ID: 1100948966

View in Genome Browser
Species Human (GRCh38)
Location 12:99823968-99823990
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3322
Summary {0: 1, 1: 0, 2: 19, 3: 381, 4: 2921}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100948966_1100948969 22 Left 1100948966 12:99823968-99823990 CCATGCTGTTTTAGTTAATACTG 0: 1
1: 0
2: 19
3: 381
4: 2921
Right 1100948969 12:99824013-99824035 ATCTGCTATCATGATGCCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100948966 Original CRISPR CAGTATTAACTAAAACAGCA TGG (reversed) Intronic
Too many off-targets to display for this crispr