ID: 1100948969

View in Genome Browser
Species Human (GRCh38)
Location 12:99824013-99824035
Sequence ATCTGCTATCATGATGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100948968_1100948969 -4 Left 1100948968 12:99823994-99824016 CCTTATGGAATAGTTTGAAATCT 0: 1
1: 2
2: 35
3: 594
4: 2191
Right 1100948969 12:99824013-99824035 ATCTGCTATCATGATGCCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 267
1100948965_1100948969 28 Left 1100948965 12:99823962-99823984 CCAGTACCATGCTGTTTTAGTTA 0: 203
1: 14030
2: 9512
3: 6202
4: 4438
Right 1100948969 12:99824013-99824035 ATCTGCTATCATGATGCCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 267
1100948966_1100948969 22 Left 1100948966 12:99823968-99823990 CCATGCTGTTTTAGTTAATACTG 0: 1
1: 0
2: 19
3: 381
4: 2921
Right 1100948969 12:99824013-99824035 ATCTGCTATCATGATGCCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100948969 Original CRISPR ATCTGCTATCATGATGCCTC TGG Intronic
904404771 1:30279240-30279262 TTCAGCTATCCTGATGTCTCTGG - Intergenic
905159472 1:36018847-36018869 CTCTGCTATCATGAGGCTTTTGG - Intronic
905180958 1:36166302-36166324 ATAGGCTATCATGATGACTTTGG + Intronic
906675756 1:47692646-47692668 ATCTGCTATTTTCATGGCTCTGG + Intergenic
906729581 1:48069757-48069779 ATCTGCCATCATGATGCCATTGG - Intergenic
907424577 1:54371544-54371566 GTCTGCAATGATGGTGCCTCTGG + Intronic
907590254 1:55659881-55659903 ACCTGCTCTCATCAGGCCTCTGG + Intergenic
907768019 1:57429910-57429932 ATCAGGTAGTATGATGCCTCTGG + Intronic
908038619 1:60083356-60083378 ACATGCTACCATGATGCCTGTGG + Intergenic
908359398 1:63353846-63353868 TTCTGCTTCCCTGATGCCTCTGG + Intergenic
908726025 1:67178040-67178062 GTCAGGTAGCATGATGCCTCCGG + Intronic
909307571 1:74100626-74100648 GTCAGGTAGCATGATGCCTCCGG - Intronic
909380386 1:74991181-74991203 TTCAGGTAGCATGATGCCTCTGG - Intergenic
909696412 1:78473016-78473038 ATCTCCTATCATAGTGCCTGCGG - Intronic
910124566 1:83826225-83826247 ATCAGGTAGCATGATGCCTCCGG + Intergenic
910235816 1:85035410-85035432 ATCTGCCTACATGATGCCTATGG + Intronic
912186440 1:107282316-107282338 ATCAGCTAGCATGAAGTCTCAGG - Intronic
912446966 1:109744199-109744221 GTCAGGTAGCATGATGCCTCTGG + Intronic
915076922 1:153315690-153315712 GTCAGGTAGCATGATGCCTCCGG + Intergenic
915896168 1:159812875-159812897 CTCTACTAGCATGCTGCCTCTGG - Intronic
916151594 1:161797888-161797910 ATCAGGTAGCTTGATGCCTCTGG - Intronic
918027041 1:180760834-180760856 GTCAGGTAGCATGATGCCTCCGG - Intronic
919419913 1:197356959-197356981 TTCAGCTACCATGAAGCCTCAGG + Exonic
922186196 1:223276946-223276968 ATCTGTTTTGATGAAGCCTCTGG + Intronic
923669756 1:236030258-236030280 ACCTGCTACCATGATGGCTTAGG + Intronic
924151001 1:241129350-241129372 ATCTGAAATCATCCTGCCTCGGG - Intronic
924652699 1:245944709-245944731 GTTTGGTAGCATGATGCCTCCGG - Intronic
924856699 1:247881425-247881447 ATCTGCTTCCAGGAGGCCTCAGG - Intergenic
1062899265 10:1129997-1130019 ATTTGCTAGCATGAGACCTCGGG - Exonic
1062987692 10:1784751-1784773 ATCAGGTAGCATGATGCCTCTGG + Intergenic
1063324551 10:5084499-5084521 GTCAGGTAGCATGATGCCTCCGG + Intronic
1065656577 10:27957478-27957500 TTCTGCTATCCTGATGGTTCAGG - Intronic
1066639627 10:37542652-37542674 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1066813181 10:39368548-39368570 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1067572101 10:47379121-47379143 ATTTGCTATCAGGATGCTTCAGG + Intronic
1068262348 10:54599225-54599247 GTCAGGTAGCATGATGCCTCCGG - Intronic
1071395597 10:85220308-85220330 ATCAGGTAGTATGATGCCTCTGG - Intergenic
1073661004 10:105476239-105476261 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1074107790 10:110401580-110401602 CTTTGCTATCAAGATGGCTCTGG + Intergenic
1074241281 10:111641797-111641819 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1074254995 10:111793122-111793144 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1075699358 10:124459057-124459079 AAATGCAGTCATGATGCCTCGGG + Intergenic
1076743938 10:132503411-132503433 ATCTATTGTAATGATGCCTCGGG + Intergenic
1077057005 11:598685-598707 ATCTGCGACCACGCTGCCTCTGG + Intronic
1078644750 11:13130418-13130440 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1078863097 11:15271290-15271312 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1081161928 11:39759742-39759764 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1082118253 11:48350690-48350712 ATCAGGTAGCATGATGCCTCCGG - Intergenic
1082138252 11:48575772-48575794 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1082298255 11:50471826-50471848 ATCAGGTAGCGTGATGCCTCCGG + Intergenic
1082567258 11:54695730-54695752 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1082885220 11:58075028-58075050 GTCAGGTAGCATGATGCCTCTGG + Intronic
1083157618 11:60834445-60834467 CTCTGCTTTCAAGATGACTCTGG - Intergenic
1083496592 11:63059854-63059876 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1083497871 11:63074377-63074399 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1083501247 11:63110270-63110292 GTCAGGTAGCATGATGCCTCTGG + Intronic
1083542809 11:63525867-63525889 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1084800332 11:71539397-71539419 ATCTGCCATCGAGGTGCCTCAGG + Intronic
1086199560 11:84184993-84185015 ATCAGGTAGCGTGATGCCTCTGG + Intronic
1086883276 11:92174132-92174154 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1087421107 11:97925974-97925996 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1090756215 11:129794238-129794260 ATGAGCTCTCATGAGGCCTCTGG - Intergenic
1090986631 11:131772588-131772610 ATCTGCTTTCAAGCTCCCTCTGG - Intronic
1093391111 12:18623458-18623480 ATCAGGTAGTATGATGCCTCAGG + Intronic
1099755785 12:86846383-86846405 ATCAGGTAGCGTGATGCCTCTGG - Intergenic
1099756655 12:86859203-86859225 ATCAGGTAGCGTGATGCCTCTGG + Intergenic
1100948969 12:99824013-99824035 ATCTGCTATCATGATGCCTCTGG + Intronic
1101875437 12:108593961-108593983 ATCTCCTGTCCTGAGGCCTCAGG + Intronic
1104499124 12:129267752-129267774 GTCAGGTAGCATGATGCCTCTGG - Intronic
1104603722 12:130171735-130171757 ATTTGCTATCATGATGACCCAGG + Intergenic
1105235857 13:18552967-18552989 GTCAGCAAACATGATGCCTCTGG + Intergenic
1105895663 13:24715580-24715602 TTCTGCTATCATCATTCCACTGG + Intergenic
1107378387 13:39829441-39829463 TTCAGCTATCATGATGCTGCTGG + Intergenic
1107587053 13:41862015-41862037 GTCAGGTAGCATGATGCCTCAGG - Intronic
1111033179 13:82633822-82633844 ATCTGCTCTAAGGACGCCTCAGG + Intergenic
1111765426 13:92521345-92521367 GTCAGGTAGCATGATGCCTCCGG - Intronic
1114915846 14:27264332-27264354 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1115184702 14:30672630-30672652 ATCTGCAATCATGAGCACTCAGG - Intronic
1115794477 14:36918213-36918235 ATCTGCTATACTGATGTTTCAGG - Intronic
1116166130 14:41336461-41336483 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1117252211 14:53949313-53949335 CTCTGCTTTCATGATACCTCAGG - Intergenic
1120325551 14:83020578-83020600 GTCAGGTAACATGATGCCTCTGG - Intergenic
1120638286 14:86978659-86978681 ATCTGGTATTATGAAGCTTCTGG - Intergenic
1121822919 14:96985970-96985992 ATCTGCTATTCTTATTCCTCTGG + Intergenic
1121942589 14:98086708-98086730 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1123161400 14:106281795-106281817 GTTGGGTATCATGATGCCTCTGG - Intergenic
1123177185 14:106431192-106431214 ATCTGGTAGCATGATGCCTCTGG + Intergenic
1126763527 15:51991309-51991331 TTTTGCCAACATGATGCCTCGGG - Intronic
1126779685 15:52128869-52128891 ATTTGCTCTCATTCTGCCTCTGG - Intronic
1126991611 15:54384227-54384249 GTCAGATAGCATGATGCCTCCGG - Intronic
1127150291 15:56067559-56067581 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1127190276 15:56522982-56523004 GTCAACTAACATGATGCCTCTGG - Intergenic
1127580461 15:60334425-60334447 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1127748753 15:62009334-62009356 CTCTGCTTTCATGTTACCTCTGG - Intronic
1132237141 15:100230581-100230603 AGCTGTTATGAAGATGCCTCAGG - Intronic
1132362768 15:101231391-101231413 ATTAGCCATCATGGTGCCTCAGG - Intronic
1133578435 16:7117824-7117846 ATCTGCTTTCAAGCTCCCTCAGG + Intronic
1134532455 16:14994562-14994584 GTCAGGTAGCATGATGCCTCCGG + Intronic
1135882571 16:26272784-26272806 ATCTGCCTTAATGATGACTCCGG - Intergenic
1136695262 16:32074612-32074634 GTCGGGTATCATGATGCCTCTGG - Intergenic
1136795761 16:33017869-33017891 GTCGGGTATCATGATGCCTCTGG - Intergenic
1136874157 16:33836511-33836533 GTCGGGTATCATGATGCCTCTGG + Intergenic
1140027717 16:71305897-71305919 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1203098019 16_KI270728v1_random:1279528-1279550 GTCGGGTATCATGATGCCTCTGG - Intergenic
1144091619 17:11862442-11862464 GTCAGGTAGCATGATGCCTCCGG + Intronic
1144635170 17:16902138-16902160 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1145386449 17:22416032-22416054 TTCTGCTATCATGATGATGCTGG - Intergenic
1147410627 17:40249101-40249123 ATCTTCTATTTTCATGCCTCAGG - Intronic
1148903172 17:50893915-50893937 ATCTGCCAGCATGAGGGCTCAGG - Intergenic
1150289912 17:63975158-63975180 ATCTACCACCATGATGCTTCGGG - Intergenic
1153819034 18:8816926-8816948 ATCTGCTGCTAAGATGCCTCTGG - Intronic
1154513685 18:15137031-15137053 GTCAGCAAACATGATGCCTCTGG - Intergenic
1155591484 18:27432800-27432822 ATCTTCTATCATGATTACTATGG + Intergenic
1156671115 18:39470742-39470764 ACCAGCTCTCATGATGCCTTCGG - Intergenic
1156868798 18:41919388-41919410 ATATGCTATAATGATACTTCAGG + Intergenic
1157723204 18:49941896-49941918 GTCAGGTAGCATGATGCCTCTGG - Intronic
1158278943 18:55799912-55799934 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1158832589 18:61296661-61296683 TTCTTCTGTCATGATGCCTGGGG - Intergenic
1163180193 19:15593906-15593928 ATCTGATCTCCTGTTGCCTCTGG + Intergenic
1163775504 19:19215052-19215074 GCCTGCTAACACGATGCCTCAGG - Intronic
1164373333 19:27660438-27660460 CTCTGCCATAATGATGCCTTGGG + Intergenic
1165890489 19:39109322-39109344 CTCTGTTCTCATGATGACTCTGG + Intronic
1167420957 19:49402985-49403007 ATCTGCAATAATGAGGCCACAGG - Intronic
925768295 2:7258987-7259009 AGCTGCTCTCCTGCTGCCTCAGG - Intergenic
927035101 2:19166216-19166238 GTCAGGTAGCATGATGCCTCTGG - Intergenic
928392087 2:30917942-30917964 AACTGCCCTCGTGATGCCTCTGG + Intronic
930920589 2:56748814-56748836 ATCTGCTTTCAAAATGCATCTGG - Intergenic
930933338 2:56916680-56916702 GTCAGGTAGCATGATGCCTCTGG - Intergenic
930964705 2:57307913-57307935 GTCAGGTAGCATGATGCCTCTGG - Intergenic
933381808 2:81557759-81557781 GTCAGGTAGCATGATGCCTCTGG + Intergenic
933734082 2:85481073-85481095 ATCTGAAATCATGTAGCCTCTGG + Intergenic
934115956 2:88793744-88793766 GTCAGGTAGCATGATGCCTCCGG - Intergenic
938513926 2:131981642-131981664 GTCAGCAAACATGATGCCTCTGG - Intergenic
940703194 2:157072320-157072342 GTCAGGTAGCATGATGCCTCTGG - Intergenic
940896425 2:159085600-159085622 ATCTGCTTTGGTGAGGCCTCAGG + Intronic
941199164 2:162488135-162488157 ATCTGTTGTCAAGATGGCTCAGG - Intronic
943085546 2:183306768-183306790 CTCTGCTATTAAGATGCCTTGGG - Intergenic
943591847 2:189808215-189808237 ATCTGATATAATGATACCTGTGG + Intronic
945128312 2:206538030-206538052 ATCTGCTATCTTGATTTCTTGGG - Intronic
946354242 2:219175068-219175090 ATGTGCTATGATGCTGGCTCTGG - Exonic
947143155 2:227038489-227038511 ATCAGGTAGCCTGATGCCTCTGG + Intronic
1168992534 20:2106813-2106835 TTCTGCTGTCTTAATGCCTCTGG - Intronic
1171108834 20:22461938-22461960 ATCTGGTATCATGATTCCCATGG + Intergenic
1174166823 20:48590153-48590175 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1174966048 20:55216476-55216498 ATGTGCTATAATTATGCCTTTGG - Intergenic
1176779856 21:13181253-13181275 GTCAGCAAACATGATGCCTCTGG + Intergenic
1177477162 21:21638526-21638548 GTCTGGTATTGTGATGCCTCTGG + Intergenic
949376484 3:3395888-3395910 GTCAGGTAGCATGATGCCTCTGG + Intergenic
950603382 3:14056531-14056553 GTCAGGTAGCATGATGCCTCCGG - Intronic
956284651 3:67595955-67595977 ATCTGCCATCCTGATGTCTTAGG - Intronic
956976648 3:74588674-74588696 GTCAGGTAGCATGATGCCTCCGG - Intergenic
957007260 3:74964385-74964407 ATCTGCCATTATGATGCATATGG + Intergenic
957559030 3:81797686-81797708 GTCAGGTAGCATGATGCCTCTGG + Intergenic
957688498 3:83536790-83536812 GTCAGGTAGCATGATGCCTCCGG - Intergenic
958148879 3:89663280-89663302 ATCTGCTATTTTGAATCCTCTGG + Intergenic
958916355 3:100054766-100054788 AACTTCTATCACAATGCCTCTGG + Intronic
959327302 3:104954059-104954081 ATATGCTATCATGTTGCTTAAGG - Intergenic
959408823 3:105995676-105995698 GTCAGGTAGCATGATGCCTCTGG - Intergenic
960462175 3:117949747-117949769 GTCAGGTAGCATGATGCCTCTGG - Intergenic
960560495 3:119078234-119078256 ATCAGGTAGTATGATGCCTCTGG - Intronic
964377596 3:156064628-156064650 GTCAGGTAGCATGATGCCTCAGG + Intronic
964905702 3:161717614-161717636 CTCTGCTCTCATGATGCTTTGGG - Intergenic
965172881 3:165290960-165290982 GTCAGCTAACATGATGCCCCTGG + Intergenic
965576688 3:170224201-170224223 ATTTGCTGCCATGAAGCCTCTGG + Intronic
967302271 3:188026629-188026651 CTCTGGCATCATGAGGCCTCAGG + Intergenic
967713693 3:192739120-192739142 ATCTGGTATCATGCTGACTAGGG - Intronic
969069978 4:4528498-4528520 ATCTGCTTTTGTGAAGCCTCAGG - Intronic
970014693 4:11500297-11500319 GTCAGGTAGCATGATGCCTCCGG + Intergenic
970496747 4:16633831-16633853 GTCAGGTAGCATGATGCCTCCGG - Intronic
971642085 4:29147168-29147190 GTCAGGTAGCATGATGCCTCTGG + Intergenic
975083441 4:70308199-70308221 GTCAGGTAGCATGATGCCTCCGG - Intergenic
975105723 4:70566864-70566886 GTCAGGTAGCATGATGCCTCTGG + Intergenic
975460348 4:74645366-74645388 ATCAGGTAATATGATGCCTCTGG - Intergenic
975807785 4:78131106-78131128 ATCTGCTTTCATTGTGCCTTGGG + Intronic
977515779 4:98019439-98019461 GTCAGGTAGCATGATGCCTCCGG + Intronic
978676012 4:111317075-111317097 GTCAGGTAGCATGATGCCTCCGG + Intergenic
979044708 4:115848618-115848640 TTCTCTTAGCATGATGCCTCTGG - Intergenic
979494724 4:121370499-121370521 TTCTGCTATCCTGCTGCCGCGGG + Intronic
979653092 4:123159252-123159274 ATCTGATATTATGATGCTTTTGG + Intronic
979706490 4:123726097-123726119 GTCAGGTAGCATGATGCCTCCGG - Intergenic
980987325 4:139708485-139708507 GTCAGGTATCGTGATGCCTCCGG + Intronic
983065752 4:163208360-163208382 GTCAGGTAGCATGATGCCTCCGG + Intergenic
983303704 4:165959134-165959156 GTCAGGTAGCATGATGCCTCCGG + Intronic
984268502 4:177522622-177522644 GTCAGGTAGCATGATGCCTCCGG + Intergenic
985869104 5:2539688-2539710 CTCTGCCACCATGATGCCTCTGG + Intergenic
987500926 5:18708621-18708643 GTCTGGTAACATGATGTCTCTGG - Intergenic
987668879 5:20982811-20982833 ATATGCTATCTTCATGTCTCTGG - Intergenic
989809601 5:45657959-45657981 GTCAGGTAGCATGATGCCTCCGG - Intronic
990927540 5:61044747-61044769 ATCTGATAGTGTGATGCCTCTGG + Intronic
994160730 5:96554123-96554145 GTCAGGTAGCATGATGCCTCTGG - Intronic
994298425 5:98118143-98118165 GTCAGGTAGCATGATGCCTCCGG - Intergenic
994308591 5:98238795-98238817 GTCAGGTAGCATGATGCCTCCGG - Intergenic
994434462 5:99709817-99709839 GTCAGGTAGCATGATGCCTCCGG + Intergenic
994741241 5:103622083-103622105 TTCTGTTAACAAGATGCCTCTGG - Intergenic
995018425 5:107339939-107339961 ATCTGCCATCATGGAGCCTTTGG - Intergenic
995330278 5:110938683-110938705 GTCAGGTAGCATGATGCCTCCGG - Intergenic
995556346 5:113332969-113332991 ATCTGCTACCTTGATGTTTCAGG - Intronic
995668425 5:114571458-114571480 ATCAGCTAACGTGATACCTCTGG + Intergenic
995764322 5:115599647-115599669 CTCTGTTAGCATGCTGCCTCAGG - Intronic
996251532 5:121340434-121340456 GTCAGGTAGCATGATGCCTCTGG + Intergenic
997787801 5:136729380-136729402 ATTTGGTTTTATGATGCCTCAGG - Intergenic
1000741826 5:164977804-164977826 AACTGGTAACATGATTCCTCTGG + Intergenic
1003468030 6:6400040-6400062 ATCAGCTACCATGATCCATCTGG - Intergenic
1005672964 6:28125582-28125604 CTCTGCTATCAGGATGCACCTGG + Exonic
1005692029 6:28315820-28315842 CTCTGCTATCAGGATTCCCCTGG - Intergenic
1009229837 6:61048826-61048848 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1009495833 6:64345269-64345291 GTCAGGTAGCATGATGCCTCTGG - Intronic
1009528245 6:64775366-64775388 ATCTTCTATCCTATTGCCTCAGG - Intronic
1009652496 6:66493756-66493778 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1010023997 6:71194602-71194624 ATCTGCTATGATGATACTCCAGG - Intergenic
1010353947 6:74908474-74908496 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1010589411 6:77695686-77695708 GTCAGGTAGCATGATGCCTCCGG + Intronic
1010758293 6:79692779-79692801 GTCAGGTAGCATGATGCCTCTGG + Intronic
1011211116 6:84957729-84957751 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1011358117 6:86493537-86493559 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1012235906 6:96814785-96814807 ATTGGCTCTCATGCTGCCTCAGG - Intronic
1012507158 6:99960550-99960572 GTCAGGTAGCATGATGCCTCTGG - Intronic
1012507977 6:99970984-99971006 GTCAGGTAGCATGATGCCTCTGG + Intronic
1014128063 6:117800102-117800124 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1014157319 6:118126403-118126425 GTCAGGTAGCATGATGCCTCCGG + Intronic
1014529139 6:122538601-122538623 GTCAGGTAGCATGATGCCTCCGG + Intronic
1014583433 6:123166902-123166924 ATCAGGTAACATGATTCCTCTGG - Intergenic
1016638667 6:146324014-146324036 ATCAGGTAGCATGATGCCTCTGG + Intronic
1017994113 6:159516634-159516656 ATTGGGTAACATGATGCCTCTGG + Intergenic
1020735596 7:11945424-11945446 GTCAGGTAACATGATGCCTCTGG + Intergenic
1023666942 7:42533193-42533215 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1024300899 7:47886711-47886733 ATCTGCTCTGATGAGGCCTCAGG - Intronic
1024563264 7:50662007-50662029 ACCTGCTTTCAGGATGCCTTTGG - Intronic
1025847739 7:65215973-65215995 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1025897988 7:65721842-65721864 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1027408598 7:77889326-77889348 CTCTGATTTCATGATGCCACTGG + Intronic
1027496375 7:78892448-78892470 GTCAGGTAGCATGATGCCTCCGG - Intronic
1029310134 7:99655501-99655523 GTCAGGTAGCATGATGCCTCCGG + Intronic
1031801748 7:126255466-126255488 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1033719883 7:144048230-144048252 TTTTGATATAATGATGCCTCAGG - Intergenic
1035554997 8:560894-560916 GTCAGGTAACATGATGCCTCTGG - Intergenic
1035646856 8:1230577-1230599 GTCAGGTAACATGATGCCTCTGG - Intergenic
1037141279 8:15523106-15523128 ATCTGCCAGCATGATGCCGTAGG + Intronic
1038485808 8:27934465-27934487 ATCTCTTCTCATGATGCCCCTGG - Intronic
1039379343 8:37070377-37070399 AACTCATATCATGATGCCACTGG + Intergenic
1041916873 8:63147128-63147150 TTCTGCTATCTTGCTGACTCAGG + Intergenic
1042818098 8:72900066-72900088 GTCAGGTAGCATGATGCCTCTGG - Intronic
1043280105 8:78453448-78453470 ATATGGTATCATAATGGCTCAGG - Intergenic
1047688373 8:127323959-127323981 ATCTGCTCCCATGATGATTCAGG - Intergenic
1048681593 8:136848215-136848237 GTCTGGTAACATGATGCCTCTGG - Intergenic
1050425282 9:5506732-5506754 GTCTGGTAGGATGATGCCTCTGG - Intergenic
1050440785 9:5661256-5661278 GTCAGGTAGCATGATGCCTCTGG + Intronic
1050750235 9:8928613-8928635 GTCAGGTAGCATGATGCCTCTGG + Intronic
1050836847 9:10092671-10092693 ATCAGGTAATATGATGCCTCGGG - Intronic
1050975818 9:11936694-11936716 ATCTGCCAACATCATGCCTTGGG + Intergenic
1051581550 9:18681183-18681205 ATCTGCTGCCATGAAGCCACAGG - Intronic
1052465638 9:28825952-28825974 ATTTTCTATGATGATTCCTCTGG + Intergenic
1054997781 9:71411816-71411838 GTCAGGTAGCATGATGCCTCCGG - Intronic
1055755930 9:79557205-79557227 ATCTGAAATCAGGATGCATCAGG - Intergenic
1056346634 9:85703036-85703058 ATCTGCTATTCTGAGCCCTCTGG + Intronic
1056571714 9:87822531-87822553 GTCTGGTAGCATGATGCCCCTGG - Intergenic
1059457781 9:114410658-114410680 ATCTGGTCCCATGATGCTTCAGG + Intronic
1059603055 9:115802493-115802515 GTCTGGTAGCGTGATGCCTCTGG - Intergenic
1203451046 Un_GL000219v1:117070-117092 ATCTGGTATAATGTTTCCTCTGG + Intergenic
1187594794 X:20759092-20759114 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1188109924 X:26184915-26184937 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1188798170 X:34492262-34492284 ATATTCTATCATGCTCCCTCAGG - Intergenic
1190669558 X:52727714-52727736 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1190669859 X:52730690-52730712 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1191135060 X:57055237-57055259 TTTTGGTATCATGATGCCACTGG + Intergenic
1191144119 X:57148184-57148206 GTCAGGTAGCATGATGCCTCCGG + Intergenic
1192695162 X:73406070-73406092 ATAAGGTAGCATGATGCCTCCGG - Intergenic
1193206980 X:78760728-78760750 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1193464151 X:81826946-81826968 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1193717859 X:84952817-84952839 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1193854909 X:86588288-86588310 ATCTGATAACATGATGCCTTTGG + Intronic
1194078441 X:89427486-89427508 ATCAGCTATTGTGATGCCTCTGG - Intergenic
1194211117 X:91070640-91070662 ATCAGGTAACGTGATGCCTCTGG - Intergenic
1194913452 X:99675690-99675712 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1194970307 X:100335832-100335854 AGCTGCTTTCATCCTGCCTCTGG - Intronic
1195037835 X:100986257-100986279 CTCTGCTATCATGAGGTTTCAGG - Intronic
1195366562 X:104132210-104132232 ATCTCCTATCCTGATATCTCTGG - Intronic
1196570247 X:117258144-117258166 ATATGGTATCATAATACCTCTGG + Intergenic
1196577142 X:117332513-117332535 AGCTGCTATAGTGATGTCTCAGG + Intergenic
1197067873 X:122255821-122255843 GTCAGGTAGCATGATGCCTCCGG - Intergenic
1197131066 X:123006222-123006244 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1197350435 X:125375477-125375499 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1200431049 Y:3082608-3082630 ATCAGCTATTGTGATGCCTCTGG - Intergenic
1201695277 Y:16817851-16817873 ATCTGCTTTGAGGATGCCTTAGG - Intergenic
1201796220 Y:17899351-17899373 GTCAGGTAGCATGATGCCTCTGG - Intergenic
1201805335 Y:18006634-18006656 GTCAGGTAGCATGATGCCTCTGG + Intergenic
1202061156 Y:20889694-20889716 GTCAGGTAGCATGATGCCTCCGG - Intergenic