ID: 1100955824

View in Genome Browser
Species Human (GRCh38)
Location 12:99906994-99907016
Sequence TGTGTGTAAGCTCTGCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1696
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 1632}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100955824_1100955827 10 Left 1100955824 12:99906994-99907016 CCTGAAGGCAGAGCTTACACACA 0: 1
1: 0
2: 1
3: 62
4: 1632
Right 1100955827 12:99907027-99907049 TACAGTCAAGTATCCAGGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 575
1100955824_1100955826 5 Left 1100955824 12:99906994-99907016 CCTGAAGGCAGAGCTTACACACA 0: 1
1: 0
2: 1
3: 62
4: 1632
Right 1100955826 12:99907022-99907044 AAGGATACAGTCAAGTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 112
1100955824_1100955830 28 Left 1100955824 12:99906994-99907016 CCTGAAGGCAGAGCTTACACACA 0: 1
1: 0
2: 1
3: 62
4: 1632
Right 1100955830 12:99907045-99907067 CAAGGACACAGGACAAGAACAGG 0: 1
1: 0
2: 0
3: 37
4: 304
1100955824_1100955828 17 Left 1100955824 12:99906994-99907016 CCTGAAGGCAGAGCTTACACACA 0: 1
1: 0
2: 1
3: 62
4: 1632
Right 1100955828 12:99907034-99907056 AAGTATCCAGGCAAGGACACAGG 0: 1
1: 0
2: 1
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100955824 Original CRISPR TGTGTGTAAGCTCTGCCTTC AGG (reversed) Intronic
900004966 1:39114-39136 TGTCTCTTGGCTCTGCCTTCTGG - Intergenic
900172774 1:1277754-1277776 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
900197519 1:1384325-1384347 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
900347985 1:2220095-2220117 TCTGTGTAAACTCTGCCTCTCGG - Intergenic
901035816 1:6335416-6335438 TCACTGTAATCTCTGCCTTCCGG - Intronic
901041534 1:6367122-6367144 TCACTGCAAGCTCTGCCTTCTGG - Intronic
901388630 1:8927805-8927827 GGAGTGTAACCTCTGCCTCCTGG - Intergenic
901612242 1:10508279-10508301 TGTCTGCAAGCTCCGCCTCCCGG + Intronic
901769533 1:11523247-11523269 TGTGTGTTAGCCCTTCCTTTGGG - Intronic
901794848 1:11674227-11674249 TCACTGCAAGCTCTGCCTTCCGG - Exonic
901948451 1:12722250-12722272 TCACTGTAACCTCTGCCTTCTGG - Intronic
901980256 1:13028784-13028806 TCTCTGCAACCTCTGCCTTCTGG + Intronic
902001830 1:13200147-13200169 TCTCTGCAACCTCTGCCTTCTGG - Intergenic
902234262 1:15047694-15047716 TCAGTGCAACCTCTGCCTTCTGG - Intronic
902519421 1:17007624-17007646 TCACTGCAAGCTCTGCCTTCCGG + Intronic
902872120 1:19320486-19320508 TCACTGCAAGCTCTGCCTTCCGG + Intronic
902899019 1:19501012-19501034 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
902912658 1:19612115-19612137 TCACTGCAAGCTCTGCCTTCTGG + Intronic
902913646 1:19621620-19621642 TGTGTGATAGCTCAGCCTTTAGG + Intronic
903449092 1:23440779-23440801 TCACTGTAAGCTCCGCCTTCCGG - Intronic
903544877 1:24117810-24117832 TATGCGGACGCTCTGCCTTCTGG + Intergenic
903745352 1:25582995-25583017 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
903828703 1:26162186-26162208 TTTGCGTAAGCCCTTCCTTCTGG + Exonic
904501997 1:30918492-30918514 TCACTGTAACCTCTGCCTTCCGG - Intergenic
904698343 1:32343184-32343206 TGACTGCAACCTCTGCCTTCCGG - Intergenic
904771371 1:32883110-32883132 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
904782342 1:32959974-32959996 TCAGTGCAAGCTCTGCCTGCCGG - Intronic
904806871 1:33138132-33138154 AGGGTGTAACCTCTGCCTACTGG - Intergenic
904990445 1:34588499-34588521 TCATTGTAAACTCTGCCTTCTGG - Intergenic
905175816 1:36134734-36134756 TATATGTAAGCTTTGCTTTCAGG + Intergenic
905293686 1:36940775-36940797 TGAGTGTGAGCTCTGTTTTCAGG - Intronic
905445403 1:38025501-38025523 TGTGTGTATGCACTCCCTTCTGG + Intergenic
905528754 1:38659926-38659948 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
905612334 1:39365149-39365171 TCACTGCAAGCTCTGCCTTCTGG + Intronic
905686430 1:39912110-39912132 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
906156239 1:43615639-43615661 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
906388274 1:45390990-45391012 TCACTGTAAGCTCTGCCTCCCGG + Intronic
906422579 1:45683278-45683300 TCACTGGAAGCTCTGCCTTCCGG + Intronic
906426260 1:45715564-45715586 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
906619480 1:47263825-47263847 TGACTGTAACCTCTGCCTTCTGG + Intronic
906849477 1:49232622-49232644 TCACTGTAAGCTCTGCCTCCTGG - Intronic
906912194 1:49966014-49966036 TCACTGCAAGCTCTGCCTTCCGG + Intronic
906988653 1:50713846-50713868 TCACTGTAACCTCTGCCTTCTGG + Intronic
907352684 1:53845978-53846000 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
907422252 1:54355422-54355444 TCACTGTAACCTCTGCCTTCTGG + Intronic
907431509 1:54414808-54414830 TCACTGTAACCTCTGCCTTCCGG + Intergenic
907431940 1:54417579-54417601 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
907622419 1:55995072-55995094 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
907653934 1:56323104-56323126 TGACTGTAATCTCCGCCTTCTGG + Intergenic
908007510 1:59741862-59741884 TCACTGCAAGCTCTGCCTTCCGG - Intronic
908791848 1:67790682-67790704 TCTCTGTAACCTCTGCCTCCCGG + Intronic
908883564 1:68760791-68760813 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
909442286 1:75710850-75710872 TGTTTCTAAGACCTGCCTTCTGG - Intergenic
909462151 1:75929297-75929319 TCATTGCAAGCTCTGCCTTCCGG + Intronic
909513267 1:76478835-76478857 TCACTGTAAGCTCTGCCTCCTGG + Intronic
910597782 1:88997814-88997836 TGACTGAAAGCTCCGCCTTCCGG - Intergenic
910787756 1:91019643-91019665 TCTCTGCAACCTCTGCCTTCCGG + Intronic
910861472 1:91746451-91746473 TGGGGGTAAGCTCTTCCATCAGG - Intronic
910880794 1:91920740-91920762 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
910944806 1:92578641-92578663 TCACTGGAAGCTCTGCCTTCCGG - Intronic
911024481 1:93422605-93422627 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
911303083 1:96199199-96199221 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
911644340 1:100322048-100322070 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
911728353 1:101266162-101266184 TCTGTGCAAACTCTGCCTCCAGG + Intergenic
911890480 1:103362762-103362784 TGTGTTTAAGCTATTTCTTCTGG + Intergenic
912012295 1:104982228-104982250 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
912025074 1:105159819-105159841 ACTGTGCAAGCTCTGCCTTCAGG - Intergenic
912201837 1:107466775-107466797 TGTGTGGAAGCTATGCCTTCAGG - Intronic
912774321 1:112495512-112495534 TGGCTGCAAGCTCCGCCTTCTGG - Intronic
912917903 1:113835441-113835463 TCACTGCAAGCTCTGCCTTCCGG - Intronic
913268161 1:117065520-117065542 TCACTGTAAGCTCTGCCTCCGGG - Intronic
913392944 1:118334512-118334534 AGTGTATATTCTCTGCCTTCTGG + Intergenic
913674316 1:121126768-121126790 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
913709442 1:121467199-121467221 TGTCTGCAACCTCTGCCTCCTGG + Intergenic
914026099 1:143914077-143914099 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
914664535 1:149821818-149821840 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
914671229 1:149871994-149872016 TCACTGCAAGCTCTGCCTTCTGG + Intronic
914854266 1:151339189-151339211 TCACTGTAACCTCTGCCTTCCGG - Intergenic
914966189 1:152259805-152259827 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
915157125 1:153886600-153886622 TTAGTGCAAGCTCTGCCTCCCGG + Intronic
915180089 1:154051282-154051304 TCACTGTAAGCTCTGCCTCCTGG + Intronic
915180610 1:154055982-154056004 TCAGTGCAACCTCTGCCTTCTGG - Intronic
915184357 1:154092148-154092170 TCATTGTAAGCTCCGCCTTCCGG + Intronic
915331825 1:155117338-155117360 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
915487459 1:156231792-156231814 TTGGTGTAAACTCTGCCCTCAGG + Intronic
916024899 1:160824903-160824925 TCACTGTAAGCTCTGCCTCCTGG - Intronic
916073874 1:161188790-161188812 TCACTGTAAGCTCTGCCTCCCGG + Exonic
916602162 1:166303822-166303844 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
916635907 1:166668347-166668369 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
916728259 1:167543170-167543192 TCACTGTAAGCTCTGCCTCCTGG - Intronic
916798693 1:168192809-168192831 TCACTGCAAGCTCTGCCTTCCGG - Intronic
916902560 1:169245052-169245074 TCACTGTAAGCTCTGCCTCCTGG - Intronic
917055143 1:170972735-170972757 TCACTGTAAGCTCTGCCTCCTGG - Intronic
917096787 1:171406302-171406324 TCACTGTAACCTCTGCCTTCTGG + Intergenic
917132739 1:171759320-171759342 TCACTGCAAGCTCTGCCTTCAGG + Intergenic
917368986 1:174268272-174268294 TCACTGTAAGCTCTGCCTCCCGG + Intronic
917634887 1:176925878-176925900 TCACTGTAAGCTCTGCCTCCCGG + Intronic
917938646 1:179894174-179894196 TCACTGCAAGCTCTGCCTTCCGG - Intronic
918000574 1:180490709-180490731 TCACTGTAAGCTCTGCCTCCTGG - Intronic
918270443 1:182893284-182893306 TGTCTGCAACCTCTGCCTCCTGG - Intergenic
918339274 1:183553811-183553833 TGTGTTTGAGCTCTGCATTCAGG + Exonic
918858272 1:189787813-189787835 TCACTGTAACCTCTGCCTTCCGG + Intergenic
918992813 1:191720680-191720702 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
919068286 1:192721494-192721516 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
919158003 1:193791610-193791632 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
919259221 1:195168610-195168632 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
919628159 1:199932991-199933013 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
919687502 1:200497944-200497966 TCAGTGCAACCTCTGCCTTCTGG + Intergenic
919713831 1:200754655-200754677 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
920117659 1:203631867-203631889 TCACTGTAAGCTCTGCCTTCCGG + Intronic
920829994 1:209455894-209455916 TGTGTGGAAGAGCTGCCTTTGGG - Intergenic
920961397 1:210667003-210667025 TCACTGCAAGCTCTGCCTTCCGG - Intronic
921261751 1:213390624-213390646 TGTGTGTCTGCTTTGCCTTGAGG + Intergenic
921632676 1:217454512-217454534 TCACTGCAAGCTCTGCCTTCCGG - Intronic
921682681 1:218052803-218052825 TGACTGCAAACTCTGCCTTCCGG - Intergenic
922056465 1:222046506-222046528 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
922431865 1:225562495-225562517 TCACTGCAAGCTCTGCCTTCCGG - Intronic
922487347 1:225984733-225984755 TTACTGCAAGCTCTGCCTTCCGG - Exonic
922772953 1:228198401-228198423 TCTCTGCAAGCTTTGCCTTCTGG + Intergenic
923170477 1:231411922-231411944 TGCCTGCAACCTCTGCCTTCTGG - Intronic
923173334 1:231437922-231437944 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
923326907 1:232888150-232888172 TGTCTGGCAGCTCTGCTTTCAGG - Intergenic
923640463 1:235754305-235754327 TCACTGTAACCTCTGCCTTCTGG + Intronic
924544302 1:245010754-245010776 TCACTGCAAGCTCTGCCTTCCGG + Intronic
924555460 1:245114798-245114820 TCGGTGCAACCTCTGCCTTCTGG + Intronic
1062877977 10:957102-957124 AGAGTGCAAGCTCTTCCTTCCGG + Intergenic
1063027169 10:2191934-2191956 TGTGTTTTTGCTCTGTCTTCTGG + Intergenic
1063411933 10:5842839-5842861 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1063606971 10:7531249-7531271 TGGGTGTCAGCTCTGCATTTGGG - Intergenic
1063617637 10:7615170-7615192 TGCATGCAACCTCTGCCTTCTGG - Intronic
1063821647 10:9843237-9843259 TGACTGTAACCTCTGCCTCCTGG + Intergenic
1064169695 10:13019157-13019179 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1064548499 10:16475201-16475223 TGTTTGTAACCTCTGGCTTAGGG - Intronic
1064629435 10:17294818-17294840 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1064997988 10:21313318-21313340 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1065013906 10:21443915-21443937 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1065028410 10:21561333-21561355 TGGGTGCAAGTTCTGCCTCCTGG + Intronic
1065123712 10:22552912-22552934 GGTCTGTCATCTCTGCCTTCAGG - Intronic
1065218437 10:23472871-23472893 TGACTGCAACCTCTGCCTTCTGG + Intergenic
1065595499 10:27306692-27306714 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1065632484 10:27694618-27694640 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1065690619 10:28329552-28329574 TCTCTGCAAGCTCTGCCTCCTGG - Intronic
1065985063 10:30942151-30942173 TGTGGGAAGGCTCTGCCTTATGG + Intronic
1066349050 10:34619825-34619847 TGTTTGAGAGCTCTGACTTCAGG + Intronic
1066381338 10:34904693-34904715 AGTGTGCAACCTCTGCCTCCTGG - Intergenic
1066531705 10:36347638-36347660 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1066532610 10:36356843-36356865 TCCCTGCAAGCTCTGCCTTCTGG - Intergenic
1066652173 10:37666603-37666625 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1066977301 10:42380804-42380826 TTACTGCAAGCTCTGCCTTCTGG - Intergenic
1067114978 10:43428504-43428526 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1067446341 10:46350014-46350036 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1067547551 10:47205207-47205229 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1067880181 10:50036184-50036206 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1068104517 10:52597061-52597083 TCACTGAAAGCTCTGCCTTCTGG - Intergenic
1068174834 10:53444997-53445019 TCACTGTAAGCTCCGCCTTCCGG + Intergenic
1068225273 10:54100288-54100310 TGACTGTAACCTCTGCCTCCCGG - Intronic
1068430819 10:56930339-56930361 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1068730880 10:60356781-60356803 TCAGTGTAACCTCTGCCTCCTGG + Intronic
1068766139 10:60765779-60765801 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1068920912 10:62482883-62482905 TGGGTGTAAACTCTGGTTTCTGG + Intronic
1068974510 10:62994167-62994189 TGTGTGCAACCTCTGCTTTCAGG + Intergenic
1068990428 10:63144487-63144509 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1069189514 10:65468703-65468725 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1069194963 10:65539519-65539541 TGACTGCAACCTCTGCCTTCTGG - Intergenic
1069214670 10:65804404-65804426 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1069220861 10:65881599-65881621 TCAGGGTAACCTCTGCCTTCCGG + Intergenic
1069230737 10:66006085-66006107 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
1069279268 10:66633603-66633625 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1069442390 10:68440370-68440392 TGACTGTAAGCTCTGCCTCCCGG + Intronic
1069810063 10:71152317-71152339 AGTCTGCAAGCTCTACCTTCTGG - Intergenic
1070003963 10:72404062-72404084 TCAGTGTAACCTCTGCCTCCTGG + Intronic
1070099945 10:73375723-73375745 TTACTGAAAGCTCTGCCTTCCGG - Exonic
1070118357 10:73551028-73551050 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1070134760 10:73683276-73683298 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1070232230 10:74580498-74580520 TCACTGTAACCTCTGCCTTCTGG - Intronic
1070259567 10:74841488-74841510 TCACTGTAATCTCTGCCTTCTGG - Intronic
1070786652 10:79165995-79166017 TGTGTGTGGGCTCTCCCTGCAGG + Intronic
1071044914 10:81361882-81361904 TCAGTGCAACCTCTGCCTTCCGG + Intergenic
1071133833 10:82430330-82430352 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1071753655 10:88510770-88510792 TCACTGTAACCTCTGCCTTCTGG - Intronic
1071815755 10:89231347-89231369 TGTATGTGAGCAGTGCCTTCCGG - Intronic
1071831138 10:89373258-89373280 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1072127666 10:92461737-92461759 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1072206246 10:93207565-93207587 TGACTGCAACCTCTGCCTTCCGG - Intergenic
1072210181 10:93239269-93239291 TGTCTGCAAACACTGCCTTCTGG - Intergenic
1072288041 10:93935541-93935563 TGACTGTAACCTCTGCCTCCTGG - Intronic
1072292267 10:93975087-93975109 TCAGTGCAAGCTCTGCCTCCTGG + Intergenic
1072332106 10:94363993-94364015 TCATTGCAAGCTCTGCCTTCTGG + Intergenic
1072350431 10:94551812-94551834 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1072647826 10:97272913-97272935 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1072698699 10:97623808-97623830 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1072714728 10:97743160-97743182 TGAGGGTAAGAACTGCCTTCAGG + Exonic
1073033084 10:100543645-100543667 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1073070676 10:100791266-100791288 GGTGTAAAAGCTCTGCCTGCAGG - Intronic
1073074333 10:100814275-100814297 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1073161260 10:101398375-101398397 TCGCTGCAAGCTCTGCCTTCCGG + Intronic
1073368814 10:102968319-102968341 TGACTGTAACCTCTGCCTCCTGG + Intronic
1073476666 10:103758117-103758139 TGTTTGTGAGCTGTGCCATCTGG - Intronic
1073820845 10:107262576-107262598 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1073849608 10:107599485-107599507 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1073938237 10:108660988-108661010 GGAGTGCAAGCTCTGCCTTCTGG - Intergenic
1073966700 10:108998475-108998497 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1074089254 10:110232033-110232055 TCGCTGCAAGCTCTGCCTTCTGG + Intronic
1074265767 10:111901561-111901583 TCACTGCAAGCTCTGCCTTCAGG - Intergenic
1074380775 10:112978538-112978560 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
1074537522 10:114339370-114339392 TCACTGTAAGCTCCGCCTTCCGG - Intronic
1074756087 10:116625194-116625216 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1074802586 10:117016479-117016501 TGTCTGCAACCTCTGCCTCCTGG + Intronic
1075292489 10:121242348-121242370 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1075751995 10:124779986-124780008 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1075788412 10:125066024-125066046 TCACTGTAACCTCTGCCTTCTGG - Intronic
1075944624 10:126421753-126421775 TGTGTGAGAGCTCTGGGTTCAGG - Intergenic
1076165505 10:128279170-128279192 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1076396701 10:130143770-130143792 TCACTGTAACCTCTGCCTTCTGG + Intronic
1076954442 10:133688313-133688335 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1076954485 10:133688722-133688744 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1077291044 11:1793683-1793705 TCATTGCAAGCTCTGCCTTCTGG + Intergenic
1077564256 11:3286519-3286541 TGACTGTAAGCTCTGCCTCCCGG + Intergenic
1077570146 11:3332336-3332358 TGACTGTAAGCTCTGCCTCCCGG + Intergenic
1077637108 11:3850664-3850686 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
1077903721 11:6512293-6512315 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1078216633 11:9317279-9317301 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1078303624 11:10159813-10159835 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1079170234 11:18086624-18086646 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1079801056 11:24869529-24869551 TCATTGTAACCTCTGCCTTCGGG + Intronic
1079850839 11:25532338-25532360 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1079907510 11:26267015-26267037 TGACTGCAAGCTCTGCCTCCAGG - Intergenic
1080182319 11:29440122-29440144 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1080362528 11:31532844-31532866 TCATTGTAACCTCTGCCTTCCGG + Intronic
1080469508 11:32531096-32531118 TCAGTGTAAGCTCCGCCTCCCGG - Intergenic
1080478675 11:32623081-32623103 TCATTGTAACCTCTGCCTTCCGG + Intronic
1080788109 11:35494406-35494428 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1081189876 11:40090648-40090670 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1081238432 11:40675031-40675053 TTTGTGTATGCTCTGACTTTTGG - Intronic
1081240351 11:40697991-40698013 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1081277397 11:41166636-41166658 TGTGTGTCATATCTGCCCTCAGG - Intronic
1081314127 11:41611027-41611049 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1081437836 11:43046768-43046790 TGGCTGCAAGCTCTGCCTCCCGG - Intergenic
1081651390 11:44826347-44826369 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1081849872 11:46267714-46267736 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1082129589 11:48471800-48471822 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1082170635 11:49000969-49000991 TGTTTTTAGTCTCTGCCTTCTGG - Intergenic
1082815911 11:57509039-57509061 TCAGTGCAACCTCTGCCTTCTGG - Intronic
1082880957 11:58037791-58037813 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1082975568 11:59067903-59067925 TTACTGAAAGCTCTGCCTTCTGG + Intergenic
1083444401 11:62697980-62698002 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1083487927 11:62995359-62995381 TCTGGGTCAGCTCTGCCCTCTGG - Intronic
1083499459 11:63090004-63090026 TCTCTGCAAGCTCTGCCTCCTGG - Intronic
1083808932 11:65091639-65091661 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1083871919 11:65493679-65493701 TTACTGTAACCTCTGCCTTCCGG - Intergenic
1083971068 11:66075810-66075832 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1084079525 11:66812249-66812271 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1084082422 11:66837199-66837221 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1084417017 11:69038343-69038365 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1084896320 11:72272836-72272858 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1084969130 11:72760299-72760321 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1085361041 11:75887520-75887542 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1085473944 11:76777256-76777278 TGTCTGGTAGCTCTGCCATCAGG + Intergenic
1085510810 11:77087173-77087195 TGTGTGTAGGCACTGCCTACTGG + Intronic
1086046797 11:82542296-82542318 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1086090602 11:83000970-83000992 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1086593220 11:88540819-88540841 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1086664424 11:89461568-89461590 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1086781402 11:90910622-90910644 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1087210551 11:95442695-95442717 TGGGTGTAAGCTTTTCCTCCAGG + Intergenic
1087266825 11:96070213-96070235 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1087273040 11:96131257-96131279 TGTTTTTAAGCTCTGTTTTCAGG - Intronic
1087458327 11:98415743-98415765 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1087644539 11:100792825-100792847 TTACTGCAAGCTCTGCCTTCCGG + Intronic
1087697397 11:101395445-101395467 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1087777131 11:102266864-102266886 TTACTGTAAGCTCTGCCTTCCGG - Intergenic
1088422021 11:109658924-109658946 TCACTGTAAGCTCTGCCTTTCGG + Intergenic
1088710679 11:112505758-112505780 TCAGTGCAAGCTCTGCCTCCTGG + Intergenic
1088790395 11:113220679-113220701 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1088872424 11:113902369-113902391 TCAGTGCAACCTCTGCCTTCTGG + Intergenic
1089374151 11:117982677-117982699 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1089405285 11:118192565-118192587 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1089500064 11:118926665-118926687 TCACTGTAACCTCTGCCTTCTGG + Intronic
1089569618 11:119395958-119395980 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1089983567 11:122792391-122792413 TCACTGTAACCTCTGCCTTCTGG + Intronic
1090101490 11:123801947-123801969 AGTGAGGAAGCTCTGCCCTCAGG + Intergenic
1090678126 11:129024137-129024159 TGTGGGAGAGCTCTGCCTCCAGG + Intronic
1090755567 11:129787305-129787327 TCTGTGTAAGCAGTGCCTTTTGG + Intergenic
1090859611 11:130641188-130641210 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1090886337 11:130880302-130880324 TCTGGGGAAGCTCTGCCTGCAGG - Intronic
1091133879 11:133170409-133170431 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1091378378 12:41164-41186 TGTCTCTTGGCTCTGCCTTCTGG - Intergenic
1091417967 12:306666-306688 TCAGTGCAACCTCTGCCTTCTGG - Intronic
1091531793 12:1364404-1364426 TTTGTGTACCCTCTGCCTGCTGG + Intronic
1091595709 12:1877785-1877807 TATCTGAAAGCTCTGCCTCCAGG - Intronic
1091876150 12:3934600-3934622 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1091881420 12:3981449-3981471 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1091883882 12:4002239-4002261 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1091968378 12:4764616-4764638 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1092221242 12:6715474-6715496 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1092222605 12:6725229-6725251 TGAGTGCAAGCTCTGCCTCCTGG + Intronic
1092340550 12:7672271-7672293 TCACTGTAACCTCTGCCTTCCGG - Intergenic
1092482231 12:8870340-8870362 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1092773414 12:11919031-11919053 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1092907948 12:13119018-13119040 TCACTGTAACCTCTGCCTTCCGG - Intronic
1093364451 12:18275454-18275476 TCAGTGCAACCTCTGCCTTCTGG + Intronic
1093433671 12:19111225-19111247 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1093765745 12:22959978-22960000 TTACTGTAACCTCTGCCTTCTGG + Intergenic
1093809479 12:23474204-23474226 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1093891377 12:24525778-24525800 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1094083490 12:26563493-26563515 GGTGTGCAACCTCTGCCTACTGG - Intronic
1094318573 12:29159461-29159483 TCATTGTAAGCTCTGCCTCCTGG - Intronic
1094596419 12:31870742-31870764 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1094597212 12:31876119-31876141 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1094675838 12:32619555-32619577 TCATTGTAAGCTCTGCCTCCCGG - Intronic
1095062311 12:37712843-37712865 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1095200790 12:39381231-39381253 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1095276245 12:40286279-40286301 TGTGTGTGAGCTCATCCTACCGG + Intronic
1095897105 12:47290755-47290777 TCACTGCAAGCTCTGCCTTCGGG + Intergenic
1096131952 12:49166413-49166435 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1096172590 12:49485138-49485160 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1096297213 12:50393772-50393794 TGTATGCAACCTCTGCCTCCGGG - Intronic
1096301798 12:50434971-50434993 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1096304313 12:50460866-50460888 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1096314907 12:50556122-50556144 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1096702680 12:53396204-53396226 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1096715917 12:53491506-53491528 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1097092138 12:56515035-56515057 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1097204751 12:57311298-57311320 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1097229306 12:57499527-57499549 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1097362632 12:58674768-58674790 TCACTGTAAGCTCTGCCTCCAGG + Intronic
1097861120 12:64519593-64519615 TGTATGTAAACTCTACCTTAAGG + Intergenic
1097878803 12:64668754-64668776 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1097977099 12:65698177-65698199 TCACTGAAAGCTCTGCCTTCTGG - Intergenic
1098247300 12:68533737-68533759 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1098405119 12:70116808-70116830 TGTCTGCAACCTCTGCCTCCCGG - Intergenic
1098560195 12:71864580-71864602 TGACTGTAATCTCTGCCTCCTGG + Intronic
1098573549 12:72015392-72015414 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1098682938 12:73381043-73381065 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
1098782008 12:74699545-74699567 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1098799925 12:74942844-74942866 TCAGTGCAACCTCTGCCTTCAGG - Intergenic
1099524053 12:83697123-83697145 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1099670276 12:85682568-85682590 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1099697705 12:86042791-86042813 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1099981291 12:89606646-89606668 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1100127614 12:91447920-91447942 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1100229432 12:92592485-92592507 TGTGTGTTAGCCTTGCCTTTGGG + Intergenic
1100256542 12:92888500-92888522 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1100417719 12:94395744-94395766 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1100521271 12:95378476-95378498 GGAGTGCAAGCTCTGCCTCCCGG + Intronic
1100526351 12:95423274-95423296 TCACTGCAAGCTCTGCCTTCGGG - Intergenic
1100769134 12:97901982-97902004 TCCCTGTAAGCTCTGCCTCCTGG + Intergenic
1100806849 12:98294417-98294439 TGTGTTTAAGCCCTGTTTTCAGG - Intergenic
1100860265 12:98798195-98798217 TCACTGCAAGCTCTGCCTTCAGG + Intronic
1100955824 12:99906994-99907016 TGTGTGTAAGCTCTGCCTTCAGG - Intronic
1101032898 12:100677552-100677574 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1101154495 12:101915052-101915074 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1101268620 12:103118721-103118743 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1101321702 12:103678599-103678621 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1101386092 12:104259304-104259326 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1101494981 12:105245450-105245472 TGTGACTAAGCTCTGGCTTATGG - Intronic
1102114275 12:110389855-110389877 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1102138369 12:110594124-110594146 TCTCTGCAAGCTCTGCCTCCCGG + Intergenic
1102230949 12:111261828-111261850 TCACTGTAACCTCTGCCTTCTGG - Intronic
1102670619 12:114615771-114615793 TCACTGAAAGCTCTGCCTTCCGG - Intergenic
1102717632 12:114987925-114987947 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1102871096 12:116414387-116414409 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1102939158 12:116923596-116923618 TCACTGTAAGCTCTGCCTGCCGG + Intronic
1102966357 12:117130703-117130725 GGTGTGTCTGCCCTGCCTTCAGG - Intergenic
1103208642 12:119150395-119150417 TGACTGCAACCTCTGCCTTCAGG - Intronic
1103279546 12:119744638-119744660 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1103312365 12:120021207-120021229 TCACTGTAACCTCTGCCTTCTGG - Intronic
1103434272 12:120912880-120912902 TCTCTGTAACCTCTGCCTGCTGG + Intergenic
1103720692 12:122973784-122973806 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1103804958 12:123565210-123565232 TCTCTGCAAGCTCTGCCTCCCGG + Intergenic
1104252339 12:127107473-127107495 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1104421379 12:128638583-128638605 GGTATATTAGCTCTGCCTTCAGG - Intronic
1105033660 12:132902903-132902925 TGACTGCAACCTCTGCCTTCTGG + Intronic
1105061968 12:133161049-133161071 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1105344857 13:19562152-19562174 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1105385156 13:19922767-19922789 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1105582410 13:21711601-21711623 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1105582481 13:21712117-21712139 TCATTGCAAGCTCTGCCTTCTGG - Intergenic
1105888014 13:24659038-24659060 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1105955548 13:25278808-25278830 TCTGTGCAACCTCTGCCTCCAGG - Intronic
1106220976 13:27746103-27746125 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1106426217 13:29632979-29633001 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1106548120 13:30747992-30748014 TGACTGCAACCTCTGCCTTCCGG + Intronic
1106599530 13:31175739-31175761 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1106739176 13:32620580-32620602 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1107077567 13:36339554-36339576 TCAGTGCAACCTCTGCCTTCCGG - Intronic
1107499336 13:40957052-40957074 TTTGTGTAAGGTCTGGCTGCTGG + Intronic
1107526235 13:41234437-41234459 TGTCTGTAATCTCAGCATTCAGG - Intronic
1107647048 13:42505294-42505316 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1107868329 13:44725389-44725411 TGACTGTAAGCTCCGCCTCCCGG + Intergenic
1108007534 13:45965496-45965518 TGTGTGTACCCTCTACCTTTTGG - Intronic
1108384798 13:49889379-49889401 TCAGTGTAACCTCTGCCTCCTGG + Intergenic
1108552415 13:51559669-51559691 TTTGTGCAACCTCTGCCTCCTGG - Intergenic
1108663293 13:52605512-52605534 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1108667338 13:52645663-52645685 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1108813590 13:54262766-54262788 TGTTTGTAAAATCTGGCTTCAGG - Intergenic
1109007953 13:56902316-56902338 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1109208551 13:59508692-59508714 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1109318271 13:60777948-60777970 TGTGTGTCTTCTCTGACTTCTGG + Intergenic
1109649617 13:65309435-65309457 TGTGCACATGCTCTGCCTTCAGG + Intergenic
1109671587 13:65615178-65615200 TGGTTGTAAACTCTGCCATCTGG - Intergenic
1110354068 13:74545740-74545762 TCTCTGCAAGCTCAGCCTTCCGG - Intergenic
1110431800 13:75432865-75432887 TTACTGCAAGCTCTGCCTTCCGG - Intronic
1110436760 13:75484366-75484388 TGTGTGTTGGCTCAGCCTTTGGG - Intergenic
1110510493 13:76344354-76344376 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1110645717 13:77881301-77881323 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1110904648 13:80871360-80871382 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1111282862 13:86050061-86050083 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1111310087 13:86472771-86472793 TCACTGTAAGCTCCGCCTTCCGG - Intergenic
1111651081 13:91091675-91091697 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1111790759 13:92851811-92851833 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1112020407 13:95366528-95366550 TGGCTGCAACCTCTGCCTTCCGG + Intergenic
1112267780 13:97941308-97941330 TCGCTGCAAGCTCTGCCTTCCGG + Intergenic
1112295148 13:98179780-98179802 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1112296398 13:98191035-98191057 TGCGTGTCAGCTCTGCTTTTAGG - Intronic
1112314131 13:98346262-98346284 TGACTGCAACCTCTGCCTTCTGG + Intronic
1112395010 13:99021562-99021584 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1112527669 13:100167839-100167861 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1112735907 13:102416690-102416712 TCACTGTAAGCTCTGCCTACTGG - Intergenic
1112879767 13:104092735-104092757 TCACTGCAAGCTCTGCCTTCAGG + Intergenic
1113017425 13:105843544-105843566 TGAGTGTAAGCATTGCTTTCAGG - Intergenic
1113417967 13:110145299-110145321 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1113633369 13:111903253-111903275 TGTGAGTCAGCTCTGCTTTCTGG - Intergenic
1113633376 13:111903320-111903342 TGTGAGTCAGCTCTGCTTTCTGG - Intergenic
1113633383 13:111903387-111903409 TGTGAGTCAGCTCTGCTTTCTGG - Intergenic
1113721909 13:112563798-112563820 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1114296701 14:21335754-21335776 GGAGTGCAAGCTCTGCCTCCTGG - Intronic
1115042621 14:28949433-28949455 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1115548446 14:34483985-34484007 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1115798075 14:36961284-36961306 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1115847163 14:37551802-37551824 TCACTGCAAGCTCTGCCTTCCGG - Exonic
1116192820 14:41681891-41681913 TCTCTGTAACCTCTGCCTCCCGG + Intronic
1116267178 14:42707902-42707924 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1116836481 14:49773337-49773359 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1116852298 14:49920701-49920723 TCATTGCAAGCTCTGCCTTCCGG + Intergenic
1117137526 14:52752083-52752105 TCACTGTAACCTCTGCCTTCTGG - Intronic
1117392534 14:55275747-55275769 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1117692624 14:58323977-58323999 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1117711252 14:58531250-58531272 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1117730173 14:58714453-58714475 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1117770378 14:59128203-59128225 TCACTGCAAGCTCTGCCTTCGGG + Intergenic
1118180615 14:63488772-63488794 TCTCTGTAACCTCTGCCTCCTGG - Intronic
1118242250 14:64071417-64071439 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1118267113 14:64305214-64305236 TCAGTGCAAGCTCTGCCTCCTGG - Intronic
1118371213 14:65138760-65138782 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1118406271 14:65426931-65426953 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1118800099 14:69182115-69182137 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1118927547 14:70206650-70206672 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1118953040 14:70452438-70452460 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1119305313 14:73603427-73603449 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1119338941 14:73858476-73858498 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1119447302 14:74676869-74676891 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1119661837 14:76457745-76457767 TCTCTGCAACCTCTGCCTTCTGG + Intronic
1120091376 14:80336193-80336215 TCACTGTAACCTCTGCCTTCTGG - Intronic
1120120042 14:80667781-80667803 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1120142557 14:80944745-80944767 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1120246760 14:82015637-82015659 TGGTTCTAAGCTCTGCCCTCTGG + Intergenic
1120318515 14:82928774-82928796 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1120709926 14:87782463-87782485 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG + Intronic
1121224156 14:92308949-92308971 TGAGTGTGGGCCCTGCCTTCTGG - Intergenic
1121352704 14:93185941-93185963 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
1121575966 14:94988166-94988188 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1121621468 14:95352441-95352463 TCAGTGTAACCTCTGCCTTCTGG + Intergenic
1121745507 14:96287177-96287199 TCTCTGCAAGCTCTGCCTCCTGG - Intronic
1122020600 14:98834741-98834763 TGTGGGCAACCCCTGCCTTCTGG + Intergenic
1122605677 14:102946081-102946103 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1122644198 14:103181085-103181107 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1122732016 14:103807567-103807589 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1123137342 14:106040324-106040346 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1202850479 14_GL000225v1_random:14385-14407 CTTGTGTAGGCTCTGCCTACAGG - Intergenic
1202851009 14_GL000225v1_random:19370-19392 CTTGTGTAGGCTCTGCCTGCAGG - Intergenic
1202851177 14_GL000225v1_random:20941-20963 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1202851258 14_GL000225v1_random:21687-21709 CTTGTGTAGGCTCTGCCTACAGG - Intergenic
1202851833 14_GL000225v1_random:25472-25494 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202851992 14_GL000225v1_random:26974-26996 CTTGTCTAAGCTCTGCCTTGAGG + Intergenic
1202852165 14_GL000225v1_random:28507-28529 TTTGTGTAGGCTCTGCCTATGGG + Intergenic
1202853012 14_GL000225v1_random:32848-32870 CTTGTCTAGGCTCTGCCTTCAGG - Intergenic
1202853108 14_GL000225v1_random:33804-33826 GTTGTATAAGCTCTGCCTACGGG - Intergenic
1202853213 14_GL000225v1_random:34756-34778 CTTGTGTAGGCTCTGCCTACAGG - Intergenic
1202854153 14_GL000225v1_random:39697-39719 TTTATCTAGGCTCTGCCTTCCGG - Intergenic
1202854258 14_GL000225v1_random:40652-40674 TTTGTCTAAGCTCTGCCTACAGG - Intergenic
1202854421 14_GL000225v1_random:41946-41968 TTTGTCTAGGCTCTGCCTACTGG - Intergenic
1202855145 14_GL000225v1_random:45317-45339 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1202855631 14_GL000225v1_random:49864-49886 TTTGTCTAGGCTCTGCCTACAGG - Intergenic
1202856617 14_GL000225v1_random:55341-55363 CTTGTCTAAGCTCTGCCTACTGG - Intergenic
1202856735 14_GL000225v1_random:56429-56451 TTTGTGTAGGCTCTGCTTACAGG - Intergenic
1202857795 14_GL000225v1_random:62401-62423 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1202859102 14_GL000225v1_random:70691-70713 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1202861056 14_GL000225v1_random:81304-81326 GTTGTGTAGGCTCTGCCTACAGG + Intergenic
1202861421 14_GL000225v1_random:84845-84867 TTTGTCTAGGCTCTGCCTACTGG + Intergenic
1202861664 14_GL000225v1_random:86955-86977 TTTGTCTAGGCTCTGCCTACTGG + Intergenic
1202861777 14_GL000225v1_random:87980-88002 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1202862615 14_GL000225v1_random:92166-92188 CTTGTGTAGGCTCTGCCTACAGG + Intergenic
1202863716 14_GL000225v1_random:101817-101839 CTTGTGTAGGCTCTGCATTCAGG + Intergenic
1202864464 14_GL000225v1_random:106036-106058 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1202864955 14_GL000225v1_random:110605-110627 GTTGTATAAGCTCTGCCTACCGG - Intergenic
1202865950 14_GL000225v1_random:117319-117341 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202866541 14_GL000225v1_random:122928-122950 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202866736 14_GL000225v1_random:124841-124863 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202866996 14_GL000225v1_random:127259-127281 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202867072 14_GL000225v1_random:127936-127958 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1202867380 14_GL000225v1_random:130661-130683 TTTGTATAAGCTCTGCCTACAGG + Intergenic
1202868831 14_GL000225v1_random:140763-140785 TTTGTCTAGGCTCTGCCTACAGG + Intergenic
1202868985 14_GL000225v1_random:142058-142080 TTTGTCTAGGCTCTGCCTACAGG + Intergenic
1123485693 15:20735823-20735845 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1123542178 15:21304870-21304892 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1123794111 15:23754513-23754535 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1124370522 15:29102377-29102399 TGTGAGTAAGATCAGCCTCCAGG - Intronic
1124585120 15:30998012-30998034 TGGCTGCAAGCTCCGCCTTCCGG - Intergenic
1124778858 15:32610643-32610665 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1125068079 15:35515644-35515666 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1125219409 15:37316173-37316195 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1125667371 15:41442240-41442262 TCGCTGTAAGCTCTGCCTCCCGG + Intronic
1125710774 15:41783932-41783954 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1125711040 15:41786688-41786710 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1125712140 15:41795679-41795701 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1125801914 15:42456575-42456597 TCACTGTAACCTCTGCCTTCTGG - Intronic
1125947474 15:43721537-43721559 TCAGTGCAACCTCTGCCTTCCGG - Intergenic
1125974396 15:43938154-43938176 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1126338776 15:47616684-47616706 TGTGTGTACTTTCTGCCTACTGG + Intronic
1126583041 15:50258517-50258539 TCTGTGCATGCTCTGCCTCCAGG - Exonic
1126597991 15:50400832-50400854 AGTGTATAAGCTCCGCCTCCTGG - Intergenic
1126628447 15:50708960-50708982 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1126654835 15:50965990-50966012 TGACTGTAACCTCTGCCTCCCGG + Intronic
1127029544 15:54846840-54846862 TCAGTGCAACCTCTGCCTTCCGG + Intergenic
1127086778 15:55431547-55431569 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1127121493 15:55775973-55775995 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1127124697 15:55800803-55800825 TCGGTGCAAGCTCTGCCTCCCGG + Intergenic
1127423080 15:58827536-58827558 TCACTGTAAGCTCCGCCTTCCGG + Intronic
1128097681 15:64970812-64970834 TGGGTGCAACCTCTGCCTCCCGG + Intronic
1128119533 15:65135216-65135238 TCATTGTAAGCTCTGCCTCCTGG + Intergenic
1128378732 15:67095605-67095627 TCTCTGTAACCTCTGCCTGCGGG + Intronic
1128504789 15:68260377-68260399 TTACTGCAAGCTCTGCCTTCTGG + Intergenic
1128507167 15:68281690-68281712 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1128572670 15:68746661-68746683 TCCCTGCAAGCTCTGCCTTCTGG + Intergenic
1128627877 15:69230131-69230153 TCACTGTAACCTCTGCCTTCTGG - Intronic
1128664329 15:69527288-69527310 TGACTGCAACCTCTGCCTTCTGG + Intergenic
1128808153 15:70549298-70549320 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1129173911 15:73825776-73825798 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1129508713 15:76104130-76104152 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1129981577 15:79876538-79876560 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1129985197 15:79912723-79912745 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1130175494 15:81565024-81565046 TGTAAGTAAGCTCCGCCTCCCGG + Intergenic
1130294305 15:82633445-82633467 TCTCTGTAACCTCTGCCTCCCGG + Intronic
1130581407 15:85140212-85140234 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1130637871 15:85642507-85642529 TGTGGATTAGCTCTGCCTTTAGG + Intronic
1130642882 15:85695708-85695730 TGTGTGTGATCTCTGCCCACAGG - Intronic
1131084299 15:89563084-89563106 TCTCTGCAACCTCTGCCTTCCGG - Intergenic
1131085382 15:89571833-89571855 TGTGTGTTAGCTCTTCCCTTTGG + Intergenic
1131110964 15:89765181-89765203 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
1131190814 15:90315137-90315159 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1131201244 15:90397956-90397978 TCACTGTAACCTCTGCCTTCTGG + Intronic
1131213334 15:90516730-90516752 TCACTGTAAGCTCCGCCTTCCGG + Intergenic
1131292805 15:91121847-91121869 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1131475848 15:92738675-92738697 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1131538869 15:93259696-93259718 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1131638620 15:94264532-94264554 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1132020511 15:98357547-98357569 TTACTGCAAGCTCTGCCTTCCGG - Intergenic
1132448543 15:101951830-101951852 TGTCTCTTGGCTCTGCCTTCTGG + Intergenic
1202950496 15_KI270727v1_random:32010-32032 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1132539096 16:499721-499743 TCACTGTAACCTCTGCCTTCTGG - Intronic
1132597226 16:758643-758665 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1132899814 16:2247169-2247191 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1133009318 16:2901695-2901717 TGCCTGTAATCCCTGCCTTCGGG + Intergenic
1133032687 16:3018965-3018987 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1133057960 16:3156721-3156743 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1133080496 16:3315264-3315286 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1133181180 16:4055757-4055779 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1133302212 16:4789398-4789420 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1133335015 16:5001331-5001353 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1133457039 16:5951371-5951393 TCTGTGCAACCTCTGCCTCCCGG - Intergenic
1133538406 16:6724282-6724304 TGACTGTAACCTCTGCCTCCTGG + Intronic
1133544119 16:6788548-6788570 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1133603302 16:7361054-7361076 TGTTTGTAAACTCTGCCTGCTGG + Intronic
1133785629 16:8971002-8971024 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1133798685 16:9067237-9067259 TCACTGTAAGCTCTGCCTTCTGG - Intergenic
1133947924 16:10364808-10364830 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1133968672 16:10550898-10550920 TCAGTGCAACCTCTGCCTTCTGG - Intronic
1134646539 16:15872237-15872259 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1134663114 16:15999073-15999095 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1134926553 16:18168040-18168062 TCACTGTAACCTCTGCCTTCCGG + Intergenic
1135297740 16:21297316-21297338 TCTCTGTAACCTCTGCCTCCCGG - Intronic
1135663645 16:24317465-24317487 TCTCTGCAACCTCTGCCTTCTGG - Intronic
1135702457 16:24644159-24644181 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1135717347 16:24782795-24782817 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1135928751 16:26718469-26718491 TCTGTGCAACCTCTGCCTCCCGG + Intergenic
1137289097 16:47039464-47039486 TTAGTGCAACCTCTGCCTTCTGG - Intergenic
1137955755 16:52827322-52827344 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1137981951 16:53077396-53077418 TCACTGAAAGCTCTGCCTTCTGG + Intronic
1138116374 16:54363964-54363986 TGTGTGTGAGGTCTGACTTGTGG + Intergenic
1138409265 16:56825284-56825306 TCTGTGCAACCTCTGCCTCCCGG + Intronic
1138468808 16:57214951-57214973 TAACTGTAATCTCTGCCTTCTGG - Intronic
1138569463 16:57859945-57859967 TCTCTGTAACCTCTGCCTCCTGG - Intronic
1138632483 16:58309597-58309619 TTACTGTAAGCTCTGCCTCCTGG + Intronic
1138684269 16:58710891-58710913 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1138706207 16:58918414-58918436 TCTCTGTAAGCTCCGCCTCCTGG + Intergenic
1139010154 16:62622169-62622191 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1139522968 16:67495699-67495721 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1139563778 16:67760023-67760045 TCAGTGCAAGCTCTGCCTCCTGG - Intronic
1139585142 16:67897920-67897942 TCATTGCAAGCTCTGCCTTCCGG + Intronic
1139719034 16:68837942-68837964 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1139771523 16:69280870-69280892 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1139858328 16:69999426-69999448 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1139892338 16:70261521-70261543 TCACTGTAACCTCTGCCTTCCGG - Intronic
1139898924 16:70311303-70311325 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1139929712 16:70516369-70516391 TCACTGTAAGCTCTGCCTTCTGG + Intronic
1140284277 16:73586312-73586334 TTTCTGTAACCTCTGCCTCCTGG - Intergenic
1140445592 16:75025140-75025162 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1140466101 16:75184100-75184122 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1140528413 16:75643450-75643472 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1140660538 16:77187914-77187936 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
1141090093 16:81124231-81124253 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1141340767 16:83201838-83201860 TCACTGGAAGCTCTGCCTTCCGG - Intronic
1141516062 16:84545858-84545880 TCACTGTAACCTCTGCCTTCTGG - Intronic
1141680887 16:85543135-85543157 TCACTGTAAGCTCTGCCTTCTGG - Intergenic
1142392197 16:89808978-89809000 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1203139359 16_KI270728v1_random:1750201-1750223 TCAGTGTAAACTCTGCCTCCCGG + Intergenic
1142861632 17:2765666-2765688 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1142918221 17:3161374-3161396 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1142971131 17:3612349-3612371 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1142972177 17:3620333-3620355 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1143219699 17:5251238-5251260 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1143318238 17:6049102-6049124 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1143814971 17:9505678-9505700 TGTGTGTAATCCCAGCCCTCTGG + Intronic
1143888659 17:10085615-10085637 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1144042476 17:11424930-11424952 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1144109119 17:12014971-12014993 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1144126442 17:12207196-12207218 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1144414292 17:15031796-15031818 TGTGTGTCAACTCTGTCCTCTGG - Intergenic
1144432505 17:15207330-15207352 TGTCTGCAAGCTCTGCCTCCCGG + Intergenic
1144473775 17:15566633-15566655 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1144710267 17:17396961-17396983 TTTGTCTCAGCTCTGCTTTCAGG + Intergenic
1144860044 17:18295839-18295861 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1144922749 17:18778176-18778198 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1144968456 17:19092369-19092391 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1144979461 17:19159694-19159716 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1144988761 17:19218538-19218560 TCTCTGCAAGCTCTGCCTCCTGG - Intronic
1145259395 17:21345722-21345744 TGTCTGCAACCTCTGCCTCCTGG + Intergenic
1145822090 17:27846590-27846612 TGACTGTAAGCTCCGCCTCCCGG + Intronic
1146029276 17:29350885-29350907 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1146099406 17:29964974-29964996 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1146264575 17:31443838-31443860 TGGCTGCAACCTCTGCCTTCTGG - Intronic
1146428131 17:32763109-32763131 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1146452591 17:32986626-32986648 TCTCTGTAACCTCTGCCTCCCGG + Intronic
1146565913 17:33912607-33912629 TGTGTGAAACCTCTGACTTAAGG + Intronic
1146699600 17:34944849-34944871 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1146835785 17:36109413-36109435 TGTCTGTAACTTCTGCCTCCGGG - Intergenic
1146962170 17:36991658-36991680 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1146999247 17:37348872-37348894 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1147220113 17:38923571-38923593 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1147392462 17:40118833-40118855 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1147714834 17:42498749-42498771 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1147809202 17:43155242-43155264 TCTCTGTAACCTCTGCCTCCTGG + Intergenic
1147875501 17:43617870-43617892 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1147908150 17:43836529-43836551 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1147998318 17:44373717-44373739 AGGGTGTAAGTCCTGCCTTCAGG - Intronic
1148168786 17:45502410-45502432 TGACTGCAACCTCTGCCTTCCGG - Intergenic
1148367245 17:47064728-47064750 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1148419605 17:47534164-47534186 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1148715100 17:49710436-49710458 TTTGTGTAAGCTCTGCAGTACGG + Exonic
1148801108 17:50226468-50226490 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1148802729 17:50242279-50242301 TATTTGCAAACTCTGCCTTCCGG + Intergenic
1148886943 17:50780816-50780838 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1149103975 17:52939682-52939704 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1149280959 17:55105540-55105562 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1149368252 17:55967191-55967213 TCATTGCAAGCTCTGCCTTCCGG + Intergenic
1149606728 17:57930366-57930388 TGTTTGTAAGGGCTACCTTCTGG - Intronic
1149744429 17:59081830-59081852 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1149757197 17:59197324-59197346 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1149882429 17:60306561-60306583 TCATTGTAACCTCTGCCTTCCGG - Intronic
1149972416 17:61232128-61232150 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1150055184 17:62007942-62007964 TCACTGGAAGCTCTGCCTTCCGG - Intronic
1150071980 17:62158922-62158944 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1150121540 17:62607452-62607474 TCAGTGAAAGCTCTGCCTCCCGG - Intronic
1150378364 17:64700959-64700981 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1150591175 17:66564151-66564173 TCTGTGCAGGCTCTGCCTCCCGG + Intronic
1150722377 17:67624596-67624618 TCAGTGCAACCTCTGCCTTCTGG + Intronic
1150995215 17:70309520-70309542 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1151189016 17:72384373-72384395 TGTCTGCAAGCTCCGCCTCCCGG + Intergenic
1151256485 17:72880754-72880776 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1151389169 17:73774246-73774268 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1151448357 17:74181894-74181916 TGCCTGAAAGCTCTGCCTTCCGG + Intergenic
1151615826 17:75210774-75210796 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1151627280 17:75284901-75284923 TGTGTGTAATCTCAGCCCTTTGG - Intronic
1151820992 17:76496834-76496856 TCACTGTAAGCTCTGCCTTCTGG + Intronic
1152106418 17:78331934-78331956 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1152208352 17:78989054-78989076 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1152647975 17:81478886-81478908 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1152725982 17:81946278-81946300 TGACTGCAACCTCTGCCTTCCGG - Intronic
1152753557 17:82077634-82077656 TGTGGGCATGCTGTGCCTTCCGG + Intergenic
1152833338 17:82512652-82512674 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1152835427 17:82527213-82527235 TGTATTTAAGCTCCGCCTCCTGG + Intronic
1152965193 18:108103-108125 CTTGTGTAGGCTCTGCCTACAGG + Intergenic
1152965285 18:108850-108872 GTTGTATAAGCTCTGCCTACAGG + Intergenic
1152965326 18:109259-109281 CTTGTCTAAGCTCTGCCTGCAGG + Intergenic
1153069772 18:1091931-1091953 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
1153189751 18:2524489-2524511 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1153414697 18:4834176-4834198 TTAGTGCAAGCTCTGCCTCCTGG + Intergenic
1153659613 18:7315333-7315355 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
1153894803 18:9548841-9548863 TCACTGTAACCTCTGCCTTCCGG - Intronic
1154005949 18:10527111-10527133 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1154126431 18:11696428-11696450 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1154160042 18:11974250-11974272 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1154284007 18:13034742-13034764 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1154391981 18:13945485-13945507 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1154500524 18:14994212-14994234 TGACTGTAAGCTCCGCCTCCCGG - Intergenic
1154531592 18:15351144-15351166 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
1154998835 18:21667146-21667168 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1155150047 18:23116104-23116126 TCATTGCAAGCTCTGCCTTCTGG + Intergenic
1155673465 18:28400509-28400531 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1155913952 18:31537542-31537564 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1155933938 18:31735407-31735429 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1156021261 18:32601956-32601978 TGACTGTAACCTCTGCCTCCTGG + Intergenic
1156150248 18:34233516-34233538 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1156973661 18:43190068-43190090 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
1156983171 18:43316912-43316934 TGTGTGTTAAATCTGTCTTCAGG + Intergenic
1156983561 18:43322306-43322328 TCTGAGTGGGCTCTGCCTTCTGG + Intergenic
1157103003 18:44746888-44746910 AGTGTGTAAGCACTGTCTTCAGG + Intronic
1157437529 18:47683489-47683511 TCTTTCTGAGCTCTGCCTTCAGG - Intergenic
1157554502 18:48604249-48604271 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1157809487 18:50684581-50684603 CTTGGGTGAGCTCTGCCTTCGGG + Intronic
1157835697 18:50900367-50900389 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1157948075 18:52003618-52003640 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1158843241 18:61411122-61411144 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1159199094 18:65160301-65160323 TGTGTGCAACCTCAGCCTCCAGG + Intergenic
1159267532 18:66102205-66102227 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1159524102 18:69566210-69566232 TCACTGTAAGCTCCGCCTTCGGG + Intronic
1159612300 18:70539529-70539551 TCAGTATAACCTCTGCCTTCCGG + Intergenic
1159941093 18:74409434-74409456 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1160090849 18:75825395-75825417 TGTGTGTAAAGTCAGCATTCAGG - Intergenic
1160480225 18:79233215-79233237 TCACTGAAAGCTCTGCCTTCCGG - Intronic
1160626734 18:80213881-80213903 TCATTGCAAGCTCTGCCTTCCGG - Intronic
1160636718 19:80723-80745 TGTCTCTTGGCTCTGCCTTCTGG - Intergenic
1161289665 19:3486499-3486521 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1161351333 19:3793625-3793647 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1161419630 19:4169403-4169425 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1161471631 19:4459766-4459788 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1161689585 19:5723537-5723559 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1161693090 19:5748802-5748824 TCAGTGTAACCTCTGCCTCCTGG + Intronic
1161817355 19:6507672-6507694 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1161820119 19:6525367-6525389 TGTGTGTAATCCCAGCATTCTGG + Intergenic
1162438237 19:10676361-10676383 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1162645342 19:12045570-12045592 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1162777534 19:12988985-12989007 TCAGTGTAAGCTCCGCCTCCCGG - Intergenic
1162978750 19:14224640-14224662 TGACTGCAACCTCTGCCTTCCGG + Intergenic
1163043284 19:14618779-14618801 TGAGTGCAACCTCTGCCTCCCGG - Intergenic
1163096375 19:15060288-15060310 TCACTGCAAGCTCTGCCTTCAGG - Intergenic
1163157314 19:15446511-15446533 TGGGTGTACCCTCTGCCCTCAGG + Intronic
1163178406 19:15581764-15581786 TCTCTGCAACCTCTGCCTTCCGG + Intergenic
1163464231 19:17456973-17456995 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1163487705 19:17598537-17598559 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1163566625 19:18055624-18055646 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1163662149 19:18584910-18584932 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1163833542 19:19559671-19559693 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1163877488 19:19885463-19885485 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1163881577 19:19927821-19927843 TCTCTGCAACCTCTGCCTTCTGG + Intronic
1163940640 19:20490198-20490220 TCAGTGAAACCTCTGCCTTCTGG - Intergenic
1163971397 19:20799134-20799156 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1164094815 19:21998227-21998249 TCACTGTAAGCTCTGCCTTCTGG + Intronic
1164176582 19:22780614-22780636 TGACTGTAACCTCTGCCTCCCGG - Intronic
1164214269 19:23129917-23129939 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1164328599 19:24228529-24228551 TCACTGTAAGCTCTGCCTTCCGG + Intergenic
1164448992 19:28343242-28343264 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1164728766 19:30485067-30485089 TCACTGAAAGCTCTGCCTTCCGG - Intronic
1164750886 19:30653966-30653988 CGTGCTTTAGCTCTGCCTTCTGG + Intronic
1165012094 19:32856267-32856289 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1165029853 19:32990028-32990050 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1165226887 19:34361163-34361185 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1165410729 19:35659486-35659508 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
1165564917 19:36716898-36716920 TCACTGTAAACTCTGCCTTCCGG + Intronic
1165633953 19:37324847-37324869 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1166291587 19:41866940-41866962 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1166401296 19:42482536-42482558 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1166680268 19:44761813-44761835 TCTCTGCAAGCTCTGCCTCCCGG - Intergenic
1167057924 19:47124558-47124580 TTGCTGCAAGCTCTGCCTTCTGG + Intronic
1167058179 19:47126482-47126504 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
1167081863 19:47281718-47281740 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1167085877 19:47309498-47309520 TCTCTGTAACCTCTGCCTCCTGG - Intronic
1167221453 19:48201545-48201567 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1167246259 19:48374899-48374921 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1167478607 19:49715079-49715101 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1167541433 19:50090398-50090420 TGACTGCAACCTCTGCCTTCCGG - Intergenic
1167610214 19:50503893-50503915 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1167628657 19:50609115-50609137 TGACTGCAACCTCTGCCTTCCGG + Intergenic
1167639207 19:50671256-50671278 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1167667713 19:50832395-50832417 TCACTGTAACCTCTGCCTTCTGG + Intronic
1167788543 19:51655910-51655932 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1167864208 19:52310928-52310950 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1168140912 19:54386518-54386540 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1168212586 19:54901284-54901306 TCTCTGCAAGCTCTGCCTCCGGG - Intergenic
1168264250 19:55213187-55213209 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1168387263 19:55974659-55974681 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1168502535 19:56905497-56905519 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1168538141 19:57189125-57189147 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1168607381 19:57770725-57770747 TTTGTGAAAGCCCTGCCTTTTGG + Intronic
1168611824 19:57806836-57806858 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1168618518 19:57857707-57857729 TCAGTGTAACCTCTGCCTCCTGG + Intronic
1168652727 19:58102384-58102406 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
1168653043 19:58105584-58105606 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1168720098 19:58550125-58550147 TATGTGTGATCTCTGCCTGCAGG + Exonic
925109352 2:1320455-1320477 TCACTGTAAGCTCTGCCTCCCGG - Intronic
925396999 2:3541252-3541274 TCACTGTAAGCTCTGCCTCCCGG - Intronic
925723821 2:6853825-6853847 TCACTGCAAGCTCTGCCTTCCGG - Intronic
925728471 2:6897920-6897942 GCTCTGTAACCTCTGCCTTCAGG - Exonic
925812068 2:7710752-7710774 TCTCTGTAACCTCTGCCTCCTGG + Intergenic
925813718 2:7726744-7726766 TCAGTGTAACCTCTGCCTCCCGG - Intergenic
926005701 2:9372026-9372048 TTTGTGTAGGAGCTGCCTTCGGG + Intronic
926011457 2:9411646-9411668 TCTCTGCAACCTCTGCCTTCCGG - Intronic
926023367 2:9516676-9516698 TCACTGTAACCTCTGCCTTCTGG - Intronic
926229862 2:10994213-10994235 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
926447143 2:12957007-12957029 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
926599786 2:14830094-14830116 AGTGTGTCAGCTTTGCCTTCAGG + Intergenic
926699365 2:15792930-15792952 TCACTGTAATCTCTGCCTTCTGG - Intergenic
926735469 2:16070305-16070327 TGGGTCTAAGCCCTGCCCTCAGG - Intergenic
927670224 2:25062765-25062787 TGAGTGTAAGGCCTGCCTTTTGG + Intronic
927771240 2:25863616-25863638 TCTTTGCAAGCTCCGCCTTCTGG - Intronic
928150903 2:28828059-28828081 TCACTGTAACCTCTGCCTTCCGG + Intronic
928222590 2:29417060-29417082 TCACTGCAAGCTCTGCCTTCTGG + Intronic
928281542 2:29950681-29950703 TTTGCATCAGCTCTGCCTTCAGG - Intergenic
928457029 2:31431504-31431526 TCTTTGAAAGCTCTTCCTTCTGG - Intergenic
928495457 2:31827109-31827131 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
928638303 2:33270513-33270535 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
929320556 2:40539066-40539088 TCACTGTAAGCTCTGCCTCCTGG + Intronic
929827524 2:45320662-45320684 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
929945636 2:46369728-46369750 TGTGTGTTTGATTTGCCTTCTGG + Intronic
930075915 2:47405345-47405367 TCACTGCAAGCTCTGCCTTCCGG - Intronic
930894968 2:56435382-56435404 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
931272268 2:60713416-60713438 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
931354080 2:61518540-61518562 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
931945222 2:67298909-67298931 TGTCTGTAACCTCTGCCTCCTGG - Intergenic
932184003 2:69675930-69675952 TCACTGCAAGCTCTGCCTTCCGG - Intronic
932249495 2:70230166-70230188 TCACTGCAAGCTCTGCCTTCCGG - Intronic
932260267 2:70321096-70321118 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
932525165 2:72458278-72458300 TGTGTCTAAGATTTGCCTTCGGG - Intronic
932744240 2:74318609-74318631 GGTCTGCAACCTCTGCCTTCTGG - Intronic
933272258 2:80245867-80245889 TCACTGCAAGCTCTGCCTTCCGG + Intronic
933545783 2:83710044-83710066 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
933551704 2:83785956-83785978 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
933681983 2:85110158-85110180 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
933912246 2:86951956-86951978 TCACTGTAACCTCTGCCTTCTGG + Intronic
934010749 2:87817941-87817963 TCACTGTAACCTCTGCCTTCTGG - Intronic
934076037 2:88429586-88429608 TCACTGTAAGCTCCGCCTTCCGG + Intergenic
934116804 2:88806756-88806778 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
934742897 2:96738813-96738835 TCACTGTAAGCTCTGCCTCCCGG + Intronic
935027697 2:99293064-99293086 TCTCTGCAACCTCTGCCTTCTGG + Intronic
935039985 2:99416836-99416858 TCACTGCAAGCTCTGCCTTCTGG - Intronic
935122007 2:100191250-100191272 TCTCTGTAACCTCTGCCTCCTGG + Intergenic
935233486 2:101118933-101118955 TCTGTGCAACCTCTGCCTCCAGG - Intronic
935252447 2:101275514-101275536 TCACTGCAAGCTCTGCCTTCCGG + Intronic
935774317 2:106458648-106458670 TCACTGTAACCTCTGCCTTCTGG - Intronic
935811568 2:106803284-106803306 TTTCTCGAAGCTCTGCCTTCAGG + Exonic
935905751 2:107837265-107837287 TCACTGTAACCTCTGCCTTCTGG + Intronic
935919397 2:107994509-107994531 TCACTGTAAGCTCTGCCTCCCGG - Intronic
935969060 2:108512283-108512305 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
935992231 2:108729792-108729814 TCACTGTAACCTCTGCCTTCTGG + Intronic
936029452 2:109059499-109059521 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
936105733 2:109623050-109623072 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
936121502 2:109749675-109749697 TCACTGTAACCTCTGCCTTCTGG - Intergenic
936127549 2:109802442-109802464 TCACTGTAACCTCTGCCTTCTGG + Intronic
936217148 2:110569043-110569065 TCACTGTAACCTCTGCCTTCTGG - Intronic
936223195 2:110621793-110621815 TCACTGTAACCTCTGCCTTCTGG + Intergenic
936293004 2:111241728-111241750 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
936340269 2:111625314-111625336 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
936410392 2:112253057-112253079 TCACTGCAAGCTCTGCCTTCCGG - Intronic
936426288 2:112423627-112423649 TCACTGTAACCTCTGCCTTCTGG - Intronic
936442062 2:112563127-112563149 TCACTGTAAGCTCTGCCTCCCGG + Intronic
936447742 2:112609139-112609161 TCTTTGCAAGCTCTGCCTCCTGG + Intergenic
936564761 2:113574318-113574340 TGTCTCTTGGCTCTGCCTTCTGG + Intergenic
936575069 2:113646130-113646152 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
936588029 2:113775759-113775781 TCTCTGTAAGCTCCGCCTCCCGG - Intergenic
936655049 2:114475139-114475161 TGTGTGTAAACTGTGCCGTGCGG - Intronic
936846710 2:116843249-116843271 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
937210263 2:120264223-120264245 TCACTGCAAGCTCTGCCTTCTGG + Intronic
937224780 2:120362170-120362192 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
937608024 2:123825865-123825887 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
937938842 2:127269494-127269516 TCACTGTAAGCTCTGCCTCCCGG + Intronic
938415358 2:131099516-131099538 TCACTGTAAGCTCCGCCTTCCGG - Intergenic
938640327 2:133270992-133271014 TGAGTGCAAGCTCTGCCTCCCGG + Intronic
938958931 2:136323482-136323504 TGTGTGTAAGCCATGCCCTCAGG - Intergenic
939491974 2:142887093-142887115 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
940258239 2:151755006-151755028 TCACTGTAACCTCTGCCTTCCGG + Intergenic
940693230 2:156946251-156946273 TGTCTGCAACCTCTGCCTCCTGG - Intergenic
941570914 2:167169299-167169321 TTTTTGTAAGTTTTGCCTTCAGG - Intronic
941666830 2:168250755-168250777 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
942092756 2:172509946-172509968 TCAGTGCAACCTCTGCCTTCTGG + Intergenic
942155258 2:173121459-173121481 TCACTGTAAGCTCTGCCTCCCGG + Intronic
942402016 2:175612852-175612874 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
942436916 2:175988846-175988868 TCACTGTAAGCTCTGCCTCCCGG + Intronic
942585453 2:177470627-177470649 AGTCTGTAATCTCTGCCTCCCGG - Intronic
943158562 2:184216719-184216741 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
943187186 2:184625941-184625963 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
943242778 2:185407792-185407814 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
944574297 2:201076692-201076714 TCACTGTAACCTCTGCCTTCTGG + Intronic
944585833 2:201173104-201173126 TCACTGTAACCTCTGCCTTCTGG + Exonic
944710210 2:202328650-202328672 TCAGTGCAATCTCTGCCTTCTGG - Intergenic
945223823 2:207511472-207511494 TCTCTGCAAGCTCTGCCTCCTGG - Intergenic
945230790 2:207587316-207587338 TCACTGCAAGCTCTGCCTTCCGG - Intronic
945248105 2:207739305-207739327 TCACTGTAACCTCTGCCTTCCGG + Intronic
945507293 2:210657383-210657405 TGACTGCAAGCTCCGCCTTCCGG + Intronic
946240365 2:218350349-218350371 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
946264610 2:218528125-218528147 TGACTGCAACCTCTGCCTTCTGG - Intronic
946428114 2:219610475-219610497 TCACTGCAAGCTCTGCCTTCCGG + Intronic
946582316 2:221142860-221142882 TCACTGTAACCTCTGCCTTCTGG - Intergenic
946606679 2:221412406-221412428 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
946848120 2:223879110-223879132 TCAGTGCAACCTCTGCCTTCTGG - Intronic
946852190 2:223918554-223918576 TCACTGTAAGCTCTGCCTCCCGG - Intronic
946916693 2:224530162-224530184 TCACTGCAAGCTCTGCCTTCCGG - Intronic
947150546 2:227110756-227110778 TTACTGCAAGCTCTGCCTTCCGG + Intronic
947460741 2:230302317-230302339 TCAGTGCAAGCTCTGCCTCCTGG - Intronic
947482802 2:230517688-230517710 TCACTGTAACCTCTGCCTTCTGG - Intronic
947676170 2:231982752-231982774 TGACTGCAACCTCTGCCTTCTGG + Intronic
947855626 2:233322110-233322132 TCACTGCAAGCTCTGCCTTCCGG - Intronic
948171504 2:235906939-235906961 TCACTGTAACCTCTGCCTTCCGG - Intronic
948277699 2:236722515-236722537 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
948512726 2:238481315-238481337 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1169124911 20:3120569-3120591 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1169586244 20:7089270-7089292 TGTGTGTAATTTCTACCTTTTGG - Intergenic
1169883630 20:10373935-10373957 TCATTGTAAGCTCTGCCTCCCGG - Intergenic
1169970750 20:11267323-11267345 TGTGTGGAATCTCCTCCTTCGGG + Intergenic
1170000165 20:11606436-11606458 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1170027064 20:11900780-11900802 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1170186076 20:13592320-13592342 TCACTGTAACCTCTGCCTTCTGG - Intronic
1170232562 20:14066884-14066906 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
1170258047 20:14368466-14368488 TCATTGCAAGCTCTGCCTTCCGG - Intronic
1170947143 20:20901408-20901430 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1171061036 20:21960395-21960417 TCACTGTAAGCTCCGCCTTCTGG + Intergenic
1171341752 20:24434847-24434869 TCACTGTAAGCTCTGCCTCCAGG + Intergenic
1171468095 20:25346717-25346739 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1171954992 20:31454911-31454933 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1171955611 20:31460544-31460566 TGAGTGCAAGCTCCGCCTCCCGG - Intergenic
1172003671 20:31801962-31801984 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1172112307 20:32554244-32554266 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1172147814 20:32769157-32769179 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1172351834 20:34249052-34249074 TCATTGTAACCTCTGCCTTCAGG - Intronic
1172903562 20:38351961-38351983 TCTGTGCAACCTCTGCCTCCAGG - Intronic
1173075226 20:39812084-39812106 TGTTTGCAATCTCTGCCTTAAGG + Intergenic
1173206858 20:41002125-41002147 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1173505131 20:43580948-43580970 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1173980959 20:47223749-47223771 TTAGTGCAACCTCTGCCTTCCGG - Intronic
1174234617 20:49079299-49079321 TCACTGTAACCTCTGCCTTCCGG + Intronic
1174445629 20:50589005-50589027 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1174577065 20:51544060-51544082 TCATTGCAAGCTCTGCCTTCTGG + Intronic
1174578668 20:51555516-51555538 TTACTGTAAGCTCTGCCTCCCGG - Intronic
1175071162 20:56335161-56335183 TCAATGTAAGCTCTGCCTCCCGG + Intergenic
1175099563 20:56569224-56569246 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1175336783 20:58201389-58201411 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1175550713 20:59815497-59815519 TCACTGTAACCTCTGCCTTCTGG + Intronic
1176711775 21:10156109-10156131 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1176955571 21:15099159-15099181 TGCCTGTAAGCTGTGCCATCAGG + Intergenic
1177166000 21:17604368-17604390 TGTCTGCAACCTCTGCCTGCCGG - Intronic
1177321326 21:19524703-19524725 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1177440327 21:21114893-21114915 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1177461356 21:21415408-21415430 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1177530603 21:22354080-22354102 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1177614022 21:23493009-23493031 TGTCTGCAAGCTCCGCCTCCCGG + Intergenic
1177806191 21:25877177-25877199 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1178136254 21:29630872-29630894 TGTTTGCAACCTCTGCCTCCCGG + Intronic
1178466931 21:32857531-32857553 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1178603873 21:34018261-34018283 TTACTGTAACCTCTGCCTTCTGG - Intergenic
1178861952 21:36297065-36297087 TCAGTGCAATCTCTGCCTTCGGG - Intergenic
1178938676 21:36886356-36886378 TCGCTGCAAGCTCTGCCTTCCGG - Intronic
1179181542 21:39049473-39049495 GGAGTGCAAGCTCTGCCTCCTGG - Intergenic
1179258081 21:39734936-39734958 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1179338524 21:40481447-40481469 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1179633583 21:42693371-42693393 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1180112929 21:45672996-45673018 TGTGTGCATTATCTGCCTTCAGG + Intronic
1180172946 21:46069998-46070020 TGGGGGTAAGCGCTGCCATCTGG - Intergenic
1180217283 21:46333355-46333377 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1180231210 21:46427797-46427819 TGAGTGTCAGCTCTGCCACCAGG + Intronic
1180413889 22:12692161-12692183 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1181259770 22:21589218-21589240 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1181675953 22:24452259-24452281 TCAGTGCAATCTCTGCCTTCTGG - Intergenic
1181772237 22:25134080-25134102 TGCGGCAAAGCTCTGCCTTCAGG - Intronic
1181969124 22:26677040-26677062 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1182116618 22:27760268-27760290 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1182445090 22:30385345-30385367 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
1182447762 22:30399438-30399460 TCCCTGTAAGCTCTGCCTCCCGG - Intronic
1182609504 22:31535262-31535284 TCACTGTAACCTCTGCCTTCCGG + Intronic
1182628496 22:31666050-31666072 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1182673678 22:32019552-32019574 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1182804854 22:33060777-33060799 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1182807791 22:33090128-33090150 TATCTGCAACCTCTGCCTTCCGG - Intergenic
1182818745 22:33193741-33193763 TCACTGTAACCTCTGCCTTCCGG - Intronic
1183125670 22:35778709-35778731 TCTCTGTAACCTCTGCCTCCTGG + Intronic
1183291709 22:37006292-37006314 TGGCTCTCAGCTCTGCCTTCTGG - Intronic
1183443592 22:37838058-37838080 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1183636324 22:39065204-39065226 TCGCTGCAAGCTCTGCCTTCTGG - Intronic
1183647714 22:39136013-39136035 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1183890915 22:40927798-40927820 TCACTGCAAGCTCTGCCTTCTGG - Exonic
1183960060 22:41406137-41406159 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1184044160 22:41962034-41962056 TTTCTGTAGGCTCTGCCATCTGG - Intergenic
1184364432 22:44040926-44040948 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1184364868 22:44044263-44044285 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1184396556 22:44245387-44245409 TCACTGCAAGCTCTGCCTTCTGG + Exonic
1184809727 22:46823032-46823054 TGTGGGTAACCTCTGCTGTCAGG + Intronic
1184912099 22:47542986-47543008 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1185124332 22:48997993-48998015 TCACTGTAAGCTCTGCCTTCCGG - Intergenic
1185304512 22:50106774-50106796 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
1185381600 22:50510919-50510941 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1185425104 22:50764750-50764772 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
949319709 3:2795593-2795615 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
949553298 3:5130606-5130628 TGACTGTAACCTCTGCCTCCTGG + Intronic
949911696 3:8915656-8915678 TCACTGCAAGCTCTGCCTTCCGG + Intronic
949990856 3:9577994-9578016 TCAGTGTAAGCTCCGCCTCCTGG + Intergenic
950022913 3:9801134-9801156 TCACTGTAAGCTCTGCCTCCCGG - Intronic
950025513 3:9817347-9817369 TCACTGTAAGCTCTGCCTCCCGG - Intronic
950058241 3:10046126-10046148 TCACTGTAAGCTCTGCCTCCCGG + Intronic
950140706 3:10613216-10613238 TGTGTGGGAGCTCTGTGTTCAGG + Intronic
950245817 3:11417883-11417905 TCACTGAAAGCTCTGCCTTCTGG + Intronic
950258489 3:11525627-11525649 TCACTGTAAGCTCTGCCTCCTGG + Intronic
950331976 3:12163165-12163187 TCATTGCAAGCTCTGCCTTCCGG - Intronic
950379217 3:12596971-12596993 TCACTGTAAGCTCTGCCTCCCGG + Intronic
950386897 3:12667043-12667065 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
950686253 3:14620579-14620601 TTTGTGTAAGTTCAACCTTCTGG - Intergenic
950796896 3:15517435-15517457 TGTGTGGAAGGCCTGCCCTCCGG + Intronic
950810055 3:15642527-15642549 TCACTGCAAGCTCTGCCTTCCGG + Intronic
951267174 3:20581939-20581961 TCGCTGTAACCTCTGCCTTCCGG + Intergenic
951369048 3:21822144-21822166 TCACTGTAAGCTCTGCCTCCTGG + Intronic
951998859 3:28761208-28761230 TGACTGTAAGCTCTGCCTCCCGG - Intergenic
952270630 3:31827559-31827581 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
952328223 3:32339886-32339908 TGACTGCAAGCTCTGCCTCCCGG - Intronic
952462070 3:33538064-33538086 TCACTGCAAGCTCTGCCTTCCGG - Intronic
953172863 3:40523689-40523711 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
953252122 3:41254806-41254828 TCAGTGTAACCTCTGCCTCCTGG - Intronic
953486695 3:43305555-43305577 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
953559685 3:43977303-43977325 TGACTGCAATCTCTGCCTTCTGG + Intergenic
954024780 3:47774490-47774512 TCAGTGCAAGCTCTGCCTTCTGG + Intronic
954139695 3:48598556-48598578 TGTGTGTTTACTCTGCATTCTGG - Intergenic
954194389 3:48987796-48987818 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
954264615 3:49462660-49462682 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
954341504 3:49957904-49957926 TGACTGTAACCTCTGCCTCCCGG + Intronic
954476675 3:50752701-50752723 TCTGTGCAACCTCTGCCTCCTGG - Intronic
954494210 3:50937579-50937601 TCACTGCAAGCTCTGCCTTCCGG - Intronic
954718855 3:52542543-52542565 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
954787738 3:53107208-53107230 TCCCTGCAAGCTCTGCCTTCTGG + Intronic
954793362 3:53148712-53148734 TGACTGCAACCTCTGCCTTCTGG - Intergenic
955141115 3:56270905-56270927 TCGCTGCAAGCTCTGCCTTCTGG - Intronic
955159394 3:56448998-56449020 TGACTGCAAGCTCTGCCTCCTGG - Intronic
955278700 3:57573125-57573147 TCACTGCAAGCTCTGCCTTCTGG - Intronic
955857031 3:63283890-63283912 TCACTGCAAGCTCTGCCTTCCGG + Intronic
955983629 3:64551282-64551304 TCACTGCAAGCTCTGCCTTCCGG + Intronic
956074755 3:65493001-65493023 TCACTGTAAGCTCTGCCTCCTGG - Intronic
956580542 3:70807558-70807580 TCAGTGAAACCTCTGCCTTCTGG + Intergenic
956611324 3:71126412-71126434 TCACTGCAAGCTCTGCCTTCCGG - Intronic
957908439 3:86588857-86588879 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
958440963 3:94155334-94155356 TCTCTGCAAGCTCCGCCTTCCGG - Intergenic
958542589 3:95498476-95498498 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
958597907 3:96253950-96253972 TCACTGTAAGCTCTGCCTTCTGG + Intergenic
958784892 3:98586867-98586889 TCACTGCAAGCTCTGCCTTCCGG - Intronic
959334475 3:105046420-105046442 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
959427210 3:106205468-106205490 TGACTGCAAGCTCCGCCTTCCGG - Intergenic
960160610 3:114346758-114346780 TCACTGTAACCTCTGCCTTCTGG + Intronic
960704530 3:120469259-120469281 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
960795782 3:121485990-121486012 ATTGCGTGAGCTCTGCCTTCTGG - Intronic
961070173 3:123916914-123916936 TCACTGCAAGCTCTGCCTTCTGG + Intronic
961140929 3:124555337-124555359 TCACTGCAAGCTCTGCCTTCCGG - Intronic
961437257 3:126927947-126927969 GGTGCGTCAGCTCTGCCTTGCGG - Intronic
961569097 3:127785429-127785451 TGTGTGGAAGCTTCCCCTTCAGG + Intronic
961580517 3:127877457-127877479 TCAGTGTAACCTCTGCCTCCTGG + Intergenic
961798426 3:129426437-129426459 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
961865151 3:129948484-129948506 TCAGTGCAAGCTCTGCCTCCTGG + Intergenic
962506099 3:136047828-136047850 TCACTGCAAGCTCTGCCTTCTGG - Intronic
962529374 3:136264798-136264820 TGACTGCAAGCTCTGCCTCCCGG - Intronic
962547536 3:136452487-136452509 TGTCTGCAAGCTCCGCCTCCTGG - Intronic
962609466 3:137062164-137062186 TCTCTGTCATCTCTGCCTTCAGG - Intergenic
963173209 3:142271878-142271900 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
963271556 3:143290488-143290510 TGTCTGTAAACACTGCCTGCAGG + Intronic
963415355 3:144988061-144988083 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
963642257 3:147875403-147875425 TGTGATTAACCTATGCCTTCGGG - Intergenic
963775501 3:149434958-149434980 TGACTGCAGGCTCTGCCTTCTGG - Intergenic
964099610 3:152972918-152972940 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
964154302 3:153565505-153565527 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
964596750 3:158440865-158440887 TCTCTGCAAGCTCTGCCTCCTGG - Intronic
964766403 3:160182756-160182778 TGTCTGTAATCTCTGCATTTTGG + Intergenic
964798915 3:160531865-160531887 TCACTGCAAGCTCTGCCTTCTGG + Intronic
964935181 3:162075787-162075809 TCACTGTAAGCTCCGCCTTCCGG + Intergenic
965050898 3:163646091-163646113 TCACTGTAACCTCTGCCTTCTGG + Intergenic
965103246 3:164329641-164329663 TGACTGCAACCTCTGCCTTCTGG + Intergenic
965204139 3:165699095-165699117 TCGCTGCAAGCTCTGCCTTCCGG - Intergenic
965543331 3:169891585-169891607 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
965580798 3:170265687-170265709 TGACTGCAAGCTCTGCCTCCTGG + Intronic
965598369 3:170430615-170430637 TGCATGCAACCTCTGCCTTCTGG + Intronic
965797631 3:172457605-172457627 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
965807475 3:172557056-172557078 TCAGTGCAACCTCTGCCTTCTGG - Intergenic
965857915 3:173111333-173111355 TCACTGTAAGCTCTGCCTCCTGG - Intronic
966069865 3:175862461-175862483 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
966146351 3:176816663-176816685 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
966185740 3:177225433-177225455 TGTCTGTAAGCTCAGCATTTTGG + Intergenic
966297542 3:178441317-178441339 TGACTGCAAGCTCTGCCTCCCGG - Intronic
966324610 3:178740191-178740213 TCACTGTAAGCTCTGCCTCCTGG + Intronic
966513180 3:180786862-180786884 TCACTGTAAGCTCTGCCTCCCGG + Intronic
966794560 3:183701154-183701176 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
966809620 3:183832291-183832313 TCACTGCAAGCTCTGCCTTCTGG + Intronic
966833838 3:184033840-184033862 TGTCTGCAACCTCTGCCTCCTGG - Intronic
966858533 3:184214082-184214104 TCACTGCAAGCTCTGCCTTCCGG + Intronic
967181850 3:186911980-186912002 TCAGTGCAAGCTCTGCCTTCCGG + Intergenic
967476277 3:189924045-189924067 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
967518793 3:190403255-190403277 TCACTGTAACCTCTGCCTTCTGG - Intronic
967860049 3:194143860-194143882 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
968028238 3:195461149-195461171 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
968198921 3:196735218-196735240 TCACTGCAAGCTCTGCCTTCCGG - Intronic
968338375 3:197933364-197933386 TCACTGTAACCTCTGCCTTCTGG - Intronic
968627835 4:1635916-1635938 TCACTGCAAGCTCTGCCTTCTGG + Intronic
968696329 4:2030875-2030897 TCACTGCAAGCTCTGCCTTCCGG - Intronic
968770707 4:2504623-2504645 TCACTGTAAGCTCTGCCTCCTGG + Intronic
968779131 4:2566120-2566142 TGACTGCAAGCTCTGCCTTCTGG + Intronic
968786078 4:2623243-2623265 TCACTGCAAGCTCTGCCTTCGGG + Intronic
968859512 4:3155294-3155316 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
969031609 4:4219620-4219642 TCACTGTAAGCTCTGCCTCCTGG - Intronic
969864458 4:10064798-10064820 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
969898178 4:10324246-10324268 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
970036542 4:11741870-11741892 TGTATGTAGGCACAGCCTTCAGG + Intergenic
970296252 4:14633937-14633959 TGTGTCTAAGCTCTGTCTCTTGG + Intergenic
970722066 4:18999465-18999487 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
970741634 4:19246385-19246407 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
970911842 4:21285764-21285786 TGAGTGCAACCTCTGCCTCCTGG - Intronic
971016940 4:22498168-22498190 ACTGTGCAACCTCTGCCTTCTGG - Intronic
971487191 4:27172229-27172251 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
971571697 4:28220414-28220436 TCAATGCAAGCTCTGCCTTCCGG + Intergenic
972500219 4:39670935-39670957 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
972510540 4:39764959-39764981 TGACTGTAAGCTCCGCCTCCTGG + Intronic
972520448 4:39850195-39850217 TCACTGTAAGCTCTGCCTCCTGG - Intronic
972529869 4:39951823-39951845 TCACTGTAACCTCTGCCTTCCGG - Intronic
972574163 4:40336549-40336571 TCACTGTAAGCTCTGCCTCCTGG + Intronic
972637135 4:40894211-40894233 TCACTGCAAGCTCTGCCTTCCGG - Intronic
972754017 4:42025738-42025760 TCACTGTAAGCTCTGCCTTCCGG + Intronic
972906771 4:43759706-43759728 TCACTGCAAGCTCTGCCTTCAGG - Intergenic
973005969 4:45007205-45007227 TCACTGTAAGCTCCGCCTTCCGG - Intergenic
973978530 4:56286449-56286471 TCACTGTAAGCTCTGCCTCCCGG - Intronic
974058458 4:57008275-57008297 TCACTGCAAGCTCTGCCTTCTGG + Intronic
974338776 4:60586925-60586947 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
974762953 4:66302204-66302226 TGCCTGCAAGCTCTGCCTCCTGG - Intergenic
974802614 4:66837961-66837983 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
974890764 4:67879404-67879426 TATCTGCAAGCTCTGCCTCCCGG - Intronic
975008454 4:69320237-69320259 TCACTGTAAGCTCTGCCTTCCGG - Intronic
975125414 4:70776699-70776721 TTACTGTAAGCTCTGCCTCCCGG - Intronic
975176523 4:71295731-71295753 TCACTGTAACCTCTGCCTTCTGG + Intronic
975332010 4:73126804-73126826 TGTCTGCAATCTCTGCCTCCTGG + Intronic
975454690 4:74576354-74576376 TCAGTGCAACCTCTGCCTTCTGG + Intergenic
975918635 4:79356048-79356070 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
976258588 4:83124563-83124585 TCACTGTAAGCTCTGCCTCCTGG - Intronic
976591166 4:86851132-86851154 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
976647410 4:87400322-87400344 TGTGTTTCAGCTCTGCCATTTGG - Intergenic
976973294 4:91134983-91135005 TCAGTGCAAGCTCTGCCTCCTGG - Intronic
977682834 4:99814631-99814653 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
977838838 4:101676735-101676757 TCAGTGTAACCTCTGCCTCCTGG + Intronic
977937399 4:102822859-102822881 TCACTGCAAGCTCTGCCTTCTGG - Intronic
977992252 4:103458573-103458595 TGTCTGCAAGCTCTGCCTCCAGG + Intergenic
978002310 4:103571370-103571392 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
978069979 4:104454954-104454976 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
978281636 4:107023236-107023258 TGAGTGTAATCTTTGACTTCCGG - Intronic
978390071 4:108216176-108216198 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
978440212 4:108726206-108726228 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
978448097 4:108800294-108800316 TCAGTGTAACCTCTGCCTCCCGG + Intergenic
978511336 4:109522124-109522146 TCACTGCAAGCTCTGCCTTCGGG + Intronic
978542556 4:109834402-109834424 TCACTGCAAGCTCTGCCTTCTGG + Intronic
978575933 4:110189890-110189912 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
979139984 4:117160685-117160707 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
979425218 4:120555530-120555552 TAAGTGTAAGTTTTGCCTTCTGG + Intergenic
979608010 4:122659698-122659720 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
979793883 4:124819867-124819889 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
980049378 4:128023807-128023829 TTACTGCAAGCTCTGCCTTCTGG - Intronic
980340763 4:131542846-131542868 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
980407995 4:132378997-132379019 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
981116990 4:141003246-141003268 TGTGTGCTAGCTTTGCTTTCAGG + Intronic
981277733 4:142921636-142921658 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
981357652 4:143808834-143808856 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
981448568 4:144869062-144869084 TAGCTGTAACCTCTGCCTTCCGG - Intergenic
981473033 4:145158405-145158427 TTACTGCAAGCTCTGCCTTCTGG - Intronic
981755866 4:148141357-148141379 TGTGTGCAACCTCCGCCTCCTGG - Intronic
982317889 4:154049614-154049636 TGTGTGAAATCACTGTCTTCAGG - Intergenic
982348510 4:154388567-154388589 TGACTGCAACCTCTGCCTTCTGG + Intronic
982770607 4:159393477-159393499 TCACTGTAAGCTCCGCCTTCTGG + Intergenic
982907066 4:161087861-161087883 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
982939540 4:161532128-161532150 TCACTGTAAGCTCTGCCTCCCGG - Intronic
983480643 4:168269524-168269546 TCACTGCAAGCTCTGCCTTCCGG - Intronic
983517383 4:168672531-168672553 TCACTGCAAGCTCTGCCTTCCGG + Intronic
984094267 4:175414037-175414059 TCTGAGTAGGCTCTGCCATCTGG - Intergenic
984171274 4:176362393-176362415 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
984197958 4:176682381-176682403 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
984782269 4:183536801-183536823 TTACTGTAAGCTCTGCCTCCCGG + Intergenic
984787884 4:183585714-183585736 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
984911591 4:184678600-184678622 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
984990044 4:185371465-185371487 TCACTGCAAGCTCTGCCTTCCGG - Intronic
985109148 4:186530669-186530691 TGACTGCAATCTCTGCCTTCTGG - Intronic
985200626 4:187481316-187481338 TCTCTGCAAGCTCTGCCTCCCGG - Intergenic
985341747 4:188961769-188961791 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
985463886 4:190176304-190176326 CTTGTCTAAGCTCTGCCTACAGG - Intronic
985464129 4:190178425-190178447 CTTGTCTAAGCTCTGCCTACAGG - Intronic
985464171 4:190178834-190178856 GTTGTATAAGCTCTGCCTACAGG - Intronic
985956073 5:3267283-3267305 GGTGTGGAAGCTCTGCTTCCTGG - Intergenic
986247678 5:6025561-6025583 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
986503305 5:8424521-8424543 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
986975113 5:13384715-13384737 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
987333753 5:16880103-16880125 TCAGTGTAACCTCTGCCTCCTGG - Intronic
987343707 5:16960163-16960185 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
987640443 5:20605329-20605351 TAAGTGCAAGCTCTGCCTCCAGG + Intergenic
987711979 5:21512076-21512098 TCAGTGCAACCTCTGCCTTCTGG - Intergenic
987837060 5:23175558-23175580 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
988000957 5:25347723-25347745 GGTGTGAAACCTCTGCCTCCTGG + Intergenic
988036719 5:25836489-25836511 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
988042512 5:25908169-25908191 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
988078080 5:26379487-26379509 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
988185785 5:27859993-27860015 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
989058779 5:37389483-37389505 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
989221163 5:38966873-38966895 TCAGTATAACCTCTGCCTTCCGG + Intronic
989331129 5:40259697-40259719 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
989709353 5:44378504-44378526 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
989908972 5:49599787-49599809 GTTGTATAAGCTCTGCCTTCAGG - Intergenic
990805638 5:59658454-59658476 TCACTGCAAGCTCTGCCTTCTGG + Intronic
990867951 5:60400445-60400467 TCACTGCAAGCTCTGCCTTCCGG - Intronic
991344558 5:65649929-65649951 TCACTGCAAGCTCTGCCTTCCGG + Intronic
991581563 5:68160929-68160951 TGTGTGTGAGCACTCCTTTCTGG + Intergenic
991682307 5:69151342-69151364 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
991727015 5:69545811-69545833 TCGGTGCAACCTCTGCCTTCCGG + Intronic
991867942 5:71082063-71082085 TCGGTGCAACCTCTGCCTTCCGG - Intergenic
992444785 5:76823885-76823907 TCGCTGTAAGCTCTGCCTCCCGG + Intronic
992647224 5:78822710-78822732 TTACTGCAAGCTCTGCCTTCCGG + Intronic
992982397 5:82189696-82189718 TGACTGTAACCTCCGCCTTCTGG + Intronic
992985128 5:82220702-82220724 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
993283760 5:85962125-85962147 TGACTGTAACCTCTGCCTCCTGG - Intergenic
993464848 5:88232646-88232668 TGACTGCAAGCTCTGCCTCCCGG + Intronic
993534712 5:89068312-89068334 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
993667401 5:90717568-90717590 TCACTGCAAGCTCTGCCTTCCGG + Intronic
993702166 5:91131523-91131545 TCACTGTAACCTCTGCCTTCTGG + Intronic
993854909 5:93062091-93062113 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
994089046 5:95792310-95792332 TCACTGCAAGCTCTGCCTTCCGG - Intronic
994183952 5:96798248-96798270 TCACTGCAAGCTCTGCCTTCCGG - Intronic
995331619 5:110953456-110953478 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
995512821 5:112925160-112925182 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
995607124 5:113869122-113869144 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
995647989 5:114334996-114335018 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
995836469 5:116404854-116404876 TGTCTCTCAGCTCTGCCTCCAGG + Intronic
996084110 5:119286545-119286567 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
996102098 5:119454694-119454716 TGACTGCAACCTCTGCCTTCCGG + Intronic
996716339 5:126590808-126590830 TCACTGTAACCTCTGCCTTCTGG - Intronic
996916512 5:128718961-128718983 TTTGTGTATGATCTGACTTCAGG + Intronic
997070805 5:130619878-130619900 TCTCTGTAACCTCTGCCTCCTGG - Intergenic
997127121 5:131238426-131238448 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
997458953 5:134039401-134039423 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
997482545 5:134198316-134198338 TGACTGCAAGCTCTGCCTCCCGG - Intronic
998064096 5:139142841-139142863 TCACTGCAAGCTCTGCCTTCCGG + Intronic
998088721 5:139348427-139348449 TGACTGCAAGCTCTGCCTCCCGG + Intronic
998204470 5:140149045-140149067 TCACTGAAAGCTCTGCCTTCCGG + Intergenic
998342306 5:141428927-141428949 TCACTGCAAGCTCTGCCTTCCGG + Intronic
998346912 5:141472463-141472485 TCACTGCAAGCTCTGCCTTCTGG - Intronic
998365295 5:141626666-141626688 TCAGTGCAAGCTCTGCCTCCTGG - Intronic
998409021 5:141893961-141893983 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
998466530 5:142348938-142348960 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
998958373 5:147460034-147460056 TCACTGTAAGCTCTGCCTCCTGG - Intronic
999299693 5:150483672-150483694 TCTCTGCAAGCTCTGCCTCCCGG + Intergenic
999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG + Intergenic
1000035052 5:157440221-157440243 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1000140404 5:158397739-158397761 TGTGTATAAACTCTTCCTACTGG + Intergenic
1000517726 5:162259830-162259852 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1000837234 5:166170433-166170455 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1000876505 5:166645609-166645631 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1001031581 5:168266991-168267013 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1001397146 5:171425603-171425625 TCACTGTAAGCTCTGCCTGCCGG + Intronic
1001404728 5:171467833-171467855 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1001604972 5:172953033-172953055 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1001789138 5:174439849-174439871 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1002117225 5:176972325-176972347 TCACTGCAAGCTCTGCCTTCAGG - Intronic
1002399864 5:178985626-178985648 TCCCTGCAAGCTCTGCCTTCCGG - Intronic
1002476043 5:179466853-179466875 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1002529289 5:179834339-179834361 TGTGTGTCTTCTCTGCCTTAGGG + Intronic
1002612011 5:180426332-180426354 TCTCTGCAAGCTCTGCCTCCAGG + Intergenic
1002620443 5:180484347-180484369 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1002646095 5:180656186-180656208 TCAGTGCAAGCTCTGCCTCCTGG - Intergenic
1002652211 5:180707285-180707307 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1002684193 5:180994858-180994880 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1002816128 6:682272-682294 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1002817040 6:690626-690648 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1003595716 6:7472497-7472519 TGAGTGCAACCTCTGCCTCCAGG + Intergenic
1003686657 6:8311212-8311234 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1003841083 6:10119866-10119888 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1004103312 6:12638220-12638242 TGTGTGTGAGCACCGCCTGCTGG - Intergenic
1004400350 6:15283051-15283073 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1004401270 6:15290969-15290991 TGTGTGTAAGCCCAGCCCTTTGG + Intronic
1004504090 6:16233646-16233668 TCACTGTAACCTCTGCCTTCCGG + Intergenic
1004587244 6:17014468-17014490 TCAGTGCAATCTCTGCCTTCCGG - Intergenic
1004623128 6:17348823-17348845 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1004666271 6:17751143-17751165 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1004843525 6:19613772-19613794 TCTGTGTTAGCTCTGACTCCAGG - Intergenic
1004969974 6:20899137-20899159 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1004973229 6:20935501-20935523 TCACTGTAACCTCTGCCTTCTGG + Intronic
1005043816 6:21622808-21622830 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1005163664 6:22894737-22894759 TTTGTGCAAGCTATGTCTTCAGG + Intergenic
1005302210 6:24482172-24482194 TCACTGTAACCTCTGCCTTCCGG + Intronic
1005494426 6:26376136-26376158 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1005610985 6:27524969-27524991 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1005761153 6:28969370-28969392 TCTGTGTCAGCTCTGACTCCAGG + Intergenic
1005956529 6:30667505-30667527 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1006213551 6:32418705-32418727 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1006534455 6:34686879-34686901 TTTCTGCAAGCTCCGCCTTCCGG - Intronic
1006675890 6:35762770-35762792 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1006873578 6:37276037-37276059 TCACTGTAACCTCTGCCTTCCGG + Intronic
1006900647 6:37498748-37498770 TCACTGTAAACTCTGCCTTCTGG - Intronic
1006952874 6:37839587-37839609 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1006952937 6:37840170-37840192 TCAGTGCAACCTCTGCCTTCTGG + Intronic
1007489714 6:42209668-42209690 TCACTGTAACCTCTGCCTTCCGG - Intronic
1007838123 6:44692405-44692427 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1007950258 6:45865921-45865943 TGAGAGTATGTTCTGCCTTCTGG - Intergenic
1008151501 6:47957673-47957695 TCTCTGTAAGCTCTGCCTCCCGG + Intronic
1008162500 6:48095612-48095634 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1008267774 6:49452405-49452427 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1008272704 6:49508219-49508241 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1008543201 6:52563642-52563664 GGAGTGCAAGCTCTGCCTCCTGG - Intronic
1008942227 6:57059514-57059536 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1009561087 6:65244585-65244607 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1009978926 6:70703149-70703171 TGACTGCAACCTCTGCCTTCTGG + Intronic
1010147157 6:72683440-72683462 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1010183745 6:73118944-73118966 TGTCTGCCACCTCTGCCTTCTGG - Intronic
1010439532 6:75877339-75877361 TGACTGCAACCTCTGCCTTCTGG + Intronic
1010503073 6:76624997-76625019 TCACTGTAAGCTCTGCCTTCCGG + Intergenic
1010506123 6:76661727-76661749 TGTCTGCAAGCTCCGCCTCCCGG + Intergenic
1010601102 6:77827284-77827306 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1010826374 6:80481749-80481771 TCAGTGTAACCTCTGCCTCCTGG + Intergenic
1010839116 6:80626365-80626387 TCAGTGTAAGCTCTGCCTCCTGG - Intergenic
1010890911 6:81309365-81309387 TGTGTGTAGGCTCTGTGTACAGG - Intergenic
1011654500 6:89537819-89537841 CGTTTGTAACCTCTACCTTCTGG - Intronic
1011658756 6:89576124-89576146 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1011658827 6:89576705-89576727 GGTCTGTCAGCTCTGCCTCCTGG + Intronic
1012184552 6:96196635-96196657 TCACTGTAACCTCTGCCTTCCGG - Intronic
1012229947 6:96749726-96749748 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1012596578 6:101048281-101048303 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1012772461 6:103456387-103456409 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1012849541 6:104430089-104430111 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1012869595 6:104657703-104657725 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1013029872 6:106322992-106323014 TCTCTGCAAGCTCTGCCTCCCGG + Intronic
1013305079 6:108840355-108840377 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1013699764 6:112751285-112751307 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1014005289 6:116410657-116410679 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1014094984 6:117449898-117449920 TTAGTGCAAACTCTGCCTTCTGG - Intronic
1014169393 6:118262064-118262086 TGTCTGTGAGATCTGCCTTCAGG - Intronic
1014363573 6:120510720-120510742 TCTCTGCAAGCTCTGCCTCCCGG + Intergenic
1014483887 6:121975376-121975398 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1014700854 6:124686225-124686247 TGTATGTAAGGCCTGCCTTGCGG - Intronic
1014808250 6:125856425-125856447 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1014850616 6:126336151-126336173 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
1015211124 6:130700407-130700429 TGTGCTTAAGCTTTGCTTTCAGG - Intergenic
1015296322 6:131597399-131597421 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1015841506 6:137481668-137481690 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1016143090 6:140637774-140637796 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1016268374 6:142258232-142258254 TCATTGTAAGCTCTGCCTCCCGG - Intergenic
1016739532 6:147512784-147512806 GATGTGAAAGCTCTGCCCTCTGG + Intronic
1016891060 6:149007360-149007382 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1017193580 6:151678396-151678418 TGAGTGCAACCTCTGCCTCCCGG - Intronic
1017413136 6:154190979-154191001 TCAGTGAAAGCTCTGCCTCCTGG - Intronic
1017798694 6:157871849-157871871 TCACTGTAACCTCTGCCTTCTGG + Intronic
1017808244 6:157964904-157964926 TGACTGCAACCTCTGCCTTCCGG - Intergenic
1017865682 6:158441236-158441258 TCACTGTAACCTCTGCCTTCGGG - Intronic
1018031845 6:159847611-159847633 TGTGTGTTAGCACAGCCTCCTGG - Intergenic
1018072889 6:160181712-160181734 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1018156015 6:160986029-160986051 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1018544750 6:164923138-164923160 TCTTTGCAAGCTCTGCCTCCTGG - Intergenic
1018869801 6:167772762-167772784 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1018989885 6:168666450-168666472 TGTGTCTAGGAACTGCCTTCGGG - Exonic
1019130540 6:169869782-169869804 TGACTGCAAGCTCTGCCTCCGGG - Intergenic
1019490535 7:1311209-1311231 TGAGTGTAACCTCTCCTTTCAGG + Intergenic
1019691924 7:2420046-2420068 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1019706941 7:2501398-2501420 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1019726456 7:2605543-2605565 TCACTGTAAGCTCCGCCTTCCGG - Intronic
1019911990 7:4106376-4106398 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1020285086 7:6672529-6672551 TTAGTGCAAGCTCTGCCTCCTGG + Intergenic
1020843619 7:13254613-13254635 AGTGTCTAAGCTCTGCAGTCAGG - Intergenic
1021396742 7:20158671-20158693 TTTGTCTTAGCACTGCCTTCAGG + Exonic
1021476726 7:21069996-21070018 TGTGTGTAATCTCAGCATTTTGG - Intergenic
1021670233 7:23028518-23028540 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1021721876 7:23512531-23512553 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1021778654 7:24079638-24079660 TCTGTGCAACCTCTGCCTCCTGG + Intergenic
1022032899 7:26508251-26508273 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1022136326 7:27452599-27452621 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1022147804 7:27563971-27563993 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1023176916 7:37444585-37444607 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1023285847 7:38618435-38618457 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1023409855 7:39879424-39879446 TCACTGTAAGCTCTGCCTCCGGG - Intergenic
1023429039 7:40070163-40070185 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1023807418 7:43883433-43883455 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1024067322 7:45751205-45751227 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1024104747 7:46071566-46071588 TGGGTTGATGCTCTGCCTTCTGG - Intergenic
1024118639 7:46215833-46215855 CGTGTGTAAGAACAGCCTTCGGG + Intergenic
1024129449 7:46335750-46335772 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1024224756 7:47317757-47317779 TGTGTGTTGGCTCTGTCTGCAGG - Intronic
1024291586 7:47808171-47808193 TTTGTGTGACCTCTGCCTTTTGG + Intronic
1024896155 7:54264367-54264389 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1025043009 7:55664163-55664185 TCACTGTAAGCTCTGCCTCCGGG + Intergenic
1025126351 7:56348096-56348118 TCAGTGCAACCTCTGCCTTCCGG + Intergenic
1025135931 7:56412691-56412713 TCACTGTAAGCTCTGCCTCCGGG + Intergenic
1025136271 7:56416079-56416101 TGAGTGCAAGCTCCGCCTCCCGG - Intergenic
1025222009 7:57119530-57119552 TCACTGTAACCTCTGCCTTCCGG - Intergenic
1025268051 7:57483816-57483838 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1025649910 7:63456981-63457003 TCACTGTAACCTCTGCCTTCCGG + Intergenic
1025723828 7:64039541-64039563 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1025947050 7:66112710-66112732 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1025976270 7:66372546-66372568 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1026075406 7:67162237-67162259 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1026144594 7:67735555-67735577 TGCATGCAACCTCTGCCTTCCGG - Intergenic
1026232461 7:68497174-68497196 TGTGTGCAATCTCTACCCTCAGG + Intergenic
1026492635 7:70875957-70875979 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1026748648 7:73032356-73032378 TGACTGCAATCTCTGCCTTCCGG - Intergenic
1026752296 7:73060501-73060523 TGACTGCAATCTCTGCCTTCCGG - Intergenic
1026755947 7:73088628-73088650 TGACTGCAATCTCTGCCTTCCGG - Intergenic
1026794266 7:73355989-73356011 TGTCTGCAAGCTCCGCCTCCCGG - Intronic
1026916791 7:74125056-74125078 TCACTGTAAGCTCTGCCTTCCGG + Intergenic
1026935408 7:74252022-74252044 TCTCTGCAAGCTCTGCCTGCTGG - Intronic
1026945502 7:74313483-74313505 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1026999330 7:74641265-74641287 TGACTGCAAGCTCCGCCTTCCGG + Intergenic
1027034844 7:74917622-74917644 TGACTGTAATCTCTGCCTTCCGG - Intergenic
1027091458 7:75304801-75304823 TGACTGCAATCTCTGCCTTCCGG + Intergenic
1027095102 7:75332767-75332789 TGACTGCAATCTCTGCCTTCCGG + Intergenic
1027111722 7:75444896-75444918 TCAGTGCAACCTCTGCCTTCTGG - Intronic
1027182377 7:75949931-75949953 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1027283952 7:76629427-76629449 TCAGTGCAACCTCTGCCTTCTGG - Intergenic
1027324237 7:77034902-77034924 TGACTGCAATCTCTGCCTTCCGG - Intergenic
1027570916 7:79865491-79865513 AGACTGTAAGCTCTGCCTCCTGG - Intergenic
1027658683 7:80962590-80962612 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1027762837 7:82301830-82301852 TGACTGCAACCTCTGCCTTCTGG + Intronic
1027783767 7:82553671-82553693 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1027822882 7:83070460-83070482 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1028541772 7:91950302-91950324 TCAGTGCAAGCTCTGCCTCCCGG + Intronic
1028693497 7:93681294-93681316 TCTCTGCAAGCTCTGCCTCCCGG - Intronic
1028808253 7:95054188-95054210 TGACTGCAACCTCTGCCTTCTGG + Intronic
1028831578 7:95333197-95333219 TCAGTGCAACCTCTGCCTTCTGG - Intergenic
1028921972 7:96319465-96319487 TCACTGTAACCTCTGCCTTCTGG - Intronic
1029131748 7:98336539-98336561 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1029208179 7:98882435-98882457 TCACTGTAACCTCTGCCTTCCGG + Intronic
1029395211 7:100303508-100303530 TGACTGCAATCTCTGCCTTCCGG + Intergenic
1029714145 7:102316942-102316964 TGACTGTAACCTCTGCCTTCCGG - Intronic
1030024954 7:105314255-105314277 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1030032359 7:105381167-105381189 TCAGTGTAACCTCTGCCTCCTGG - Intronic
1030035722 7:105406595-105406617 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1030064061 7:105645736-105645758 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1030391555 7:108934117-108934139 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1030448072 7:109672606-109672628 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1030479893 7:110090022-110090044 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1030557783 7:111048163-111048185 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1030652928 7:112134639-112134661 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1030685025 7:112477273-112477295 TCACTGTAACCTCTGCCTTCAGG + Intronic
1030743301 7:113135256-113135278 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1031100113 7:117469731-117469753 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1031682802 7:124695362-124695384 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1031695348 7:124844658-124844680 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1032144944 7:129370621-129370643 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1032290554 7:130586535-130586557 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1033095581 7:138427696-138427718 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1033154330 7:138943772-138943794 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1033344056 7:140513523-140513545 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1033495336 7:141888507-141888529 TCAGTGCAAGCTCTGCCTCCTGG + Intergenic
1033501533 7:141955514-141955536 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1033920848 7:146389773-146389795 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1034067613 7:148151991-148152013 TGTATGAAAGCCCTTCCTTCCGG - Intronic
1034173323 7:149080095-149080117 TGACTGTAACCTCTGCCTTCCGG - Intronic
1034189425 7:149202384-149202406 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1034647530 7:152662037-152662059 TCACTGTAACCTCTGCCTTCTGG + Intronic
1034676478 7:152896045-152896067 TGTTGGGAAGCTCTGCCATCGGG + Intergenic
1034875324 7:154720248-154720270 TGCCTGGAAGCTCTGCCTGCTGG - Intronic
1035097232 7:156365539-156365561 TGTGTGTGAGCCCTGCTTCCAGG + Intergenic
1035207400 7:157302856-157302878 TCGCTGTAACCTCTGCCTTCTGG + Intergenic
1035655726 8:1303320-1303342 TCTGTGCAAGCTCCGCCTCCCGG - Intergenic
1036033970 8:4999111-4999133 TCACTGCAAGCTCTGCCTTCGGG - Intergenic
1036155875 8:6341445-6341467 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1036704648 8:11037781-11037803 TCAGTGCAAGCTCTGCCTTCTGG - Intronic
1036750359 8:11439934-11439956 TGTGTGAATGCTCTGAATTCCGG + Intronic
1036757554 8:11481259-11481281 TATGTGGCAGCTCAGCCTTCAGG + Intergenic
1037078414 8:14751855-14751877 TCAGTGCAAGCTCTGCCTCCCGG - Intronic
1037158434 8:15735772-15735794 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1037254641 8:16939510-16939532 TGACTGCAACCTCTGCCTTCTGG - Intergenic
1037343220 8:17870033-17870055 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1037470819 8:19208283-19208305 TCACTGTAAGCTCCGCCTTCTGG - Intergenic
1037686851 8:21147440-21147462 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1038036458 8:23690802-23690824 TGTGTGCAAGCTCTCCCTGCAGG + Intergenic
1038161812 8:25046635-25046657 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1038173562 8:25160799-25160821 TTACTGCAAGCTCTGCCTTCCGG - Intergenic
1038185182 8:25266787-25266809 TGTGTGTAAGCCCTACCTAAAGG - Intronic
1038222852 8:25627289-25627311 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1038604032 8:28980188-28980210 CATGTGTAGTCTCTGCCTTCTGG + Intronic
1038626839 8:29202390-29202412 TCACTGTAATCTCTGCCTTCTGG + Intronic
1038847917 8:31246870-31246892 TGACTGCAACCTCTGCCTTCTGG + Intergenic
1039529631 8:38249185-38249207 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1039564747 8:38543135-38543157 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1039590153 8:38739434-38739456 TGTATGTAAGCACTGACATCTGG - Intronic
1039951238 8:42174321-42174343 TATCTGCAAGCTCTGCCTCCTGG - Intergenic
1040012105 8:42670464-42670486 TCACTGTAACCTCTGCCTTCTGG + Intergenic
1040435756 8:47389612-47389634 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1040480582 8:47822713-47822735 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1040857832 8:51968770-51968792 TCAGTGTAACCTCTGCCTCCTGG + Intergenic
1041231274 8:55755339-55755361 TCACTGTAACCTCTGCCTTCCGG + Intronic
1041508324 8:58626171-58626193 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
1042140359 8:65672583-65672605 TCATTGTAACCTCTGCCTTCTGG + Intronic
1042328410 8:67552696-67552718 TGCATGCAAGCTCTGCCTCCCGG - Intronic
1042967974 8:74376421-74376443 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1043497107 8:80813802-80813824 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1043587937 8:81791693-81791715 TCAGTGTAAGCTCTGCCTCCTGG + Intergenic
1044086781 8:87952508-87952530 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1044429623 8:92094024-92094046 TGTATGTCATTTCTGCCTTCAGG - Intronic
1044679690 8:94764499-94764521 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1044697211 8:94935481-94935503 TTCTTGTAATCTCTGCCTTCTGG - Intronic
1044700595 8:94962365-94962387 TCACTGTAACCTCTGCCTTCTGG + Intronic
1044804726 8:95993196-95993218 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1045304249 8:100943910-100943932 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1045308440 8:100979578-100979600 TCACTGTAACCTCTGCCTTCCGG - Intergenic
1046340916 8:112853298-112853320 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1046787369 8:118282439-118282461 TCTGTGTAAACCCTACCTTCTGG + Intronic
1046797628 8:118390079-118390101 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1046940018 8:119921833-119921855 TCACTGTAACCTCTGCCTTCTGG + Intronic
1047386224 8:124411923-124411945 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1047910546 8:129524053-129524075 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
1048065886 8:130968242-130968264 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1048275976 8:133066249-133066271 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1048847613 8:138615454-138615476 TTACTGTAACCTCTGCCTTCAGG - Intronic
1049872072 8:144987945-144987967 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1049887660 9:38896-38918 TGTCTCTTGGCTCTGCCTTCTGG - Intergenic
1050352412 9:4752995-4753017 TCACTGTAATCTCTGCCTTCTGG - Intergenic
1050598863 9:7230810-7230832 TGTGAGTAATCTCTGCTTTCTGG + Intergenic
1050887737 9:10786790-10786812 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1050901996 9:10961038-10961060 TCTCTATAAGCTCTGCCTCCCGG - Intergenic
1051359657 9:16270668-16270690 TCAGTGTAACCTCTGCCTCCCGG - Intronic
1051652866 9:19347212-19347234 TGTCTGCAACCTCTGCCTCCCGG + Intronic
1051931233 9:22388901-22388923 TATGTGTAAGCATTGCCTCCAGG - Intergenic
1051985252 9:23078017-23078039 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1052288735 9:26818621-26818643 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1052301668 9:26959181-26959203 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1052446272 9:28565624-28565646 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1052557290 9:30033473-30033495 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1052656904 9:31374749-31374771 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1052765484 9:32635782-32635804 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1052883989 9:33625443-33625465 TCACTGTAACCTCTGCCTTCCGG - Intergenic
1052982560 9:34459518-34459540 TCTCTGTAACCTCTGCCTCCTGG + Intronic
1053089558 9:35262389-35262411 TGGCTGTAAGCTTTGCCTCCTGG + Intronic
1053454583 9:38223772-38223794 TGACTGCAACCTCTGCCTTCTGG - Intergenic
1053525710 9:38828290-38828312 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1054778906 9:69148447-69148469 TCACTGTAATCTCTGCCTTCCGG + Intronic
1055148363 9:72963450-72963472 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1055543182 9:77336869-77336891 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1055571600 9:77622817-77622839 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1055588697 9:77786301-77786323 TCGCTGCAAGCTCTGCCTTCCGG - Intronic
1055630331 9:78217182-78217204 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1055660679 9:78501174-78501196 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1056042034 9:82678088-82678110 TCTCTCTAAGCTCTGACTTCAGG + Intergenic
1056385718 9:86095301-86095323 TGTCTGTAACCTCTGCCTCCTGG + Intronic
1056452105 9:86726267-86726289 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1056507421 9:87270415-87270437 TGTGTCTGAGATCTCCCTTCGGG - Intergenic
1056523198 9:87419043-87419065 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1056627993 9:88269868-88269890 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1056637125 9:88340313-88340335 TGACTGCAACCTCTGCCTTCCGG - Intergenic
1056639463 9:88358131-88358153 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1056819183 9:89825049-89825071 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1057058217 9:91980314-91980336 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1057150745 9:92793977-92793999 TGTCTGCAACCTCTGCCTCCTGG + Intergenic
1057201942 9:93145513-93145535 TCACTGTAAGCTCCGCCTTCCGG + Intergenic
1057356652 9:94337294-94337316 TCTCTGCAAGCTCTGCCTCCCGG - Intergenic
1057427720 9:94967145-94967167 TGTGTGTAAGCCATGCCTTTAGG + Intronic
1057532686 9:95866093-95866115 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1057591187 9:96374761-96374783 TCACTGTAAGCTCTGCCTTCCGG - Intronic
1057594848 9:96406925-96406947 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1057651101 9:96920339-96920361 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
1057777430 9:98022262-98022284 TCTCTGCAACCTCTGCCTTCTGG + Intergenic
1057884134 9:98816897-98816919 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1058048341 9:100381061-100381083 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1058303379 9:103405918-103405940 TCATTGCAAGCTCTGCCTTCCGG + Intergenic
1058586154 9:106508101-106508123 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1059367505 9:113798096-113798118 TGACTGCAATCTCTGCCTTCTGG + Intergenic
1059498901 9:114733751-114733773 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1059609944 9:115881915-115881937 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1060280989 9:122215596-122215618 TGTGGGAAAGCTCTGACTCCTGG + Intronic
1060292735 9:122319223-122319245 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
1060382149 9:123185955-123185977 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1060467281 9:123918037-123918059 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1060565555 9:124588380-124588402 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1060601855 9:124883520-124883542 TCACTGTAACCTCTGCCTTCTGG + Intronic
1060699830 9:125741036-125741058 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1060708494 9:125832268-125832290 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1060725002 9:126000745-126000767 TCTGTGTAAGCTTTGACTTGTGG + Intergenic
1060853217 9:126894778-126894800 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
1061031550 9:128087138-128087160 TCACTGTAACCTCTGCCTTCCGG - Intronic
1061136826 9:128739425-128739447 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1061172121 9:128964778-128964800 TAAGTGTAATCTCTGCCTCCCGG + Intronic
1061356452 9:130109243-130109265 TCTCTGTAGCCTCTGCCTTCTGG + Intronic
1061411451 9:130424251-130424273 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1061417782 9:130456849-130456871 TCACTGTAACCTCTGCCTTCCGG - Intronic
1061490542 9:130941592-130941614 TGTGGGTCAGCACTGGCTTCTGG - Intergenic
1061548882 9:131320858-131320880 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1061564764 9:131431203-131431225 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1061752410 9:132789218-132789240 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1061821090 9:133227581-133227603 AGTCTGTAAGCCCTGCCTGCTGG + Intergenic
1061853994 9:133431727-133431749 TCACTGCAAGCTCTGCCTTCAGG + Intronic
1062453294 9:136624472-136624494 TGTGTGGTGGCTGTGCCTTCAGG + Intergenic
1202796530 9_KI270719v1_random:125098-125120 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1203737362 Un_GL000216v2:149403-149425 TTTGTATAAGCTCTGCCTACAGG - Intergenic
1203737576 Un_GL000216v2:151316-151338 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1203739372 Un_GL000216v2:165420-165442 GTTGTATAAGCTCTGCCTACCGG + Intergenic
1203739609 Un_GL000216v2:167664-167686 CTTGTGTAGGCTCTGCCTACAGG + Intergenic
1203739862 Un_GL000216v2:169981-170003 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1203740495 Un_GL000216v2:173245-173267 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1203740606 Un_GL000216v2:174196-174218 CTTGTGTAGGCTCTGCATTCAGG - Intergenic
1203740946 Un_GL000216v2:176474-176496 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1185473727 X:400643-400665 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1185660610 X:1725947-1725969 TCTTTGCAACCTCTGCCTTCCGG + Intergenic
1186038534 X:5450692-5450714 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1186104739 X:6193332-6193354 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1186153771 X:6704376-6704398 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1186411819 X:9350574-9350596 TGTGGCTACTCTCTGCCTTCTGG - Intergenic
1186439186 X:9570750-9570772 TCACTGCAAGCTCTGCCTTCTGG + Intronic
1186673082 X:11787068-11787090 TGTGTGTACCCTTTGTCTTCTGG + Intergenic
1187148142 X:16656482-16656504 TCACTGCAAGCTCTGCCTTCCGG + Intronic
1187425399 X:19173706-19173728 TCAGTGCAAGCTCTGCCTCCGGG + Intergenic
1187831266 X:23384008-23384030 TGTGTGCAAGCTCTCCTTACAGG + Intronic
1187934152 X:24319603-24319625 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1188030030 X:25253893-25253915 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1188364191 X:29294451-29294473 TTAGTGCAAGCTCTGCCTCCCGG - Intronic
1188647312 X:32585623-32585645 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1188980508 X:36722547-36722569 AGTGTGTAATCTGTGCATTCGGG - Intergenic
1189271363 X:39754631-39754653 TCACTGTAACCTCTGCCTTCTGG - Intergenic
1189343947 X:40226261-40226283 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1189449349 X:41113273-41113295 TCTCTGCAAGCTCTGCCTCCTGG + Intronic
1189781879 X:44522305-44522327 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1189922733 X:45918876-45918898 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1190105214 X:47555740-47555762 TCAGTGCAAGCTCTGCCTCCCGG - Intergenic
1190547427 X:51543638-51543660 TCAGTGCAACCTCTGCCTTCTGG + Intergenic
1190816072 X:53930888-53930910 TGTGTGTTAGCTTTGTCTCCAGG - Intergenic
1190951836 X:55153427-55153449 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1190972903 X:55369357-55369379 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1191684549 X:63876579-63876601 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1191693184 X:63961646-63961668 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1192603153 X:72486045-72486067 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1192986573 X:76406156-76406178 TGCGTGTAAGCTTTGCCAACAGG - Intergenic
1193051668 X:77107425-77107447 TTTCTGTAACCTCTGCCTCCTGG - Intergenic
1194349692 X:92810473-92810495 TTACTGTAAGCTCTGCCTCCCGG - Intergenic
1194527219 X:94991374-94991396 TCACTGAAAGCTCTGCCTTCTGG - Intergenic
1194555177 X:95349634-95349656 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1194698852 X:97089800-97089822 TCAGTGCAAGCTCTGCCTCCTGG + Intronic
1194848850 X:98847485-98847507 TCACTGTAATCTCTGCCTTCTGG + Intergenic
1194868199 X:99095848-99095870 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1195088059 X:101431616-101431638 TCCCTGCAAGCTCTGCCTTCCGG + Intronic
1195317535 X:103693541-103693563 TGTGTGTGATCTTTGCCTTCAGG - Intergenic
1195421514 X:104680240-104680262 TGGGTCTTAGCTCTGCCTCCTGG + Intronic
1195534697 X:105997966-105997988 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1195855413 X:109326691-109326713 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1195950954 X:110272139-110272161 TCACTGCAAGCTCTGCCTTCTGG - Intronic
1196081511 X:111637734-111637756 TCTGTGGTAGCTTTGCCTTCGGG + Intergenic
1196085537 X:111679667-111679689 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1196122394 X:112064997-112065019 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1196359964 X:114841664-114841686 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1196394967 X:115249632-115249654 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
1196601641 X:117607304-117607326 TCACTGCAAGCTCTGCCTTCCGG - Intergenic
1196705121 X:118710878-118710900 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1196718938 X:118835973-118835995 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1197225837 X:123955623-123955645 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1197625151 X:128793661-128793683 TCACTGCAAGCTCTGCCTTCAGG - Intergenic
1198125948 X:133643900-133643922 TCAGTGCAACCTCTGCCTTCCGG + Intronic
1198206706 X:134472639-134472661 TCAGTGCAACCTCTGCCTTCTGG + Intronic
1198242382 X:134798436-134798458 TGTGTGGAAGGTGTGCCCTCTGG + Intronic
1198708879 X:139479398-139479420 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1199152442 X:144503639-144503661 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1199676449 X:150193889-150193911 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1200470063 Y:3575817-3575839 TCAGTGCAAGCTCTGCCTCCCGG + Intergenic
1200658014 Y:5927076-5927098 TTACTGTAAGCTCTGCCTCCCGG - Intergenic
1200701641 Y:6407531-6407553 TCACTGCAAGCTCTGCCTTCTGG - Intergenic
1200783615 Y:7239112-7239134 TAACTGTAAGCTCTGCCTCCTGG + Intergenic
1200844206 Y:7814790-7814812 TGTTTCTGAGCTTTGCCTTCTGG - Intergenic
1200876169 Y:8156907-8156929 TCTCTGCAAGCTCTGCCTCCTGG + Intergenic
1201032470 Y:9757167-9757189 TCACTGCAAGCTCTGCCTTCTGG + Intergenic
1201124896 Y:10903911-10903933 CGTGTCTAGGCTCTGCCTACAGG + Intergenic
1201124940 Y:10904253-10904275 TTTGTCTAGGCTCTGCCTACAGG + Intergenic
1201125561 Y:10910835-10910857 TTTGTCTAGGCTCTGCCTACGGG - Intergenic
1201125700 Y:10912132-10912154 CTTGTGTAGGCTCTGCCTACTGG - Intergenic
1201125832 Y:10913289-10913311 TTTGTCTAGGCTCTGCCTACGGG - Intergenic
1201125989 Y:10914779-10914801 CTTGTGTAGGCTCTGCCTACAGG + Intergenic
1201126132 Y:10916133-10916155 ATTGTCTAAGCTCTGCCTACAGG + Intergenic
1201176153 Y:11309359-11309381 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1201176187 Y:11309632-11309654 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1201176487 Y:11312503-11312525 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1201176544 Y:11312978-11313000 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1201177411 Y:11317437-11317459 CTTGTCTAAGCTCTGCCTACAGG - Intergenic
1201178666 Y:11325437-11325459 TTTGTCTAGGCTCTGCCTACTGG - Intergenic
1201178795 Y:11326599-11326621 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1201179076 Y:11329197-11329219 GTTGTATAAGCTCTGCCTACAGG - Intergenic
1201179165 Y:11329943-11329965 CTTGTGTAGGCTCTGCCTACAGG - Intergenic
1201347304 Y:12999370-12999392 TCACTGCAAGCTCTGCCTTCCGG + Intergenic
1201372082 Y:13276645-13276667 TCACTGCAAGCTCTGCCTTCCGG - Intronic
1201426090 Y:13852154-13852176 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1201621246 Y:15961006-15961028 TCTCTGCAATCTCTGCCTTCTGG + Intergenic
1201650334 Y:16277567-16277589 TCACTGAAAGCTCTGCCTTCTGG - Intergenic
1201736972 Y:17277763-17277785 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1202104060 Y:21343196-21343218 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
1202202190 Y:22365216-22365238 TAACTGTAAGCTCTGCCTCCTGG - Intronic
1202624028 Y:56839251-56839273 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1202624336 Y:56842118-56842140 TTTGTCTAGGCTCTGCCTACGGG + Intergenic
1202624555 Y:56844024-56844046 CTTGTCTAAGCTCTGCCTACAGG + Intergenic
1202624882 Y:56847112-56847134 TTTGTCTCAGCTCTGCCTACAGG + Intergenic
1202625028 Y:56848337-56848359 TTTGTCTAGGCTCTGCCTACGGG + Intergenic
1202625233 Y:56850458-56850480 CTTGTGTAGGCTCTGCCTACAGG + Intergenic
1202625315 Y:56851136-56851158 GTTGTATAAGCTCTGCCTACAGG + Intergenic