ID: 1100935976

View in Genome Browser
Species Human (GRCh38)
Location 12:99666519-99666541
Sequence TTGTAGGGGTAAATTTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100935968_1100935976 -6 Left 1100935968 12:99666502-99666524 CCCATATCCTGTTAAATTTGTAG 0: 1
1: 0
2: 1
3: 31
4: 281
Right 1100935976 12:99666519-99666541 TTGTAGGGGTAAATTTGTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 139
1100935969_1100935976 -7 Left 1100935969 12:99666503-99666525 CCATATCCTGTTAAATTTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1100935976 12:99666519-99666541 TTGTAGGGGTAAATTTGTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100935976 Original CRISPR TTGTAGGGGTAAATTTGTAG GGG Intronic
902112204 1:14091148-14091170 TTGCACAGGTAAATTTGTAAAGG - Intergenic
902146584 1:14406209-14406231 TTGTAGATGTATATATGTAGGGG - Intergenic
904255376 1:29251344-29251366 TTGTAGGGGTCATTTGGCAGAGG + Intronic
909404402 1:75271146-75271168 ATGTCAGGGTAAATTTATAGGGG - Intronic
909735995 1:78962378-78962400 TTGTAGGAGAATATTTGGAGAGG - Intronic
911678733 1:100690239-100690261 TTGTAGTGGTGGATTTGTAGTGG + Intergenic
911689312 1:100813955-100813977 TTGTGGTGGTAGCTTTGTAGTGG - Intergenic
912615980 1:111100646-111100668 TTGTAGTGGTGGCTTTGTAGTGG + Intergenic
913035640 1:114962848-114962870 TTGTAGTGCTAACTTGGTAGTGG + Intronic
913151530 1:116048544-116048566 TTGTAGTGGTAGTTTGGTAGTGG - Intronic
917948384 1:180001562-180001584 GAGTAGGGATAAATTTGAAGTGG + Intronic
921289138 1:213638656-213638678 TTAGATGGGTAAATTTGTATGGG + Intergenic
922986785 1:229872291-229872313 CTTTAGGAGTAAATATGTAGAGG + Intergenic
1066169252 10:32824105-32824127 TTGTAGGGGTATATCTGGTGAGG - Intronic
1069235683 10:66069149-66069171 TTGTAGGTGTACAATTCTAGAGG - Intronic
1070110283 10:73480418-73480440 TTACAGGGATAAATTTGCAGTGG - Intronic
1071208376 10:83310560-83310582 TTGTAGGGGCAAATTTGGAAAGG + Intergenic
1072271507 10:93781439-93781461 TTTTAAGGGTTAATTTGCAGGGG - Intronic
1075982578 10:126754066-126754088 TTGTAGTAGTGATTTTGTAGTGG + Intergenic
1078787420 11:14508584-14508606 TTGTAGGGGTAAATAGATAGTGG + Intronic
1078787511 11:14509468-14509490 TTGTAGGGGTAGATAGATAGTGG - Intronic
1079405886 11:20145392-20145414 TAGTGGTGGTGAATTTGTAGGGG + Intergenic
1080010575 11:27454810-27454832 TTGTAGGAGATAATTTGTGGAGG - Intronic
1082271508 11:50174857-50174879 TTCTAGGGACAGATTTGTAGTGG + Intergenic
1086420909 11:86636144-86636166 GTGTAGTGGTAAATGTGTTGGGG + Intronic
1089797962 11:120998570-120998592 TTGCAGGGGCAAATTTGAAATGG + Intergenic
1090473434 11:126999921-126999943 TTGTGGGGGGTAATTTGCAGTGG - Intronic
1090710518 11:129380667-129380689 TTGTAAGGGTAAATAAATAGAGG + Intronic
1091158278 11:133394289-133394311 TAGTAGGGGTATATATGTATGGG + Intronic
1093995136 12:25632608-25632630 TTGTAGTGGTAGCTTGGTAGTGG - Intronic
1095948781 12:47769531-47769553 TTGATGGGGGAAAATTGTAGAGG - Intronic
1099276551 12:80583627-80583649 TTGTAGGGGGAGGTTTGTATTGG + Intronic
1099584526 12:84500730-84500752 TTGTAAGGTTATATTTGTATCGG - Intergenic
1100935976 12:99666519-99666541 TTGTAGGGGTAAATTTGTAGGGG + Intronic
1101454569 12:104816720-104816742 TTGTGGTTGTAAATTTTTAGGGG - Intronic
1108825738 13:54409763-54409785 TTGTAGTGGTAACTTGGTAGTGG - Intergenic
1109508246 13:63335411-63335433 TTGTAGTGGTAGCTTGGTAGTGG + Intergenic
1109625166 13:64964438-64964460 TTGTAGGGCTGGCTTTGTAGTGG - Intergenic
1113327282 13:109294287-109294309 GTGTAGGGGTGTATGTGTAGAGG - Intergenic
1114300176 14:21368906-21368928 TGGTAAGGGTAAGTGTGTAGGGG + Intronic
1116660470 14:47704107-47704129 TTGTAAGGGTCAATTTTGAGGGG + Intergenic
1117768700 14:59109626-59109648 TTGTAGTGGTGACTTGGTAGTGG - Intergenic
1123901418 15:24880962-24880984 TTGTAGATTAAAATTTGTAGAGG - Intronic
1124033449 15:26031976-26031998 TTATAGGAGTAAATTTATAGGGG + Intergenic
1125068734 15:35525858-35525880 TTGTAGGTGTAAATTTTTCTGGG - Intronic
1127014676 15:54670290-54670312 TTGTAGTGCTGACTTTGTAGTGG - Intergenic
1131929288 15:97421000-97421022 ATGTAGGGGGCAATTTGTAGAGG + Intergenic
1132009251 15:98260503-98260525 TTGTAGGGGTAGATATGTGGTGG - Intergenic
1134464244 16:14459195-14459217 GTGTATGGGAAAATTTGTACTGG + Intronic
1134775879 16:16853098-16853120 TTGTATGTATAAATTTGAAGAGG - Intergenic
1137808425 16:51329592-51329614 TTGTGGGGTTCAATTTGGAGGGG + Intergenic
1148946588 17:51267764-51267786 CTTTAGGGGAAAATTTGTGGTGG + Intronic
1149410723 17:56403843-56403865 TTGTAGTGGTAGCTTTGTAATGG + Intronic
1150473702 17:65458506-65458528 CTGGAGTGGTAAATTTGAAGTGG - Intergenic
1150818594 17:68416210-68416232 TTGTAGTGGTGACTTGGTAGTGG + Intronic
1155726823 18:29096533-29096555 TTGTAGGGGAAACTCTGTTGTGG + Intergenic
1160503645 18:79415179-79415201 TTGTAGAGGCAAGGTTGTAGGGG + Intronic
1164077387 19:21832998-21833020 TTTGCAGGGTAAATTTGTAGAGG - Intronic
1164279955 19:23760342-23760364 TTGTATGGGTGTATTTGTATAGG + Intergenic
1164731657 19:30510031-30510053 TTGTGGGGGGAAATTAGAAGTGG + Intronic
926012112 2:9416690-9416712 TTGTAGGCCTAAAGTTGTGGAGG - Intronic
926052942 2:9756410-9756432 TTGTTGGGATGAACTTGTAGTGG - Intergenic
928624904 2:33129673-33129695 TTTTTCGGGTAAATTTTTAGGGG + Intronic
931231664 2:60380304-60380326 AAGTAGGGGTAATCTTGTAGGGG - Intergenic
931810989 2:65854912-65854934 TTTGAGGGGTACATTTGGAGAGG - Intergenic
933110936 2:78399072-78399094 TTGTAGTGCTAACTTGGTAGTGG - Intergenic
933348439 2:81121385-81121407 TCTTTGGGGTAAATTTGAAGTGG + Intergenic
939732808 2:145806233-145806255 CTGTAGGAGAAAATTTGTCGTGG - Intergenic
940060667 2:149563010-149563032 TTTTAATGGTAAAATTGTAGAGG - Intergenic
940709227 2:157142521-157142543 TTGTAGTGGTGGCTTTGTAGTGG + Intergenic
940802390 2:158146916-158146938 TTGTAGTGGTGGCTTTGTAGTGG - Intergenic
941679797 2:168385030-168385052 TTGTAGTGGTAACTTAGTAGTGG - Intergenic
941883805 2:170507730-170507752 TTGTAGGGGGAAATGTCTAGGGG + Intronic
942643119 2:178081597-178081619 TAGTAGGGGAAAATTTGGTGAGG - Intronic
947145528 2:227060582-227060604 TTGTAGGGGTAAAGAGGTGGTGG + Intronic
948367597 2:237467904-237467926 TTGTAGTGAAAAATTTATAGAGG - Intergenic
1173691680 20:44966043-44966065 TTGTAGGAGAAAATGTGCAGGGG + Intergenic
1174743270 20:53037596-53037618 TTTTACGGGTAAGTTTCTAGGGG + Intronic
1179045885 21:37844710-37844732 TTTTAGGGATGAATTTGGAGAGG - Intronic
951198343 3:19849224-19849246 TTGTAGTGGTGACTTGGTAGTGG - Intergenic
952077543 3:29715458-29715480 TTGAAGGCGGAAATTTGGAGGGG - Intronic
953720280 3:45349230-45349252 TTGTAGGGGTGAGTGTGTACTGG + Intergenic
953866593 3:46588530-46588552 TTGTAGTGGTGACTTGGTAGTGG - Intronic
955681985 3:61511977-61511999 TTATAGAGGTAAATTTGCTGGGG - Intergenic
960444605 3:117732639-117732661 TTTTAGGGGGGAATGTGTAGAGG + Intergenic
963531192 3:146475324-146475346 TTGTAGGGGCCATTTTGTGGGGG + Intronic
964246920 3:154664665-154664687 TTGTAGGGGAAATTTTGCAAAGG - Intergenic
964958441 3:162392418-162392440 GGGTAGGGGGCAATTTGTAGGGG - Intergenic
970291880 4:14581898-14581920 TTGCAGGGGTTAATTAGCAGAGG - Intergenic
973068986 4:45834192-45834214 TTGTAGGGGTGGCTTGGTAGTGG + Intergenic
973244348 4:47994857-47994879 TTGTAGTGGTGACTTGGTAGTGG + Intronic
974241379 4:59252962-59252984 TTGTATGTATAAATCTGTAGAGG + Intergenic
975217638 4:71774489-71774511 TTGTAGGGGTAAAGATAGAGGGG + Intronic
980270948 4:130583002-130583024 TAGCAGTGGTAAATTTGTATGGG + Intergenic
980544425 4:134239658-134239680 TAGTAAAGGTAAATATGTAGAGG + Intergenic
982345305 4:154351302-154351324 TTGTGTGGGCAAATTTGGAGGGG + Intronic
982453301 4:155577577-155577599 TTCTAGAGGTCAATTTCTAGAGG + Intergenic
983015348 4:162606439-162606461 TTGTGGGGGTAAATTTCTATCGG + Intergenic
983607474 4:169606267-169606289 TAGTAGAGGTAAATATGTACGGG - Intronic
986924941 5:12735174-12735196 TCGTAAGGGTAACTTTGTAAGGG - Intergenic
987781328 5:22439936-22439958 TTGTAAGTGTAAATATATAGAGG - Intronic
990792196 5:59494964-59494986 TTGTAGGGGGTAACTTGAAGGGG - Intronic
990806326 5:59666741-59666763 TTGTAGGGGCAAATTTCTAACGG - Intronic
990973855 5:61540116-61540138 TGTTAGGGTTAAATTTTTAGAGG + Intronic
992923621 5:81556211-81556233 GTGTTGGGGTAAATCTGTATTGG - Intronic
997570923 5:134926794-134926816 GTGTTGTGGTAAATATGTAGAGG + Intronic
1001342443 5:170860240-170860262 ATGTAGAAGAAAATTTGTAGAGG - Intergenic
1003941580 6:11033421-11033443 TCTTAAGGGTAAATTTTTAGGGG + Intronic
1004473258 6:15947776-15947798 TTATTGGGGTAACATTGTAGAGG + Intergenic
1004856267 6:19753712-19753734 TTGTGGGAGTAAATTTTTTGAGG - Intergenic
1008891876 6:56503394-56503416 TTGTAGGGGTATATATCTATGGG - Intronic
1009667179 6:66698490-66698512 TTGTAGAGGTAAATATTTACAGG + Intergenic
1012699913 6:102442581-102442603 ATGTAAGGGTAAATTTGATGGGG + Intergenic
1013671298 6:112406297-112406319 GTGTAGGTGTAGATTTGGAGTGG + Intergenic
1014151924 6:118067233-118067255 TTGTTGGGGTAAAGTTGGGGAGG + Intronic
1014944905 6:127485946-127485968 TTGTAGGAGTAAAGATATAGAGG + Intronic
1016545230 6:145214586-145214608 TTGTAGGGTTAAATTTTCACTGG - Intergenic
1016707122 6:147121917-147121939 TTTTAAGGGTAAATTTGTTATGG - Intergenic
1019702737 7:2481852-2481874 ATGTAGGGGTAAAGGTGCAGAGG - Intergenic
1021150952 7:17150105-17150127 TTGTTGAGGTAAATTTCTATAGG - Intergenic
1021202003 7:17737686-17737708 GTGTAGAGGGAAATTTGCAGCGG + Intergenic
1022504266 7:30900771-30900793 ATGTAGAGGTAAAGATGTAGGGG - Intergenic
1023774880 7:43595895-43595917 TTCTAGGGGGAAATTTGCAGTGG + Exonic
1024304650 7:47917780-47917802 TTGTAGTGGTAGCTTGGTAGTGG - Intronic
1025086774 7:56029807-56029829 TAGTAGGGATAAATTTGTTCAGG + Intronic
1027337517 7:77169430-77169452 TTGTAGGTGAAAATTTTAAGAGG - Intronic
1028889733 7:95973393-95973415 TTGTAGGTATTAATTTTTAGTGG - Intronic
1029778225 7:102701372-102701394 TTGTAGGTGAAAATTTTAAGAGG + Intergenic
1031441534 7:121800564-121800586 ATTTGGGGGTAAATTTGGAGGGG - Intergenic
1033891692 7:146020299-146020321 TCGTCTGGGTAAATATGTAGAGG - Intergenic
1039083118 8:33753850-33753872 TTGTAGTGGTGGATTGGTAGTGG + Intergenic
1039958167 8:42223123-42223145 TTGGAAGAGGAAATTTGTAGGGG - Intergenic
1041902052 8:62993101-62993123 TTGCATGGGGAAATTTTTAGGGG + Intronic
1042675946 8:71322199-71322221 TTGGAAGGGTAAATCTGTGGTGG + Exonic
1043966280 8:86481400-86481422 TTGTAGGGCTTAATTTTTAGTGG - Intronic
1047902662 8:129441143-129441165 TTGTGGGGGATTATTTGTAGAGG - Intergenic
1049295809 8:141836570-141836592 TTGTAGGGGTAGCTTGGTAATGG + Intergenic
1056236523 9:84600213-84600235 TTCCAGGAGAAAATTTGTAGTGG + Intergenic
1056844019 9:90022013-90022035 TTGTAGGGAAAAATATGTGGGGG - Intergenic
1202630412 M:11980-12002 GTGTTGTGGTAAATATGTAGAGG - Intergenic
1188019326 X:25139870-25139892 TTGCATAGGTAAATTTGTGGTGG - Intergenic
1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG + Intronic
1188734412 X:33694997-33695019 TTGAAAGGGAATATTTGTAGTGG + Intergenic
1190501735 X:51085819-51085841 TTGTAGAGGTAAAGTTGTCAGGG + Intergenic
1190523487 X:51304401-51304423 TGGTAGGGGTGAAGTTGTGGGGG + Intergenic
1191781681 X:64874909-64874931 TTGTAGAGGTAACTTTGTGTTGG - Intergenic
1193771742 X:85595408-85595430 TTGTAGTGCTAACTTGGTAGTGG - Intergenic
1194046867 X:89018162-89018184 TAGTAGGGGTAAATTTTTTTGGG + Intergenic
1196948097 X:120848777-120848799 TTGTAGTGGTAGCTTGGTAGTGG + Intergenic
1197102656 X:122674451-122674473 TTGTAGTGGTGGATTGGTAGTGG - Intergenic
1197107966 X:122738511-122738533 ATGAAGGCCTAAATTTGTAGTGG + Intergenic
1197469651 X:126851625-126851647 TAGTAGGTGTAAATATGTATGGG + Intergenic
1198712642 X:139522515-139522537 TTGTAGTGCTGACTTTGTAGTGG - Intergenic