ID: 1100945271

View in Genome Browser
Species Human (GRCh38)
Location 12:99776427-99776449
Sequence ACCTATTAGCTGAATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100945271 Original CRISPR ACCTATTAGCTGAATGAACA TGG (reversed) Intronic
901689605 1:10964119-10964141 ACCCATTACCTGGATGAACATGG + Exonic
902186980 1:14732921-14732943 AGGTATTTTCTGAATGAACAGGG + Intronic
903366092 1:22806276-22806298 ACTTATTAGCTGTATAAACTTGG - Intronic
903544352 1:24114325-24114347 ACTTATTAGCTGGATGACCTTGG + Intergenic
905180147 1:36160675-36160697 ACCTCTAAGCTGAATTATCATGG + Intronic
905378828 1:37545155-37545177 ACACATTACCTGAATGAGCAGGG + Intronic
906015061 1:42569170-42569192 AACTATCATCAGAATGAACAGGG + Intronic
906257925 1:44364865-44364887 ACTTATTAGCTGAGTGAACTTGG + Intergenic
907384087 1:54114555-54114577 ACTTATTAGCTGAGTGATCCTGG + Intergenic
907968197 1:59354434-59354456 ACTTATTAGCTGAGTGACCTTGG - Intronic
907975597 1:59428342-59428364 ACCTATTAGCTGAGTGACCTTGG - Intronic
908502135 1:64754212-64754234 ACCAATTAGCTGAATGATCTTGG - Intronic
909053578 1:70796645-70796667 AACTATCATCAGAATGAACAGGG - Intergenic
909406726 1:75298634-75298656 ACCTATTTGATGAAGGAATAAGG + Intronic
911166054 1:94725470-94725492 TCATTTTAGATGAATGAACAGGG + Intergenic
911339614 1:96620837-96620859 ACTTATTAGCTGAATGACCTTGG + Intergenic
912502967 1:110134632-110134654 ACCTTTTAGCTGTGTGATCATGG + Intergenic
913555520 1:119962823-119962845 ACTTATTAGATGAATGATTATGG - Intronic
914731171 1:150371693-150371715 ACCTATTAGCTGTGTAACCACGG - Intronic
916218564 1:162420357-162420379 ACCAATAACCTGAATGAACAAGG - Intergenic
917064977 1:171082659-171082681 AACTATTGGATGAATGAATAAGG - Intergenic
917588584 1:176453908-176453930 ACCTATTAGCTATAAGAACTTGG - Intergenic
918437385 1:184529929-184529951 ACTTATTAGCTGCATGACCTTGG + Intronic
919418688 1:197343834-197343856 ACTTATTAGCTGTATGACCTTGG - Intronic
919582543 1:199394605-199394627 ACACATTATCTGAATGAACATGG - Intergenic
919702361 1:200643675-200643697 ACCTATTAATTGAATTAGCAGGG + Intronic
921489407 1:215756226-215756248 ACCTATTAGCTGAACTTAAACGG - Intronic
923169364 1:231399345-231399367 ACATATTAGCTGTATGACCTTGG - Intronic
924620181 1:245653593-245653615 GCCTATTAGCTGTGTGAACTTGG - Intronic
1063617972 10:7618725-7618747 TCCAATTAGCAGAATGAAAAAGG + Intronic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1066130813 10:32391794-32391816 ACCTACTAGCTGAGTAAACTTGG + Intergenic
1070221312 10:74448337-74448359 ACCTATTAGCCGTATGACCTTGG + Intronic
1071135960 10:82455011-82455033 ACTCATTAGCTGAATGACCTTGG - Intronic
1072636800 10:97183526-97183548 ACCTATTAGCTGTGTGACCTTGG - Intronic
1072719917 10:97773914-97773936 ACATATTAGCTGTATGACCTTGG + Intergenic
1072875935 10:99173367-99173389 ACCTAGTAGCCAAATGAATATGG + Intronic
1073591899 10:104765846-104765868 ACTTATTAGCTGAGTGACCTTGG - Intronic
1074819888 10:117169930-117169952 ACTTATTAGCTGAATGACTCGGG + Intergenic
1076080674 10:127577893-127577915 TCCCATTAGCTTAATGAACTGGG - Intergenic
1079145971 11:17852210-17852232 ACTTAGTAGCTGAATGACCTTGG - Intronic
1079365990 11:19810468-19810490 ACTTTTCAGCTGAAAGAACAAGG + Intronic
1080856920 11:36120624-36120646 ACCTACTAGCTGAGTGACCCAGG - Intronic
1082989252 11:59193195-59193217 GCTTATTAGCTGAATGACCTTGG + Intronic
1083073967 11:60017965-60017987 ACTTGTTAGCTGCATGAACTTGG + Intergenic
1083078928 11:60070972-60070994 ACTTATTACCTGTATGAACATGG + Exonic
1085763075 11:79258947-79258969 ACCTACTAGCTGTATGGCCAGGG + Intronic
1086507225 11:87518312-87518334 ACCTACTAGCTGTATGACCTTGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088983803 11:114887942-114887964 ACAGATTAGCTGAGTGACCATGG + Intergenic
1089109973 11:116047776-116047798 ACCTATAAGCTGAATGACTTTGG + Intergenic
1090860897 11:130651543-130651565 ACCAAGTAGCTAAATCAACATGG - Intergenic
1092974418 12:13730532-13730554 ACTTGTTAGCTGAATGACCATGG - Intronic
1093942900 12:25074060-25074082 ACTTATTAGCTGTGTGAACTTGG + Intronic
1094152574 12:27301703-27301725 ACTTATTAGCTAAATGAGCTTGG - Intronic
1095291151 12:40481735-40481757 AACTATCAGCTGAAGGATCAGGG + Exonic
1099291033 12:80776795-80776817 ACCTATTAACTCATTGAATATGG - Intergenic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1101347874 12:103903313-103903335 ACCTATTAGCTGTGTGACCCTGG - Intergenic
1102020551 12:109679314-109679336 ACTTATTAGCTGAAGGGACTTGG - Intergenic
1103469582 12:121169399-121169421 ACCTATTATCTGAAGTAACTTGG + Intronic
1103981305 12:124738701-124738723 ACCTATTAGCTGTGTGACCCTGG - Intergenic
1104063368 12:125286347-125286369 ACCAAGTAACTGAATGATCATGG + Intronic
1104113247 12:125724141-125724163 ACCTATTAGCAGGATAAACCTGG - Intergenic
1104738768 12:131157363-131157385 CCCTATCACTTGAATGAACATGG - Intergenic
1105346745 13:19580044-19580066 ACTTATTAGCTGTATGAAGTTGG - Intergenic
1107380117 13:39848087-39848109 ATCAATTAACTGAAAGAACAAGG + Intergenic
1107884660 13:44865455-44865477 ACCTATTTGCTGAATGAATTAGG + Intergenic
1108005579 13:45942700-45942722 ACCCATGAGCTTAAAGAACAAGG - Intergenic
1108072244 13:46640408-46640430 ACCACTTAGCTGCATGAACTTGG - Intronic
1108321155 13:49291819-49291841 CCTTATTTTCTGAATGAACAAGG - Exonic
1109676980 13:65689593-65689615 AACTATTAGTTCAATGAAAAAGG + Intergenic
1110212264 13:72987595-72987617 TCTTAGTAGCTAAATGAACATGG + Intronic
1110559167 13:76891798-76891820 ACCTATTTGCTGTATGATCTTGG - Intergenic
1110652091 13:77953494-77953516 ACCTACAACCAGAATGAACATGG + Intergenic
1111506531 13:89196816-89196838 ACCTATCATCAGAGTGAACAGGG + Intergenic
1112002145 13:95220810-95220832 ACCCATTAGCTGAAGGAACAGGG - Intronic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1112656490 13:101456973-101456995 ACTTAATAGCTGTATGAACTTGG + Intronic
1113091540 13:106621835-106621857 ACCTATTTGCTGCATGTGCAAGG - Intergenic
1113334475 13:109364892-109364914 ACCTATGAGCTGTATGACCTTGG + Intergenic
1114467625 14:22935323-22935345 TCCTAGTAAATGAATGAACAGGG - Intergenic
1115151631 14:30293072-30293094 ACCTATCATCTGAGAGAACAGGG + Intergenic
1118285064 14:64464005-64464027 ACGTGTTTGCTGAGTGAACAAGG + Intronic
1118346203 14:64942917-64942939 TCCTATTAACAGACTGAACAAGG + Intronic
1118812358 14:69284637-69284659 ACTTACTAGCTGTGTGAACATGG + Intronic
1123784618 15:23657879-23657901 ATCCATTACCTCAATGAACATGG - Intergenic
1124395539 15:29297947-29297969 ATCTAGCAGCTGAATGCACATGG + Intronic
1125119226 15:36133340-36133362 ATCTACTAGCTGTATGAACTTGG - Intergenic
1125876372 15:43150059-43150081 ACCTATTATCTGAGAGCACAGGG - Intronic
1126387183 15:48106313-48106335 AAATATTTACTGAATGAACAAGG - Intergenic
1126494136 15:49271577-49271599 ACTTACTAGCTGAATGATCTTGG + Intronic
1127071605 15:55292339-55292361 ACTTATTAGCTGCATGATCTTGG - Intronic
1128372780 15:67052694-67052716 ACCTAGTGGCAGGATGAACACGG + Intergenic
1128607027 15:69044233-69044255 AAATATTTGCTAAATGAACAAGG - Intronic
1131508727 15:93037261-93037283 ACCTACTGGCTGCATGAAAAGGG - Intronic
1132210850 15:100021096-100021118 CCCTAGTATCTGAAGGAACATGG - Intronic
1134376739 16:13682916-13682938 ACTTATTAGCTGTGTGATCACGG - Intergenic
1135572466 16:23559337-23559359 ACCTATTAGCTTTGTGAACTTGG - Intronic
1137479763 16:48842480-48842502 ACCTATTAGCTGAGTGATCTTGG - Intergenic
1137752650 16:50878435-50878457 ACGTATCAGCTGAATGACCTTGG - Intergenic
1137851292 16:51747645-51747667 TGCTATTAGATGAAGGAACAAGG + Intergenic
1137880026 16:52036261-52036283 ACTTACTAGCTGCATGAACCTGG + Intronic
1137880193 16:52038020-52038042 ACTTATTAGCTGGGTGAACTTGG + Intronic
1138231462 16:55340044-55340066 ACTAATTAGATGAATGATCAAGG - Intergenic
1140724734 16:77801784-77801806 CCCCATTAGCTGATTGAACTAGG - Intronic
1141284430 16:82658553-82658575 GCTTATTAGCTGTATGAACTTGG + Intronic
1141870548 16:86782558-86782580 ATCTGTTGACTGAATGAACAGGG + Intergenic
1146300542 17:31685780-31685802 ATTTATTAGCTGTATGAACTTGG - Intergenic
1148488868 17:48010449-48010471 ACCTACGAGCTGGATGACCATGG - Intergenic
1149385611 17:56140582-56140604 ACCTAGTAGCTGGATGACCTTGG + Intronic
1149552137 17:57548267-57548289 ACCTATGATCTGCATGGACAGGG - Intronic
1150464865 17:65383889-65383911 TCCTACTAGCTGAATGAACTTGG + Intergenic
1150649924 17:67003287-67003309 ACCTATTAGCTGTATGATCTGGG - Intronic
1153585960 18:6620661-6620683 ATCTATTAGCTGAATAGACTTGG + Intergenic
1156022427 18:32615425-32615447 ACTTGGTAGCTGACTGAACATGG + Intergenic
1156039553 18:32805127-32805149 ACTTATAAGCTGTATGAACCTGG + Intergenic
1156666951 18:39420312-39420334 TCAAATTAGCTGAATGAACCTGG - Intergenic
1157151703 18:45224746-45224768 ACTTACTAGCTGTATGAACTTGG - Intronic
1157156899 18:45277196-45277218 ACATATTAGCTGTATGACCTCGG + Intronic
1158642623 18:59216629-59216651 ACCTTTTAGCTCAGTGACCATGG - Intergenic
1159133568 18:64309478-64309500 ACATATTCGATGAATGAAAATGG + Intergenic
1159575858 18:70176381-70176403 AATTATTCACTGAATGAACAAGG + Intronic
1163189442 19:15665860-15665882 ACTTATTAGCTGGGTGAACTTGG - Intergenic
1163217383 19:15890798-15890820 ACTTATTAGCTGGGTGAACTTGG + Intronic
1164445045 19:28309728-28309750 ACCTACGAGCTGTATGACCATGG - Intergenic
1164738079 19:30556724-30556746 AGCTACTGGCTGAATCAACAGGG + Intronic
928669487 2:33586103-33586125 AACTATCTGCTGAATGACCAAGG + Intronic
929129345 2:38551648-38551670 GCCAACAAGCTGAATGAACAAGG - Intergenic
932971013 2:76541906-76541928 AACTATCAGCAGAATAAACATGG + Intergenic
933299479 2:80525893-80525915 ACTTATTAGCTGTATGATCTGGG + Intronic
936772441 2:115930787-115930809 ACTTATTAGCAGAATCAACATGG - Intergenic
939140164 2:138345085-138345107 ACCTATGAAATGAATGCACATGG - Intergenic
939202089 2:139049760-139049782 AGCTGTTATCTAAATGAACAAGG - Intergenic
939774231 2:146364367-146364389 ACTTATTAGCTGTATGTGCATGG + Intergenic
940188196 2:151010037-151010059 ACCTATTAGCCCAAGGAAAATGG + Intronic
941271041 2:163429272-163429294 ACCTATTCAGTGAATGAACATGG + Intergenic
943467243 2:188243323-188243345 ACTTATCAGCTCTATGAACATGG - Intergenic
943562625 2:189482188-189482210 TCCTATTTGTTGAATGAAGATGG + Intergenic
943709139 2:191070788-191070810 ACTTATTAGCTGCATGGACTTGG + Intronic
944547991 2:200816944-200816966 ACTCATTAGCTGAATGATCTCGG - Intronic
944796274 2:203189099-203189121 ACCTATTACCTGAATGGATCCGG - Intronic
944901363 2:204219828-204219850 ACTTACTAGCTGCATGATCATGG + Intergenic
945051829 2:205831196-205831218 AGCTCTTAGCTGAATTAAGAAGG + Intergenic
947579050 2:231300631-231300653 ACTTATTAGCTGTGTGAACTTGG - Intronic
1168844620 20:935398-935420 ACCTTCTAGCTGAGTGAACCCGG + Intergenic
1169866321 20:10203685-10203707 ACTTATTAGCTGAATGTCCTTGG + Intergenic
1173151633 20:40571211-40571233 ACCAGTAAGCAGAATGAACATGG - Intergenic
1173335376 20:42108329-42108351 ACTTATTAGCTGCATGACCTCGG + Intronic
1173428975 20:42968702-42968724 TACTATTAGCTCAATGCACAAGG + Intronic
1173534777 20:43801124-43801146 CCTTACTAGCTGAATGACCATGG - Intergenic
1173656054 20:44701014-44701036 ACCTATTTGCTCAAATAACAAGG - Intergenic
1175557497 20:59878593-59878615 ACCTTTTAGCAGAAGGGACACGG - Intronic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1177091606 21:16776124-16776146 ACTTATTAGCTGAATCACCTAGG - Intergenic
1178378463 21:32088588-32088610 ACTTACTAGCTGAGTGAACATGG - Intergenic
1178753854 21:35329005-35329027 ACATATTAGTTGAATGAAGGAGG - Intronic
1181394320 22:22608536-22608558 ACCTATGTCCTGCATGAACATGG - Intergenic
1182751934 22:32648629-32648651 ACATATTAGCTACATGACCATGG + Intronic
949656130 3:6222237-6222259 ACATAATAGCTAAATAAACAGGG - Intergenic
951231211 3:20181721-20181743 CCCTACTAGTTGACTGAACAAGG + Intronic
951361518 3:21730130-21730152 GCCTATTAGGTGAAAGACCATGG - Intronic
951795728 3:26536355-26536377 CCCTATCAGCTGATTGAACAAGG - Intergenic
952448640 3:33409501-33409523 ACCTTTAAGCAGAATGAAAATGG - Exonic
952527189 3:34222983-34223005 AGTTATTAGCTGAAGTAACATGG + Intergenic
953622772 3:44547433-44547455 AGCTATTATCTGTATGAATATGG - Intergenic
954090663 3:48281481-48281503 ACTTATTAGCTGTGTGAACATGG - Intronic
955145410 3:56313421-56313443 AAATATTTGCTGAATGAAAATGG - Intronic
957543079 3:81601295-81601317 ACCTATTACCTGAGTGATCCAGG - Intronic
957932346 3:86897427-86897449 CGCTATTAGTTGAATGAACTGGG - Intergenic
958433175 3:94065942-94065964 ACTTATTAGCTGAGTGAACTTGG - Intronic
958555506 3:95670713-95670735 ACTTACTAGCTGTGTGAACATGG - Intergenic
959517227 3:107282058-107282080 ACCTATTAGTTGTGTGATCATGG - Intergenic
959707977 3:109357007-109357029 ACATTTGAGCTGAATGAAAAGGG - Intergenic
960163863 3:114380061-114380083 AGATATTGGCTGAATGAAAATGG + Intronic
960164398 3:114385346-114385368 ACCTATTAGCTGTATGTCCTGGG + Intronic
962832874 3:139159581-139159603 ACCTAAAAGCTGCTTGAACATGG - Intronic
963821376 3:149898507-149898529 ACCTAGTAGCTGTATGACCTTGG + Intronic
964901764 3:161668709-161668731 ACCTATTGGCTGAAAGTAAAGGG - Intergenic
964978245 3:162646033-162646055 ACTTATAACATGAATGAACATGG - Intergenic
965338197 3:167454127-167454149 GCCTACCTGCTGAATGAACAAGG - Intronic
965385457 3:168040199-168040221 ATATATTTACTGAATGAACAGGG - Intronic
965963647 3:174458794-174458816 ACCTAATAGCCCAATGAATAAGG + Intronic
966974872 3:185074680-185074702 ACCAAATATCTGGATGAACATGG - Intergenic
971142968 4:23944964-23944986 ACCTATTAGCTATATGACCTTGG + Intergenic
971478526 4:27094122-27094144 ACCTATTAGCTGCGTGGCCAGGG - Intergenic
971763980 4:30805340-30805362 ACCTATTAGCTGGCTGACTAAGG + Intronic
971905386 4:32717767-32717789 ATCAATCAGCTGATTGAACAAGG + Intergenic
971981832 4:33761620-33761642 ACCTCTAAGCTGACAGAACAAGG - Intergenic
972258872 4:37387999-37388021 ACTTATGAGCTGAATGACCTTGG + Intronic
973138440 4:46735389-46735411 ACCGATTAGCTATATGAACTTGG + Intronic
974306645 4:60151360-60151382 ACCTATCATCAGAGTGAACAGGG - Intergenic
974785631 4:66616878-66616900 ACCCATAAGCTCAATGAAAAAGG - Intergenic
977071204 4:92390317-92390339 ACTTATTTGCTGAATGATCTTGG - Intronic
977155755 4:93570985-93571007 AGCTGTTAAATGAATGAACAGGG - Intronic
978905468 4:114000617-114000639 AAATATTAGCTGAATCAAAAGGG + Intergenic
979277026 4:118825560-118825582 ACTTATTAGTTGTATGAACCTGG + Intronic
979322332 4:119338705-119338727 ACCTATTAGCTTTATTTACAAGG + Intergenic
979837953 4:125397308-125397330 ACTTATTAGCTAGATGAACTCGG - Intronic
981309100 4:143278718-143278740 ACTGATTAGTAGAATGAACATGG + Intergenic
982284202 4:153717467-153717489 ACCTCTTAGCTGACAGAACAAGG + Intronic
983240310 4:165224319-165224341 ACCTATTAGCTTTATTTACAAGG + Intronic
983861146 4:172708502-172708524 ACTTACTAGCTGAATTACCAAGG + Intronic
984595616 4:181664096-181664118 ACATACTAGCTGAATGATCCAGG + Intergenic
986627619 5:9737331-9737353 ACTTATTAGCTGAGTGACCTTGG + Intergenic
988772934 5:34450154-34450176 ACTTATTACCTGCATGACCATGG - Intergenic
988878957 5:35479263-35479285 AAATATTTGTTGAATGAACAAGG + Intergenic
989207795 5:38828809-38828831 ACCTGTTAGCTTAGAGAACAGGG - Intergenic
990017902 5:51088583-51088605 ACTTATTAGCTGAGTGAACTTGG + Intergenic
991630758 5:68654474-68654496 AGGTATTAGCTGAATGACCTTGG - Intergenic
993542618 5:89171385-89171407 ACCTAATATCTGAATGGAAAAGG + Intergenic
993753881 5:91703281-91703303 ACATATTTACTGAATAAACATGG - Intergenic
995984007 5:118146021-118146043 ACCGATTAGTTGATTGAATATGG + Intergenic
997924138 5:138012641-138012663 ACCAATTAGTGGAATGAATACGG - Intronic
998718748 5:144917472-144917494 GCCTATTAACTGAATGATCCTGG + Intergenic
998891241 5:146748182-146748204 ACTTACTAGCTAAATGACCATGG - Intronic
998921077 5:147069057-147069079 AACTATAAGCTGAAAGGACATGG + Intronic
999269988 5:150291274-150291296 ATTTATTAGCTGAGTGATCACGG + Intergenic
1001662990 5:173410439-173410461 AACTATCAGCTGAAAGGACAGGG - Intergenic
1001763582 5:174227020-174227042 ACCGATAGGCTGAATGAGCATGG + Intronic
1002036443 5:176474078-176474100 ACCTTTCAGCTGACTGAGCAAGG + Intronic
1002208537 5:177581326-177581348 ACTTATCAGCTGAATGACCTTGG - Intergenic
1003240868 6:4344575-4344597 TCCTACTAGCTGAGTGACCATGG + Intergenic
1003656678 6:8017773-8017795 AGCTATTAGGTGAGTGACCATGG - Intronic
1004567374 6:16811204-16811226 ACTTACTAGCTACATGAACATGG + Intergenic
1008833646 6:55800811-55800833 CCCTATTGGCTAAGTGAACATGG - Intronic
1009385801 6:63083300-63083322 AGCTATTATCTGCATGAATATGG - Intergenic
1011585936 6:88925194-88925216 ACTTATTAGATGCATGACCATGG + Intronic
1011991244 6:93520519-93520541 ACCTACTAGCTGAGTGAACTTGG - Intergenic
1012288919 6:97426596-97426618 ACTTCCTAGCTGCATGAACATGG - Intergenic
1013014534 6:106149393-106149415 ACCTTTATCCTGAATGAACAAGG + Intergenic
1013877277 6:114847701-114847723 ATTTATTAGCTGAATAAACTTGG - Intergenic
1014834793 6:126148546-126148568 ACATATTAGCTGAATGATCTGGG + Intergenic
1015296349 6:131597774-131597796 ACTTATTAAATGAATGAATAAGG + Intronic
1017372753 6:153732703-153732725 AACTATTATCAGAGTGAACAGGG + Intergenic
1018965303 6:168481308-168481330 ACATAGTAGCAGAATGAACAGGG + Intronic
1020731466 7:11886553-11886575 CCTTATTAACTGAATAAACAGGG + Intergenic
1021048311 7:15950944-15950966 ACCTACTGGTTGAATGATCAAGG - Intergenic
1025121222 7:56305641-56305663 ACCTATTAGCTGTGAGACCATGG - Intergenic
1028390156 7:90306489-90306511 AACTTTTAGGAGAATGAACATGG - Intronic
1032149398 7:129415160-129415182 GCCTCTTTGCTGAATGATCAAGG + Intronic
1033834221 7:145289169-145289191 TCTTATTAGCTGTATGAACTTGG - Intergenic
1038454707 8:27665495-27665517 ACGTATTAGCTAAATGACCTGGG + Intronic
1038776323 8:30534253-30534275 ACCTATAAGCTGTATGACCTTGG + Intronic
1041284962 8:56251178-56251200 AACTGTTAGCTGAATTAACCAGG + Intergenic
1041522367 8:58770626-58770648 ACCTACTAGCTGTATGACCTCGG - Intergenic
1041801793 8:61808441-61808463 ATCTATGAGCTGACTGAACTCGG + Intergenic
1041991340 8:63995681-63995703 ACCCCTTAGCTCAATAAACAAGG - Intergenic
1042919739 8:73909502-73909524 AGCTATTAGCTACATGAATATGG + Intergenic
1043061356 8:75508550-75508572 ACCTACTAGCTGAAAAAACGAGG - Intronic
1043184886 8:77135614-77135636 ACCTATGATCTGTGTGAACATGG + Intergenic
1046730882 8:117725034-117725056 AACCAGTAGCTGATTGAACAAGG - Intergenic
1047216098 8:122877123-122877145 ACCTATTAGCTGTGTGACCTTGG + Intronic
1047584292 8:126252862-126252884 GCTTATTAGCTGTAAGAACATGG + Intergenic
1048039523 8:130712156-130712178 ACCTGTTAGCTGTATGACCTTGG - Intergenic
1048229375 8:132621790-132621812 ACCTATTAGCTGTGTGACCTTGG + Intronic
1048281459 8:133108587-133108609 ACTTCTTAGCTGTATGAACTTGG - Intronic
1049839716 8:144763167-144763189 ACATACTTGCTGAATGGACAAGG - Intergenic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1051294552 9:15581971-15581993 AACTATCATCAGAATGAACAGGG + Intronic
1052334012 9:27301480-27301502 ACTTCTTAGCTGTATGATCATGG + Intergenic
1052356201 9:27507209-27507231 ACTTACTAGCTGTATGACCACGG - Intronic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1056333121 9:85538259-85538281 ACCTATTGGCTGCAGGAAAATGG - Intergenic
1056650150 9:88452277-88452299 ACCTACTAGCTGGATGACCTTGG - Intronic
1057375642 9:94519909-94519931 AACTATCATCAGAATGAACAGGG - Intergenic
1058488967 9:105474549-105474571 ACCTACTTGCTGACTGAATAGGG + Intronic
1058525935 9:105857673-105857695 ACCTATATGTTGAATGAACTTGG + Intergenic
1060870613 9:127037006-127037028 ACTTATTAGCTGTATGATCTTGG + Intronic
1186764505 X:12756997-12757019 TGCTACTATCTGAATGAACATGG + Intergenic
1186770322 X:12811816-12811838 AGCTTTGAGCAGAATGAACAAGG - Intronic
1187919831 X:24190819-24190841 ACTCATTAGCTGAATGAATTCGG + Intronic
1187997313 X:24942022-24942044 ACATATTTGCTGAATAAACTGGG - Intronic
1188479886 X:30626472-30626494 ACTTATTAACTGAATGACCTTGG - Intergenic
1188491827 X:30745967-30745989 AGATATTTGCTGAATGAATACGG + Intergenic
1188929181 X:36084985-36085007 ACCTACTAGCTGAGTGAGTATGG - Intronic
1189802985 X:44708759-44708781 CCCCATTAACTGCATGAACAAGG + Intergenic
1190644227 X:52509998-52510020 CCATATTATCTGAATGACCAAGG + Intergenic
1191086627 X:56574719-56574741 CCCTGTTAGCTGACTGAGCAAGG + Intergenic
1191162817 X:57350631-57350653 AACTATTAACTGAAAGAAAAGGG + Intronic
1192238058 X:69308595-69308617 ACTTACTAGCTGAATGATCTTGG - Intergenic
1193210233 X:78798778-78798800 ACATACTAGCTGCATGAACATGG - Intergenic
1193892991 X:87074462-87074484 TCATATTTGTTGAATGAACAAGG - Intergenic
1194509914 X:94781470-94781492 AGCTATTAGCTAAAAAAACAAGG + Intergenic
1195596985 X:106703452-106703474 ACGTACTAGCTGTATGACCATGG - Intronic
1195757175 X:108210954-108210976 ATCAATTAGCTGAGTGAACTTGG + Intronic
1196689510 X:118544337-118544359 ACTTACTAGCTGGATGACCATGG + Intronic
1197158294 X:123294222-123294244 ACCTATTAGCTGCATGACTCTGG - Intronic
1197409925 X:126104019-126104041 ACCAATTATTTGAGTGAACAGGG + Intergenic
1198192840 X:134327414-134327436 AACTATTAGCTAAATTAACCAGG - Intergenic
1198473485 X:136972697-136972719 ACTTACTAGCTGAATGACCATGG - Intergenic
1198720451 X:139612710-139612732 AGCAATTAGGTAAATGAACAAGG + Intronic
1198989517 X:142495279-142495301 ATCCATTAGCTGCAAGAACACGG - Intergenic
1199735267 X:150680273-150680295 AGCTGTTACCTGATTGAACAAGG + Intergenic
1200227965 X:154429522-154429544 ACCCATTAGCTGTATGAGCTTGG - Intronic