841 2:80231281-80231303 TTCAAACACCAGGAACAGGCCGG - Intronic
933548872 2:83749025-83749047 ACCAATCAGCAGGATGTGGATGG + Intergenic
934476691 2:94598411-94598433 TTCACTGATCAGGGAGAGGAGGG + Intronic
935673407 2:105574323-105574345 TTTACTCAGCAGGACCAGGAAGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936172204 2:110186085-110186107 TACCATCAGCAGGGAGAGGCGGG - Intronic
937266051 2:120615226-120615248 TTCTGCCTGCAGGAAGAGGAGGG - Intergenic
937332406 2:121039821-121039843 TTCGTTCTGCAGGAAGTGGAAGG - Intergenic
938197003 2:129337257-129337279 TTTAACCAGCAGGTGGAGGATGG - Intergenic
939229863 2:139410898-139410920 ACCAATCAGCAGGATGTGGATGG + Intergenic
939722082 2:145666446-145666468 ATTTATCAGGAGGAAGAGGAAGG - Intergenic
941313536 2:163964261-163964283 ATCAATCAGCAGGACACGGAGGG - Intergenic
941526412 2:166611525-166611547 ACCAATCAGCAGGATGTGGATGG - Intergenic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
941988768 2:171534318-171534340 TTCAATGAGAAGGAAGAAAAAGG - Intronic
942199454 2:173556371-173556393 TGCAAACAGGAGGAGGAGGAAGG - Intergenic
942254270 2:174078062-174078084 TTGGAACACCAGGAAGAGGAGGG - Intronic
942422075 2:175818525-175818547 TTCACTCTACAGGAAGAGGTTGG - Intergenic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
943680219 2:190760544-190760566 ACCAATCAGCAGGAAGTGGGTGG - Intergenic
944902201 2:204226862-204226884 TTCAATAAGCAGAGAGATGAGGG - Intergenic
945926186 2:215806707-215806729 TTCAAACTGCAGGAAGAACAAGG + Intergenic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
946358491 2:219204489-219204511 TTCACTCATCACCAAGAGGATGG - Intronic
947653411 2:231806622-231806644 AAGAAACAGCAGGAAGAGGATGG - Intronic
948064877 2:235070141-235070163 TTCAGGCAGGAGGAAGGGGAGGG + Intergenic
948358129 2:237396974-237396996 TTGAACCAGCAGCAAAAGGATGG + Intronic
948663448 2:239520512-239520534 TCAAATCTGCAGGAAGGGGAAGG - Intergenic
1168734708 20:122013-122035 TCCAAACAGGAGGAAGTGGAAGG - Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168876878 20:1177912-1177934 TCCACTCAGCAGCCAGAGGAAGG - Intronic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172516239 20:35536000-35536022 TTCCATAAAAAGGAAGAGGAGGG - Intergenic
1173001567 20:39109508-39109530 TTCAATGTGCGGGAGGAGGAGGG + Intergenic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1174657931 20:52187202-52187224 TGCAGTTCGCAGGAAGAGGAAGG - Intronic
1174741037 20:53014587-53014609 TTTAGTCAAGAGGAAGAGGAGGG - Intronic
1174794906 20:53513909-53513931 TCTAATCAGCAGAAAGAGAATGG - Intergenic
1175961096 20:62636711-62636733 TTCCATCTGCAGGAAGGGGGTGG - Intergenic
1177371128 21:20205169-20205191 ACCAATCAGCAGGATGTGGATGG + Intergenic
1177581863 21:23033977-23033999 CTCAATCAGAAAGAAAAGGATGG - Intergenic
1177637751 21:23807832-23807854 TCCAATCAGCAGGACGTGGGTGG + Intergenic
1178493511 21:33069175-33069197 TTCAATCAGAGGGATGGGGAAGG + Intergenic
1179087940 21:38237059-38237081 GTCCACCAGCAGCAAGAGGAAGG + Intronic
1179089935 21:38255650-38255672 TTGAGTCAGCAGGGAGAGGGGGG + Intronic
1180708498 22:17824117-17824139 TTGCACCAGCAGGAAGAGGGCGG + Intronic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1182578971 22:31292353-31292375 TTCAATCACCTGCAAGACGAAGG - Exonic
1183051822 22:35268863-35268885 TTCAATATGTAAGAAGAGGAAGG - Intronic
1183131073 22:35836586-35836608 TTCCATCAGGACCAAGAGGAGGG - Intronic
1183269441 22:36851481-36851503 GACAATGAGCAGGCAGAGGAAGG + Intergenic
1183940001 22:41288668-41288690 TCCTATCAGCTGGATGAGGACGG - Intergenic
1184202211 22:42978488-42978510 GTCATTCAGCAGGATGAGGGTGG - Intronic
1185128869 22:49026118-49026140 TCCAGTCAGGAGGAAGAGGGCGG - Intergenic
1185209705 22:49563816-49563838 CTCACTCAGCAGCAAGGGGATGG + Intronic
949292891 3:2485876-2485898 ACCAATCAGCAGGAAGTGGGTGG + Intronic
949610993 3:5703231-5703253 TTCATACAGCAGAAAGGGGATGG - Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
950186494 3:10948686-10948708 ATCGTTCAGCAGGGAGAGGAAGG + Intergenic
950432016 3:12956210-12956232 GTCAATAGGCAGGAAGAGAAGGG - Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950635461 3:14311337-14311359 TCCATTTAGTAGGAAGAGGAGGG - Intergenic
950639234 3:14337622-14337644 TTCAATTGGCGGGAAGAGAAGGG + Intergenic
951024706 3:17816999-17817021 ACCAATCAGCAGGAAGTGGGTGG - Intronic
951264008 3:20546577-20546599 TTCAATAAACAGTAAGAAGATGG - Intergenic
951613254 3:24516135-24516157 TTCAGCCATCATGAAGAGGAGGG - Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952961432 3:38593031-38593053 AACAATCAGTAGGAAAAGGATGG - Intronic
955130462 3:56161068-56161090 TTCACTTAGCAGCAAGGGGATGG - Intronic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
956290577 3:67655568-67655590 ACCAATCAGCAGGATGAGGGTGG + Intergenic
956311721 3:67888324-67888346 ACCAATCAGCAGGAAGTGGGCGG + Intergenic
958419986 3:93918300-93918322 ATCAATCAGCAGGATGTGGGTGG + Intronic
959413250 3:106051442-106051464 TTCCATCAGCAAGAAGATTATGG + Intergenic
960435550 3:117622218-117622240 CCCTATCAGCAGGAAGAAGAGGG + Intergenic
961166281 3:124766096-124766118 TTGAAACTGCAGGGAGAGGAGGG - Intronic
961904624 3:130250357-130250379 TTCAACCATCAGGGAAAGGAAGG + Intergenic
962177421 3:133168641-133168663 ATCAATCAGCAGGATGTGGGTGG + Intronic
962289483 3:134121604-134121626 TACAATAAGGAGGAAGAGAAAGG - Intronic
962436761 3:135374038-135374060 TTCAATCAGCTTGGTGAGGAAGG - Intergenic
963020903 3:140872394-140872416 ACCAATCAGCAGGATGAGGGCGG + Intergenic
963064443 3:141252550-141252572 CTCACTCACCAGCAAGAGGACGG + Intronic
963223267 3:142834052-142834074 ATCAGTCAGCAGGAAAAGGATGG - Intronic
965003635 3:162988004-162988026 ACCAATCAGCAGGAAGTGGGTGG + Intergenic
965094527 3:164207806-164207828 TTCAATAAGTAGGAAGTAGAGGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
967448602 3:189596681-189596703 ACCAATCAGCAGGAAGTGGGTGG + Intergenic
968124239 3:196146618-196146640 CTCAATCAGGAGGAAGAGAAGGG + Intergenic
968378946 4:71984-72006 TTCAATGAGCAGGATGGGGGTGG + Intronic
968885746 4:3330880-3330902 TTCCTTCAGCAGGAAGAGGGAGG + Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
969332206 4:6481412-6481434 TTAAATCAGTGGGAAAAGGATGG - Intronic
969398668 4:6939282-6939304 TTTATGCAGCAGGAAGAGGCAGG - Intronic
970359358 4:15292951-15292973 TCCAAGCAGGAGGAAGAGGTAGG + Intergenic
970576752 4:17436215-17436237 ATCAATCAGCAGGATGTGGGTGG - Intergenic
970936096 4:21571612-21571634 TGCAGAAAGCAGGAAGAGGAAGG + Intronic
971140190 4:23917054-23917076 GTCAATCTACAGGCAGAGGAGGG - Intergenic
975754981 4:77562890-77562912 ATCAATCAGCAGGATGTGGGTGG + Intronic
976933951 4:90604920-90604942 ACCAATCAGCAGGATGTGGATGG + Intronic
977575748 4:98672580-98672602 TTTTATCAGCAGGATGAGCACGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
982476214 4:155854573-155854595 TTCAATTTAAAGGAAGAGGAGGG + Intronic
982773734 4:159421291-159421313 ACCAATCAGCAGGATGTGGATGG + Intergenic
982893503 4:160886169-160886191 ACCAATCAGCAGGATGTGGACGG - Intergenic
983230538 4:165125534-165125556 ATCAATCAGCAGGATGTGGGTGG - Intronic
983547352 4:168978213-168978235 TTCATTCAGAAGGAACAGCATGG - Intronic
983656871 4:170092100-170092122 ACCAATCAGCAGGATGTGGATGG + Intergenic
984530436 4:180909500-180909522 TTCCATGGGAAGGAAGAGGAAGG - Intergenic
984768628 4:183419071-183419093 TCCAATCGGCAGGAAGGGGTGGG + Intergenic
985843485 5:2327154-2327176 TTCAGTCAGCAGCAGGAGGGTGG + Intergenic
986461011 5:7972296-7972318 CTCATTCAGCACCAAGAGGATGG - Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
989181056 5:38577520-38577542 GTCAGTGGGCAGGAAGAGGAGGG - Intronic
989496729 5:42117427-42117449 ACCAATCAGCAGGATGAGGGTGG + Intergenic
990698188 5:58446195-58446217 ACCAATCAGCAGGAAGTGGGCGG - Intergenic
990958919 5:61372579-61372601 TCCAAAAAGCGGGAAGAGGAAGG - Intronic
991215897 5:64157163-64157185 CTCAATCACCTGGAAGGGGAGGG + Intergenic
991557543 5:67912520-67912542 GTCAATCAGGAGGAAGAAGGAGG + Intergenic
992122665 5:73610690-73610712 TTCACACAGCAGGAACAGCAAGG - Intergenic
992545413 5:77810229-77810251 ACCAATCAGCAGGAAGTGGGCGG + Intronic
992579223 5:78154076-78154098 TTCAATCTGAAAGAAAAGGATGG - Intronic
992947567 5:81824431-81824453 ACCAATCAGCAGGAAGTGGGTGG + Intergenic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
993828795 5:92727468-92727490 TCCAGGCAGCAGGAGGAGGAGGG - Intergenic
994122463 5:96131913-96131935 TTCAATCAGCAAGAGTAGCAGGG + Intergenic
994527745 5:100927805-100927827 TTTAATCATCAGAAACAGGATGG - Intergenic
994781249 5:104093660-104093682 TTCATTCTGATGGAAGAGGATGG + Intergenic
994954548 5:106511134-106511156 ACCAATCAGCAGGACGTGGATGG + Intergenic
995155481 5:108907249-108907271 TTTAATGAGAAGGCAGAGGAGGG - Intronic
995182106 5:109238979-109239001 TTCAAGCAGCAGGAGTGGGAGGG + Intergenic
995583812 5:113625918-113625940 ATCAATCAGCAGGATGTGGGTGG - Intergenic
996416013 5:123211160-123211182 TTCAATCCTCAGGAAGGGGTAGG - Intergenic
996621684 5:125512520-125512542 TCCAGTCAGCAGGAAGAAGATGG - Intergenic
996815705 5:127570345-127570367 ACCAATCAGCAGGATGAGGGTGG + Intergenic
997663447 5:135607409-135607431 TTCCATGAGTAGGAAGATGAAGG - Intergenic
997930626 5:138069764-138069786 TTGAGTCAGTAGGAAGAAGAGGG - Intergenic
999085001 5:148880173-148880195 ATCAATCAGTAGAAAGATGATGG + Intergenic
999323038 5:150626380-150626402 TTCCATCAGTACGAAGGGGATGG + Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
1000058759 5:157633950-157633972 TGCAAGAAGAAGGAAGAGGAAGG + Intronic
1002394680 5:178943399-178943421 TTCACTCATCACCAAGAGGATGG + Intronic
1002432498 5:179211641-179211663 ATCAATAAACAGGGAGAGGATGG + Intronic
1003060565 6:2859197-2859219 TACAGACAACAGGAAGAGGATGG - Intergenic
1003286811 6:4741566-4741588 TCAAATCAGCAGGAAGGAGAAGG + Intronic
1003412373 6:5876877-5876899 ATCAACCAGCAGGCAGAGAAGGG - Intergenic
1003466347 6:6383544-6383566 TGCATTCAGGAGGAGGAGGAAGG - Intergenic
1003674661 6:8192237-8192259 TGGAATCAGCAGGAAAAGGACGG - Intergenic
1003770029 6:9290076-9290098 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1004257857 6:14081419-14081441 ATTAATCACCAGGAAGAGAAAGG - Intergenic
1004503073 6:16226502-16226524 ACCAATCAGCAGGAAGTGGGTGG - Intergenic
1004636029 6:17468693-17468715 TTCCATCAACTGGAAGAGGATGG - Intronic
1004988041 6:21105087-21105109 TTCAATCAGAAGAAAAATGACGG - Intronic
1005279541 6:24258310-24258332 ATCAATCAGCAGGATGTGGGCGG - Intronic
1005759951 6:28958884-28958906 ACCAATCAGCAGGATGTGGATGG + Intergenic
1006188114 6:32191865-32191887 TTCAGTCTGCAGGGAGAGCAGGG + Exonic
1006221234 6:32493876-32493898 ACCAATCAGCAGGAAGTGGGCGG + Intergenic
1006670971 6:35729378-35729400 TTCAAGCATCAGGAAGAAGGTGG - Intergenic
1006812952 6:36832291-36832313 TTCTGTCAGCAGGAAGAGAGTGG - Intronic
1006981957 6:38154277-38154299 TCCACGCAGCAGGCAGAGGAGGG - Exonic
1007862289 6:44923803-44923825 TTTAATCAGCAGGCAGATGTGGG - Intronic
1008254179 6:49276131-49276153 ACCAATCAGCAGGATGTGGATGG + Intergenic
1008499243 6:52164308-52164330 TTCAATAACCTGGAAGAGAATGG - Intergenic
1009565435 6:65306110-65306132 TATAATCAGGAGGAAGAGGAAGG + Intronic
1009685496 6:66950261-66950283 ACCAATCAGCAGGATGTGGATGG + Intergenic
1009800815 6:68533983-68534005 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1011176868 6:84572740-84572762 TACCATCAACAGAAAGAGGAAGG + Intergenic
1011879799 6:92011099-92011121 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1011931941 6:92724512-92724534 GCCAATCAGCAGGATGTGGATGG + Intergenic
1012437798 6:99233644-99233666 ATCCATCAGCAGGTGGAGGAAGG + Intergenic
1012534751 6:100281912-100281934 TTCAACCAGTAGTGAGAGGAGGG - Intergenic
1013132912 6:107252165-107252187 TTTAATCAGCATGCAGAGTAGGG - Intronic
1013648515 6:112169584-112169606 TCCAAAGATCAGGAAGAGGAAGG + Intronic
1016217310 6:141618821-141618843 ACCAATCAGCAGGATGTGGATGG + Intergenic
1017325212 6:153134339-153134361 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1017656799 6:156637382-156637404 GTCAATCAGCAAGAACAGGCAGG - Intergenic
1017851902 6:158311439-158311461 TTCAGGCAGTAGGAAGAAGATGG + Intronic
1018531601 6:164769607-164769629 TTAAATCAGATGGATGAGGAGGG - Intergenic
1018709544 6:166488212-166488234 TTCAGACAGCAGCAAGAGCAGGG - Intronic
1018924661 6:168197858-168197880 TGGACTCAGCAGGATGAGGAAGG - Intergenic
1019073023 6:169365581-169365603 TCCAATAATCAGGAAGAAGAGGG + Intergenic
1020004489 7:4775128-4775150 TTCAAGCAGCAGGAACAGCGCGG + Intronic
1020375209 7:7477836-7477858 ACCAATCAGCAGGAAGTGGGTGG - Intronic
1021116086 7:16747996-16748018 TTAAACGAGCAGGAAGAAGAAGG + Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021368473 7:19811402-19811424 TTAATTCAGTAGGAAGAGGTAGG - Intergenic
1021570722 7:22062398-22062420 TTCAACCAGCAAGGGGAGGAAGG + Intergenic
1022521004 7:31006816-31006838 TTGAATCAGCAGGTAGAGAAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022712841 7:32867863-32867885 TTCATTCAGTAGGCAGTGGAGGG + Intergenic
1023077612 7:36499505-36499527 ATCAATCAGCAGGATGTGGGCGG - Intergenic
1023512831 7:40971255-40971277 CCCACTCAGCATGAAGAGGATGG + Intergenic
1023557095 7:41435219-41435241 ACCAATCAGCAGGAAGTGGGCGG + Intergenic
1024385255 7:48743743-48743765 TTCATTGAGCAGCCAGAGGAGGG - Intergenic
1024419092 7:49141343-49141365 TTCAATTATCATGAAGAGTAAGG + Intergenic
1024466040 7:49712084-49712106 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1024791957 7:52975301-52975323 GTCAATCAGAACAAAGAGGAAGG + Intergenic
1024871163 7:53962796-53962818 ACCAATCAGCAGGAAGTGGGTGG - Intergenic
1026199407 7:68201259-68201281 CTCAATCAGCAGGATGTGGGTGG - Intergenic
1028018114 7:85740099-85740121 TCCAGACAGCAGGAAAAGGATGG - Intergenic
1028101714 7:86828647-86828669 GTCAATCAGCAAAAAGAGTATGG - Intronic
1028223808 7:88226482-88226504 TTCAATAAGCTGGGAGAGGAGGG + Intronic
1028443455 7:90891219-90891241 TTCATTCACCTGGAAGAGGTTGG + Intronic
1028857284 7:95606070-95606092 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1028960343 7:96741792-96741814 TTCAAGGATCAGGAAGAGAAAGG + Intergenic
1030135127 7:106239316-106239338 TTATATCAGTAGGTAGAGGAGGG - Intergenic
1030366888 7:108656732-108656754 ACCAATCAGCAGGATGTGGATGG - Intergenic
1030463083 7:109864999-109865021 TACAATCAGTAGGAAGAAGGTGG - Intergenic
1031357381 7:120803397-120803419 ATCATTCAGTAGGAAGATGAGGG - Intronic
1031545152 7:123043694-123043716 GACAATCTGGAGGAAGAGGAGGG - Intergenic
1034451706 7:151140627-151140649 TCCAATCACCAAGAAGAGGGAGG - Intronic
1034823327 7:154237144-154237166 TTCCAACAGCAGCCAGAGGAGGG + Intronic
1034900951 7:154907549-154907571 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1035471459 7:159112550-159112572 TTAAATAGGCAGGCAGAGGAGGG + Intronic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1035999380 8:4583756-4583778 ATCAATCAGCAGGATGTGGGTGG + Intronic
1036284165 8:7429262-7429284 TAAAATCAGGAGGAAGATGAAGG + Intronic
1036337311 8:7882268-7882290 TAAAATCAGGAGGAAGATGAAGG - Intronic
1037189012 8:16099694-16099716 TCCAAACAGCAGAAAGCGGATGG + Intergenic
1037263726 8:17036451-17036473 ACCAATCAGCAGGATGTGGATGG - Intronic
1037399306 8:18477752-18477774 TATAATCTGAAGGAAGAGGAAGG + Intergenic
1037811109 8:22087336-22087358 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1038051734 8:23820434-23820456 GACAAACAGAAGGAAGAGGATGG - Intergenic
1038393778 8:27231380-27231402 TTCTTTCAACAGAAAGAGGATGG + Intergenic
1038605927 8:29004411-29004433 TTCACTCCTCAGGAAGTGGAAGG + Intronic
1039188763 8:34947991-34948013 CTCAATCAGCGGGAGGAAGAAGG + Intergenic
1041068664 8:54105164-54105186 ACCAATCAGCAGGATGTGGATGG + Intergenic
1041604237 8:59761558-59761580 ACCAATCAGCAGGAAGTGGGTGG - Intergenic
1041986413 8:63926140-63926162 TTAAATCAGCAGGCTGAGAAGGG + Intergenic
1042948640 8:74179044-74179066 ACCAATCAGCAGGATGAGGATGG - Intergenic
1043370473 8:79584775-79584797 TACAATCAGGTGGAAGGGGAAGG - Intergenic
1043624480 8:82239127-82239149 TTCAATCATCAGAAATAGCAAGG - Intergenic
1043715799 8:83484653-83484675 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1045944343 8:107778770-107778792 TTCACTCAGGAAGAAGAGGACGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046380093 8:113438426-113438448 TTCAATCTGCAGGCGTAGGAAGG + Intergenic
1046661081 8:116949302-116949324 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1046718786 8:117595964-117595986 CTCAATCACCAGGAAGAAGATGG + Intergenic
1047034176 8:120916380-120916402 TCCAATCAGCAGGAGGGGGCAGG - Intergenic
1047196980 8:122730521-122730543 TTCAAATAGGAGGAAGAGGAAGG - Intergenic
1048112992 8:131488084-131488106 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1048896351 8:138995890-138995912 TTAAATCAGCAGAATGAGTAAGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049543019 8:143216987-143217009 TTCAGCCAGCAGAAGGAGGAAGG - Intergenic
1050285500 9:4097475-4097497 TTCAGTGAGAAGGCAGAGGAAGG + Intronic
1050761009 9:9071023-9071045 ATCACTCAGCAGGCAGAGGTGGG - Intronic
1051595641 9:18822012-18822034 TTCAAGCAGCAGGGAGAGCATGG + Intronic
1051928914 9:22362834-22362856 GCCAATCAGCAGGAAGTGGGTGG - Intergenic
1051955480 9:22687929-22687951 ACCAATCAGCAGGACGTGGACGG + Intergenic
1052347594 9:27425974-27425996 TTCACCCAGCAGAAGGAGGAGGG + Intronic
1052853339 9:33391494-33391516 TTCACTGATCAGGGAGAGGAGGG - Intronic
1053681371 9:40487666-40487688 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1053931361 9:43115996-43116018 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054282342 9:63137268-63137290 TTCACTGATCAGGGAGAGGAGGG + Intergenic
1054294460 9:63323182-63323204 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054392481 9:64627670-64627692 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054427129 9:65132879-65132901 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054503246 9:65888660-65888682 TTCACTGATCAGGGAGAGGAGGG + Intronic
1054744124 9:68837011-68837033 GTCAATAAGCAGGAAGGGCATGG - Intronic
1055033223 9:71791521-71791543 TCCAATTAGAAGGAAGAGGCTGG + Intronic
1055126861 9:72728842-72728864 TTTAATCAGCAGGTAGAAAAAGG + Intronic
1055816083 9:80208806-80208828 TCCAATTAGCAGGAACAGGGAGG - Intergenic
1056658531 9:88528001-88528023 TTCAAAAAGCAGGAAAAGAATGG - Intergenic
1056757654 9:89391951-89391973 TTCAATGTGCAGGAAGAAGCTGG - Intronic
1057007272 9:91571512-91571534 TTCATTCAGCAGGAAAGAGAGGG + Intronic
1058634736 9:107025395-107025417 TTCAATCAGCAGCAAGATGCAGG + Intergenic
1058684078 9:107465663-107465685 TTCAACAGGGAGGAAGAGGAGGG + Intergenic
1059368476 9:113805958-113805980 ATCATGCAGCAGGAACAGGAAGG + Intergenic
1059891341 9:118808867-118808889 ACCAATCAGCAGGATGTGGATGG - Intergenic
1060556123 9:124507919-124507941 TTCCATCAGGTGGAAGAAGAGGG + Intergenic
1061681411 9:132244201-132244223 TTCAGTCAGCAGGATGGGGAAGG + Exonic
1186771432 X:12821777-12821799 TCCAATCAGCAGGGACGGGAAGG - Intronic
1187070674 X:15884584-15884606 TGCAAACAGCAGGAGGAGAAAGG + Intergenic
1187699984 X:21955926-21955948 TTAAATCAGAAGGGTGAGGATGG + Intronic
1187834362 X:23416142-23416164 TCCAAGGAGCAGGAAGAGGTGGG - Intergenic
1188766272 X:34095816-34095838 ACCAATCAGCAGGATGTGGATGG - Intergenic
1189209953 X:39276358-39276380 ACCAATCAGCAGGATGTGGATGG + Intergenic
1191667304 X:63716638-63716660 TTCAATAAGCAGGTAAAGCATGG - Intronic
1192232018 X:69271958-69271980 TCCAATAAGGAGGCAGAGGAAGG + Intergenic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193905725 X:87242280-87242302 TTAAATCAGAAGGAAAAGGAGGG - Intergenic
1194250136 X:91564202-91564224 ACCAATCAGCAGGATGTGGACGG + Intergenic
1194321717 X:92456704-92456726 TTATATGCGCAGGAAGAGGAGGG - Intronic
1195439163 X:104882651-104882673 ACCAATCAGCAGGACGTGGATGG + Intronic
1195552759 X:106186802-106186824 ACCAATCAGCAGGATGTGGATGG - Intronic
1197134617 X:123046497-123046519 TTCAATCTAAAGGAACAGGAAGG + Intergenic
1197677854 X:129349313-129349335 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198855931 X:141016567-141016589 TTCAATCAGAAAGAAAAGGACGG - Intergenic
1198876200 X:141229544-141229566 TTCAATCAGAAAGAAAAGGATGG + Intergenic
1198906762 X:141570800-141570822 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1198972454 X:142297717-142297739 ATCAATCAGCAGGATGTGGGTGG - Intergenic
1199345867 X:146738673-146738695 TTCAATTAGCAGGAAGAAGGCGG - Intergenic
1200569100 Y:4805451-4805473 ACCAATCAGCAGGATGTGGACGG + Intergenic
1200694544 Y:6347265-6347287 ATCAATCAGCAGGATGTGGGTGG - Intergenic
1201040733 Y:9827445-9827467 ATCAATCAGCAGGATGTGGGTGG + Intergenic
1201324597 Y:12742381-12742403 ATCAATCAGCAGGATGTGGGTGG - Intronic
1201333175 Y:12849979-12850001 TCCAATCAGCAGAAAAAAGAGGG - Intronic
1201480063 Y:14428976-14428998 ACCAATCAGCAGGATGTGGATGG + Intergenic
1201496793 Y:14597397-14597419 ACCAATCAGCAGGATGTGGATGG - Intronic
1201921300 Y:19235382-19235404 TTCACTCAGGAGGCTGAGGAAGG + Intergenic