ID: 1100959296

View in Genome Browser
Species Human (GRCh38)
Location 12:99944820-99944842
Sequence AGGGATTGCTAGGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100959296 Original CRISPR AGGGATTGCTAGGGAAAAAC TGG Intronic
901340958 1:8498829-8498851 AGGAATTGCTTGTGAAGAACAGG + Intronic
902186523 1:14729517-14729539 AGGGAATGCAAGGGAAGAGCAGG + Intronic
903169481 1:21543297-21543319 AGGGAGTGTTGGGGAAAAAAAGG - Intronic
903452378 1:23463014-23463036 AGGGAATGCTTGGTAAAAAATGG + Intronic
904635021 1:31873280-31873302 TGGGATTGCTAGGGAAGGGCAGG + Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
908190423 1:61697742-61697764 AGTGCTTGCTGGGGAAAGACGGG - Intronic
910209979 1:84782857-84782879 AGGAATTGCAAGGGAAGAATTGG - Intergenic
910373220 1:86540835-86540857 AGGGAAGGCGAGGGGAAAACTGG + Intergenic
916369606 1:164075802-164075824 AGGGATATCTGGGGAAAACCTGG - Intergenic
918563429 1:185897295-185897317 AGGGATTGGGAGGGAAAGGCTGG - Intronic
920567063 1:206982443-206982465 GGGGAATGCAAGGGAACAACAGG + Intergenic
922648908 1:227319255-227319277 AACCATGGCTAGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1064964868 10:21004948-21004970 AGGCATTTCTATGGAGAAACTGG + Intronic
1065016518 10:21467562-21467584 AGGGCTTTGTAGGGAAAAACAGG - Intergenic
1065225273 10:23537282-23537304 AGGGAGTGGAAGGGAGAAACAGG - Intergenic
1065586394 10:27222188-27222210 AGGGATGTCAAGGGAAAAAAAGG + Intronic
1065652266 10:27904706-27904728 CGGAATAGCCAGGGAAAAACTGG - Intronic
1067199434 10:44154533-44154555 AGGGCCTGCTGGGGAAAGACTGG - Intergenic
1068488461 10:57690578-57690600 AGGGATTATCAGGGAAATACAGG - Intergenic
1069737262 10:70665021-70665043 AGGGAATGCTGGGGAAACAAAGG + Intergenic
1070351356 10:75594889-75594911 AGGCATGGATAGGAAAAAACAGG - Intronic
1071284999 10:84136430-84136452 AGGGATTCCAAGGGAAAACAAGG + Intergenic
1074291296 10:112139780-112139802 AGGGAAGGCCAGGGAAAAGCAGG + Intergenic
1078531875 11:12142890-12142912 AGGGAGGGCTGGGGAAAAATAGG + Intronic
1079270589 11:18982213-18982235 AGAGATAGGTAGGGAAAGACAGG + Intergenic
1080218731 11:29875861-29875883 AGGGAGTTCTAGGGGAACACTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083391829 11:62357049-62357071 AGAGATTCCTGGAGAAAAACTGG + Exonic
1083991191 11:66246728-66246750 TGGGATTGTGAGGAAAAAACTGG - Intergenic
1085818211 11:79763943-79763965 CTGGATTGCAAGGGAAAAAATGG + Intergenic
1088427163 11:109716421-109716443 AGGGCCTGCTAAGGAAAAAGTGG + Intergenic
1088687467 11:112297197-112297219 AGGGTCTGCTGGGAAAAAACAGG - Intergenic
1088998323 11:115024885-115024907 AGTGATTCATAAGGAAAAACAGG + Intergenic
1089254930 11:117189154-117189176 AGGTATTGCTGGGGAGAAGCTGG - Exonic
1089432529 11:118436184-118436206 AGGCATTGCTCGGGAAAAGGAGG - Intergenic
1089807812 11:121107072-121107094 AGTGTTTGCTAGGGAACAACAGG - Intronic
1090623888 11:128588011-128588033 AGGGATTGCTTTAGAAACACAGG + Intergenic
1091157008 11:133383283-133383305 AGGGATTGATAGGAAGGAACTGG - Intronic
1091215005 11:133895620-133895642 AGGTATTGCTAGGGAACCAGGGG + Intergenic
1091551759 12:1540589-1540611 AGGAAATTCTAGGCAAAAACTGG + Intronic
1091556859 12:1580556-1580578 AGGGATTACTAGAGAAGAATAGG - Intronic
1092196082 12:6550548-6550570 AGGGGTGGCTAGGGGAAAAAGGG + Intronic
1093459904 12:19398460-19398482 AGGGAGTTCAAGGGAAACACAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1098378042 12:69838122-69838144 AGGCATTGCTGGGGAAGGACAGG + Intronic
1099974457 12:89532148-89532170 AGGGATTACTAATGAAAAAATGG + Intergenic
1100959296 12:99944820-99944842 AGGGATTGCTAGGGAAAAACTGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102450458 12:113038066-113038088 AGGGATGGCCAGGGAAAAGAAGG + Intergenic
1103428969 12:120865086-120865108 AGGGATTTCCAGGGAAATAGGGG + Intronic
1104039388 12:125119909-125119931 AGGGACGGCTAGGAACAAACAGG - Intronic
1105499464 13:20958890-20958912 AGTGATTGTTAAAGAAAAACAGG + Intergenic
1106519717 13:30486095-30486117 AGGTATTGTTAAGGAAAACCAGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107627481 13:42304718-42304740 AGAGATAGCTACTGAAAAACAGG - Intronic
1108070512 13:46624184-46624206 AGGTATTGCAAGTTAAAAACAGG - Intronic
1108273597 13:48786538-48786560 AGGCATTGTTTGGGAAAGACTGG - Intergenic
1110866096 13:80398051-80398073 AGGGACAGATAGGGACAAACAGG + Intergenic
1111121209 13:83852732-83852754 TGAGATTGCTAATGAAAAACTGG - Intergenic
1112792562 13:103018954-103018976 AGTGATTGCGAGAGAAAAAGAGG - Intergenic
1113334093 13:109361606-109361628 AGGAATTGGTAGGAAAAAAAAGG + Intergenic
1114036970 14:18638343-18638365 AGGGATTGCCAGTGAAATTCTGG + Intergenic
1114121670 14:19676701-19676723 AGGGATTGCCAGTGAAATTCTGG - Intergenic
1115775437 14:36709738-36709760 GGGGATAGCTGGGCAAAAACAGG + Intronic
1116155665 14:41201713-41201735 ATGGATTAATAGGGAAAAATTGG + Intergenic
1119389666 14:74282430-74282452 AGGGATTGCAGGGGAGATACAGG + Intergenic
1120132206 14:80821442-80821464 AGGACTTGCTATGGAAAAAAGGG - Intronic
1120133162 14:80831274-80831296 AGGGGTTGAGCGGGAAAAACAGG - Exonic
1120452726 14:84689906-84689928 AGTGATTACTAGAGAAAAACAGG + Intergenic
1125489315 15:40135320-40135342 AGCTATTGCTAGTTAAAAACAGG + Intergenic
1126448389 15:48777274-48777296 AGGTATTAGTAGGGAAAAATGGG + Intronic
1127720678 15:61695722-61695744 AGAGATTACCAGGTAAAAACTGG + Intergenic
1127940556 15:63691126-63691148 AGGGATTGTTAGGGTTAACCGGG + Intronic
1128807713 15:70544878-70544900 AGTGATTGCTAGGGCATAAAAGG + Intergenic
1128978523 15:72169932-72169954 GTTGGTTGCTAGGGAAAAACAGG + Exonic
1130163794 15:81430955-81430977 TGTGATTGCTAATGAAAAACTGG + Intergenic
1130294714 15:82637496-82637518 TGGGGATGCTAGGGAAAGACAGG - Intronic
1134423447 16:14115969-14115991 ATGGATTGCTAAGGAACAAGAGG - Intronic
1135739011 16:24957364-24957386 GGGGATTTCTAGGGAAAAGGGGG + Intronic
1137403411 16:48171443-48171465 AGGCAATGCTAGGGGAAAACCGG + Intronic
1140518569 16:75562755-75562777 AGGCATTGCTAGGGCAATAGGGG - Intergenic
1144048192 17:11472098-11472120 AGTGGTTGCCAGGGGAAAACGGG - Intronic
1146293536 17:31630529-31630551 AGGCAATGCTAAGTAAAAACAGG - Intergenic
1147212245 17:38878442-38878464 TGGGATGGCTAGGGCAAGACAGG + Intronic
1147256466 17:39185004-39185026 AGGGATGGCCAGGGAGAACCAGG + Intronic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1147885700 17:43682996-43683018 AGAAATTGCTAGGGAAAGACTGG + Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150613471 17:66751698-66751720 AGGAGGTGCTAGGGAAAAGCTGG - Intronic
1151276280 17:73036899-73036921 AGGGATTTCCAGGGAATAGCGGG - Intronic
1151508702 17:74545155-74545177 AGGCAAGGCTAGGGAAACACTGG + Intronic
1151587669 17:75020408-75020430 AGGGATTTCTAGGGAAAGAAAGG - Intronic
1151751174 17:76038867-76038889 AGGGATGACTAAGGAAAAACGGG + Intronic
1154052541 18:10974701-10974723 AGGGATTGCAATGAAGAAACGGG - Intronic
1156773783 18:40762754-40762776 AGGAATTGTCAGGGAAAATCTGG - Intergenic
1158444708 18:57509493-57509515 AGGGATTGTTAGGGAAAAAGAGG - Intergenic
1158844553 18:61428167-61428189 AAGGATTACTTGGGAAACACAGG - Intronic
1160352398 18:78194777-78194799 AGGGACAGCTGGGGAAAGACTGG + Intergenic
1162559157 19:11406095-11406117 AGGGAATCCTAGGGAATAAGTGG - Intronic
1164503556 19:28839660-28839682 AGGGACTGCTAGAGAAAGAAAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168253114 19:55152132-55152154 AGGAAGTGCTGGGGAAAGACAGG - Intronic
1168438829 19:56345955-56345977 GGGGTTTGATAAGGAAAAACAGG + Intronic
926575691 2:14578040-14578062 AGGATTTGCTAGGGAGAAGCAGG - Intergenic
929148009 2:38723338-38723360 AGCGATTACTAGGGTGAAACTGG - Intronic
929200523 2:39230496-39230518 AGTGATTTCTATGGAAATACTGG + Intergenic
929240374 2:39647498-39647520 TGGGAGTGCTAGGAAAAATCTGG + Intergenic
930438277 2:51374685-51374707 ATGAATTGCTAGGAAAAAAAGGG + Intergenic
931563265 2:63587771-63587793 AGGCATTTCTAAGGAAAGACTGG - Intronic
931575671 2:63715863-63715885 AGTGAGGGCTAGGGAAATACAGG + Intronic
933277187 2:80296399-80296421 AGGTATTGCTAAAGAAAAAGTGG + Intronic
933933497 2:87179582-87179604 AAGGATTGATAGGGAAGAAGGGG - Intergenic
935178537 2:100670446-100670468 AGGGCTTTCTAGGGAAGCACAGG + Intergenic
936359616 2:111785863-111785885 AAGGATTGATAGGGAAGAAGGGG + Intronic
937050134 2:118881899-118881921 AGGGATTGCTAAGCAAGAAGAGG - Intergenic
937981370 2:127618026-127618048 AGAGAGAGCTAGGGAAAGACAGG - Intronic
938441546 2:131339184-131339206 AGGGATTGCCAGTGAAATTCTGG + Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
940525793 2:154811627-154811649 ATGAATTGATAGGGACAAACAGG - Intronic
941343448 2:164337042-164337064 AGGGGTTACTATGGAAAAAAAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942081151 2:172400653-172400675 GGGCACTGCTAGGGAGAAACAGG - Intergenic
942546598 2:177071169-177071191 AAGGATTACTAAGGAAAATCAGG + Intergenic
943935204 2:193906191-193906213 ACTGATGGCTAGGGAAAAATGGG - Intergenic
945095892 2:206218784-206218806 AGGTTTTACTAGGGAAACACTGG - Intergenic
946052032 2:216871114-216871136 AGGGATTGTTAGAGAAGTACTGG - Intronic
947003679 2:225486861-225486883 AGGGAATTCTAGGGAATAGCTGG - Intronic
947684190 2:232067858-232067880 AGGCATTACCAGGGAAAAAGAGG - Intronic
947880712 2:233508737-233508759 ATAGTTTGCAAGGGAAAAACAGG + Intronic
1168733578 20:109840-109862 AGTGATGCCTAGGAAAAAACAGG + Intergenic
1171087761 20:22253557-22253579 AGGCTTTGGTAGGGAAATACAGG - Intergenic
1171990125 20:31689578-31689600 AGGGAGTGGTAAGGAAAGACTGG - Intronic
1172356965 20:34287045-34287067 AGGGATGGCAAGGGAAGAGCTGG - Intronic
1172486445 20:35300890-35300912 AGGTATTGGGAGGGAAAAAGAGG - Intergenic
1174499953 20:50977076-50977098 AGAGGTTTCCAGGGAAAAACAGG + Intergenic
1177512797 21:22111940-22111962 AGGTTTTTCTAGGGATAAACTGG + Intergenic
1178603757 21:34017205-34017227 GGGGGTTGCTAGGAAAAAAAGGG + Intergenic
1180461094 22:15565391-15565413 AGGGATTGCCAGTGAAATTCTGG + Intergenic
1180749520 22:18114600-18114622 AGGGATGGCAAGTGAAAAGCAGG - Intronic
1181860980 22:25818010-25818032 TCGGGTTGCTAGGGAGAAACAGG - Intronic
1183257524 22:36771949-36771971 AGGGATTACTAGGGAGAGAGTGG - Intronic
949782043 3:7700758-7700780 ACGCATTGTTAGGGAAAAAAAGG + Intronic
951396990 3:22181102-22181124 AAGAATTGTTATGGAAAAACTGG - Intronic
953459819 3:43073284-43073306 AAGGATTCCTAGGGAACATCTGG + Intergenic
955486976 3:59444956-59444978 TAGGATTGCCAGAGAAAAACAGG + Intergenic
955922313 3:63970469-63970491 ACGGAATGATAGGGAAAAAGAGG - Intronic
956952288 3:74296395-74296417 AGGGATTGCAAGGGCAAGTCAGG - Intronic
957107442 3:75907749-75907771 AGGGATTGATAGAGAAATTCTGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
959463982 3:106662976-106662998 AGAGATGGATGGGGAAAAACTGG - Intergenic
959896481 3:111612387-111612409 TGTAATTGCTAGGGAAAAAATGG - Intronic
960348203 3:116561037-116561059 AAGGATTGCTAGGGAAAAAGAGG - Intronic
960440907 3:117687392-117687414 AGGGAATGAAAGGGAAAAAGAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962606041 3:137033799-137033821 AGGGTTTGTGAGGGAAGAACTGG - Intergenic
962641019 3:137386569-137386591 AGGAATTGTTAAGGAAAAAACGG - Intergenic
962840475 3:139227997-139228019 AGGGAGGGCAAGGGACAAACAGG - Intronic
966140613 3:176752289-176752311 AGGGAATGGAAGGGAAAAAGAGG + Intergenic
966234450 3:177685580-177685602 AGGGACTATGAGGGAAAAACAGG - Intergenic
967242897 3:187458482-187458504 AGGGAATTGCAGGGAAAAACAGG + Intergenic
967683876 3:192397275-192397297 AGGGATTGTCAGGGAAAGACAGG + Intronic
980520329 4:133924010-133924032 AGTTATTGCTATGTAAAAACAGG - Intergenic
981136875 4:141220751-141220773 AGGGAATGCGAGGGAAAATAGGG - Intergenic
986225446 5:5807586-5807608 AGGGATTCCCATGGAAACACAGG - Intergenic
987492350 5:18596923-18596945 AGGGATTGCTAGGTTATAATGGG - Intergenic
987692491 5:21284491-21284513 AGAGATAGGTAGGGAAAGACGGG - Intergenic
989441341 5:41475493-41475515 AGAGATAGGTAGGGAAAGACAGG - Intronic
991747864 5:69765562-69765584 AGAGATAGGTAGGGAAAGACGGG + Intergenic
991749865 5:69789761-69789783 AGAGATAGGTAGGGAAAGACGGG - Intergenic
991799442 5:70345420-70345442 AGAGATAGGTAGGGAAAGACGGG + Intergenic
991801439 5:70369569-70369591 AGAGATAGGTAGGGAAAGACGGG - Intergenic
991827158 5:70640451-70640473 AGAGATAGGTAGGGAAAGACGGG + Intergenic
991829155 5:70664618-70664640 AGAGATAGGTAGGGAAAGACGGG - Intergenic
991891800 5:71344839-71344861 AGAGATAGGTAGGGAAAGACGGG + Intergenic
996465632 5:123799347-123799369 ACTGATTGCTAGGAAACAACAGG + Intergenic
998800620 5:145865172-145865194 TGGGATTGCTATGAAAAAATTGG - Intronic
1001757618 5:174182661-174182683 AGGGATGGCTAGGGAGAAATAGG - Intronic
1001913610 5:175541305-175541327 AGGAAATGCTAGTGAAAGACAGG + Intergenic
1002376419 5:178792182-178792204 AGGGACAGCTAGGGACAAGCAGG + Intergenic
1002453783 5:179334062-179334084 AGGGATTGCTCCAGAGAAACTGG + Intronic
1004001285 6:11599517-11599539 AGGGTGTGCTATGGAAAGACAGG + Intergenic
1005604162 6:27459089-27459111 AGGGAAGGCTAGGGAAAGACTGG + Intronic
1007112235 6:39319541-39319563 AGGGATTGCTGGGGAACACAGGG + Intronic
1010896383 6:81370067-81370089 AGGAATGGATAGAGAAAAACAGG + Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1012371414 6:98511858-98511880 AGGGATTTCTGGGGAAAGAGTGG + Intergenic
1014826723 6:126055347-126055369 AGGGAGTGTTAGAGAAAACCAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017115229 6:150969556-150969578 TGGGCTTGCTAGGGAAAGAAGGG + Intronic
1017809523 6:157974828-157974850 AGGGCATGTCAGGGAAAAACTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031400699 7:121323462-121323484 AAGGATTGCTGGGGAAATGCTGG + Intergenic
1032752928 7:134860005-134860027 GGGGAAGGCAAGGGAAAAACAGG + Intronic
1032920559 7:136541138-136541160 AGGGCTTGGTAGGGAAAAGATGG - Intergenic
1033054399 7:138036297-138036319 AGGGATGTTTAGGAAAAAACAGG + Intronic
1033322151 7:140349605-140349627 AGTGATACCTAGGGAATAACTGG - Intronic
1034369565 7:150583271-150583293 AGAGATAGGTAGGGAAAGACAGG + Intergenic
1034504030 7:151471743-151471765 ATGGATTGCTAGGAAAAAACAGG - Intronic
1034920149 7:155072866-155072888 AGGTGTAGCTAGGGAAAAAGGGG + Intronic
1035586829 8:782693-782715 AGGGATGAGTAGAGAAAAACAGG - Intergenic
1036141665 8:6214823-6214845 AGGGATTTATTAGGAAAAACTGG - Intergenic
1036279628 8:7389637-7389659 AGGGAGTGCTTGTGAAGAACAGG + Intergenic
1038041491 8:23727305-23727327 AGTGAGTGCTAGAGGAAAACAGG - Intergenic
1039786171 8:40836023-40836045 AGAGATTTGTAGGGAGAAACTGG - Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1042260511 8:66854649-66854671 AGGGATTACTATGAAAATACAGG + Intronic
1043109967 8:76168796-76168818 AGGGATGCCAAGGGACAAACAGG + Intergenic
1045525250 8:102935958-102935980 AGGTTTTACTTGGGAAAAACAGG + Intronic
1046971728 8:120230545-120230567 CGGGATTGCAAGAGAAAAACGGG - Intronic
1047783115 8:128125882-128125904 AGGGATTACATGGGAAAAAGAGG + Intergenic
1052553041 9:29976464-29976486 AGGGAATACTAGGGAAAAAGAGG - Intergenic
1052907675 9:33850793-33850815 AGGGGTTGCTAGTGAATAATGGG - Intronic
1053152532 9:35752089-35752111 AGGGATTGGGAGGGAGAAGCTGG - Exonic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1061109366 9:128557160-128557182 AGGGATTTTTAGGGACTAACAGG - Intronic
1061222235 9:129258806-129258828 AGGAATTGCTACGGAAAGAGAGG + Intergenic
1185611115 X:1394244-1394266 AGGGAATGATGGAGAAAAACAGG - Intergenic
1189303683 X:39970935-39970957 AGGCATTACTAGGGAAAAGAGGG - Intergenic
1190326665 X:49210786-49210808 AGAGCTTGCCAGGGAAGAACTGG + Intronic
1190580765 X:51891924-51891946 AGGAAGTGCTGAGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193764717 X:85513256-85513278 AGCAATTACTAGGGAAAAGCTGG - Intergenic
1194341886 X:92715751-92715773 AGTCATTTCTAGGGAAAAAGAGG - Intergenic
1194902486 X:99530235-99530257 AAGGATAGCTAGCGAATAACGGG + Intergenic
1196091276 X:111746322-111746344 AGGGAGAGCACGGGAAAAACTGG - Intronic
1197276912 X:124490028-124490050 AGGGACTGCTAGCTGAAAACAGG - Intronic
1197305604 X:124837387-124837409 AGGGAATGATAGAGAAAAAAAGG - Intronic
1197899576 X:131355714-131355736 GGGGATTGGAAGGGAAAAGCAGG - Intronic
1200166048 X:154036139-154036161 GGGGAGTGCAAGAGAAAAACAGG + Intronic
1200572079 Y:4844101-4844123 AGGCATTTCTAGGCATAAACTGG + Intergenic
1200650230 Y:5832444-5832466 AGTCATTTCTAGGGAAAAAGAGG - Intergenic
1200798592 Y:7364198-7364220 AGGGATTGATGGGGAAAGTCAGG - Intergenic