ID: 1100959685

View in Genome Browser
Species Human (GRCh38)
Location 12:99948550-99948572
Sequence TTGAATTCCCAATATGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100959685_1100959687 14 Left 1100959685 12:99948550-99948572 CCTTGCACATATTGGGAATTCAA 0: 1
1: 0
2: 8
3: 48
4: 531
Right 1100959687 12:99948587-99948609 CCATCTGATTGAGAATTCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 148
1100959685_1100959688 18 Left 1100959685 12:99948550-99948572 CCTTGCACATATTGGGAATTCAA 0: 1
1: 0
2: 8
3: 48
4: 531
Right 1100959688 12:99948591-99948613 CTGATTGAGAATTCAGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100959685 Original CRISPR TTGAATTCCCAATATGTGCA AGG (reversed) Intronic
902988155 1:20168301-20168323 TTGAGTTCCCAACATGTGTCTGG + Intronic
903029739 1:20455182-20455204 TGGAACTCCCATTATGTGCCAGG + Intergenic
903481345 1:23655693-23655715 TTGAATACTCAATATGTGTCAGG + Intergenic
903577574 1:24348216-24348238 TTGAAGGCCCACTATGTGCCAGG + Intronic
904665680 1:32119467-32119489 TTAAGTGCCCACTATGTGCAAGG + Intronic
904780041 1:32939560-32939582 TTGATTTCCTATTATGTGCAAGG - Intronic
905241726 1:36585963-36585985 TTGAGTGCCCACTATGTGCCAGG + Intergenic
905290066 1:36915375-36915397 TTGAATGCCAATTATGTGCCAGG - Intronic
905782103 1:40720931-40720953 TTGAATCCCCACTATGTGCAAGG + Intronic
905833754 1:41098393-41098415 TTGAATGCTTAATATGTGCCAGG + Intronic
905876788 1:41436597-41436619 TTGAATTCCCAAACTTTGCAGGG + Intergenic
905996706 1:42387587-42387609 TTGAATGCCCACTCTGTGCCAGG + Intronic
906181989 1:43829612-43829634 TGCAATTCCCAATATGTGCCAGG + Intronic
906272322 1:44489513-44489535 TTGAGTTCCCACTATGTGCCAGG + Intronic
906304111 1:44705550-44705572 TTGAATACCTAATATGTACCAGG - Intronic
907337403 1:53709240-53709262 TTAAGATCCCAATATGTGCGAGG - Intronic
907679115 1:56547268-56547290 TTGAACTCCCACTATGTGCCAGG - Intronic
907803113 1:57791223-57791245 TTGAATTCCCACTATGCCCTAGG + Intronic
909274020 1:73661822-73661844 TTGAATTCCTGCTATGTGCCAGG - Intergenic
910072615 1:83237249-83237271 TTGAGTACCTACTATGTGCAAGG + Intergenic
910591698 1:88933320-88933342 TTGAACTCCTACTATGTGCCAGG - Intergenic
910672902 1:89790935-89790957 CTGAATGCCCGTTATGTGCAGGG + Intronic
910789608 1:91037552-91037574 TTGAATTCCCCCTGTGTGCCTGG + Intergenic
911707311 1:101028202-101028224 TTTAATACCTATTATGTGCAAGG - Intergenic
912216895 1:107624797-107624819 TTGACTTCCTAATATGCACAAGG + Intronic
912349202 1:108995881-108995903 TTGCATTCCTAATATATACAAGG + Intronic
912882508 1:113430284-113430306 TTGAATACCTAGTATGTGCCAGG - Intronic
912985590 1:114426103-114426125 TTGAATTGCCAAAATATGCAAGG + Intronic
913359905 1:117968901-117968923 TTGAGTACCCACTATGTGCCTGG + Intronic
914402832 1:147339540-147339562 TTGAGTACCTACTATGTGCATGG - Intergenic
914972889 1:152327171-152327193 TTGTATACCCATTATGTGCTAGG + Intergenic
915821842 1:159032042-159032064 TTGATTTCCCATAATGTACAAGG - Intronic
915825377 1:159070301-159070323 TTGAATTGCTAATAGGTACAAGG - Intronic
916392286 1:164343488-164343510 TGGTATTCCCAATTTGTGGAAGG + Intergenic
916608705 1:166368578-166368600 TTGAATCCCCACTAGGTACAAGG + Intergenic
916752405 1:167734956-167734978 CTGAATTCCCAACGTCTGCAGGG - Intronic
917018846 1:170564048-170564070 TTGAATGCCTATTGTGTGCAGGG - Intergenic
917049823 1:170908438-170908460 TTGAAACCTCAGTATGTGCAAGG - Intergenic
917253443 1:173088343-173088365 ATGCTTTCCCACTATGTGCAAGG + Intergenic
919045394 1:192445193-192445215 TTAGATTCCCATTATGTGCCAGG + Intergenic
919113632 1:193252826-193252848 CTGAATGCCTACTATGTGCAAGG - Exonic
919253264 1:195086969-195086991 TTGAGTTCCAAATATGTGAAAGG + Intergenic
919419208 1:197350366-197350388 TTGAGTGCTTAATATGTGCAAGG - Intronic
919448641 1:197742942-197742964 TTGAATTCCTCACATGTCCATGG - Intronic
919679584 1:200420939-200420961 TTGAATTTTCATTATGTGCTAGG - Intergenic
920459588 1:206128965-206128987 TTGAGTACCCATTATGTGCCAGG - Intergenic
921114919 1:212080968-212080990 TTGAACACCCAGTATGTGCTGGG + Intronic
921469517 1:215531967-215531989 TTGAATTCCTCCTATGTGCCAGG + Intergenic
922034069 1:221831319-221831341 TTGAGTTCCTAATGTGTGCCAGG + Intergenic
922126543 1:222731289-222731311 TTGAGTGCCTAATATGTTCAAGG - Intronic
922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG + Intergenic
923117433 1:230956014-230956036 TTGCATTCTTAATATGTGCCAGG + Intronic
923330669 1:232921152-232921174 TTGAATACCTACTATGTGCTGGG - Intergenic
923637319 1:235712519-235712541 TTGAATACCCATTATGTGCAAGG - Intronic
923643007 1:235784712-235784734 TTGAGCTCTCAATATGTGCCAGG - Intronic
924273568 1:242360993-242361015 TTGAATGCCCACTATGTACCTGG - Intronic
924566231 1:245200776-245200798 TTGAATTTCAAATATAGGCAGGG + Intronic
924655663 1:245972975-245972997 TTGAGTACCCAATTTGTGCCAGG - Intronic
1063060648 10:2547926-2547948 TTGAATACCAACTATGTGCTAGG - Intergenic
1064044782 10:12003117-12003139 TTGAATTCCTACTATGTGCTAGG + Intronic
1064264301 10:13812493-13812515 TTGAATGCCTACTATGTACAGGG + Intronic
1064505261 10:16022422-16022444 TTGAATTCCTTTTATGTACAAGG - Intergenic
1064862046 10:19836904-19836926 CTGAGTACCTAATATGTGCAAGG - Intronic
1065111950 10:22449032-22449054 TTGCATGCCCAATATATGCCAGG + Intronic
1065246659 10:23765564-23765586 TTGTAATCCCTATATGTGGAGGG + Intronic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1066618327 10:37318826-37318848 TTGAATTTACACTATGTGCCTGG - Intronic
1067905488 10:50286808-50286830 TTAAATTCTCAAGATGTTCAGGG - Intergenic
1068574807 10:58673358-58673380 TTGAATTCCTACCATGTGCAAGG + Intronic
1069045159 10:63735624-63735646 TTGAATTCCTTCTATGTGAAAGG + Intergenic
1069745351 10:70711586-70711608 TTGAGTACCCACTATGTGCCAGG - Intronic
1070954883 10:80457160-80457182 TTGAAGTCTCAATATGAGCTGGG + Intronic
1071539299 10:86465996-86466018 TGGAATCACCAATATGTGAATGG + Intronic
1071777659 10:88807109-88807131 TTGAGTTCCTACTATGTGCTGGG + Intronic
1071849153 10:89550972-89550994 TTGAATTCCTAATATATGCCAGG - Intronic
1071940978 10:90591675-90591697 TTGAGTACCCAGTATGTGCTAGG + Intergenic
1071984076 10:91033315-91033337 TTGACTGCCCACTATGTGCCAGG + Intergenic
1072460685 10:95615954-95615976 TTGAGTACCTACTATGTGCAAGG - Intronic
1073264890 10:102221040-102221062 TTGAGTGCCCACTATGTGCCAGG + Intergenic
1073489704 10:103844830-103844852 TTGAATTCCCATTTTGTGCCAGG - Intronic
1073637887 10:105218388-105218410 TTGAAGTCTTAAAATGTGCAAGG + Intronic
1073937541 10:108651684-108651706 TTGAGGTCCCACTATGTGCAGGG - Intergenic
1074336051 10:112576740-112576762 TTGAGTGCCAAATATGTACAGGG + Intronic
1074344246 10:112666542-112666564 TTGAATCCCCACTGTGTGCCAGG - Intronic
1074365701 10:112855811-112855833 TTGATTTCCTACTATGTGCCAGG - Intergenic
1074638444 10:115348651-115348673 TTGAATGCCTAATAAATGCAAGG + Intronic
1074946322 10:118284157-118284179 CTGAATACCTACTATGTGCAAGG - Intergenic
1076125110 10:127967922-127967944 TTGAATACCTACTATGTGCAAGG + Intronic
1077392890 11:2308174-2308196 ATGAATTCCCAAAAAGCGCAGGG + Intronic
1078806717 11:14713049-14713071 TTGAATACCAATTATGTGTAAGG + Intronic
1079258064 11:18849820-18849842 TTGAACACCTAATATGTGCCAGG - Intergenic
1079909991 11:26298016-26298038 CTGAAATCCCAACATGTTCAAGG - Intergenic
1080281072 11:30557149-30557171 TTGAATTCCTGCTATGTGCCAGG - Intronic
1081796843 11:45826300-45826322 TTGAGTGCCTAATATGTGCTGGG + Intergenic
1084059565 11:66661571-66661593 TTGAATTCCTACTATGAGCTAGG - Intronic
1084114560 11:67034527-67034549 TTGAATGCCTACTATGTGCTAGG - Intronic
1085137188 11:74102310-74102332 TTGAATACCCAGTATGTGCCAGG + Intronic
1085325319 11:75602029-75602051 TTGAATACCTATTATGTGCCAGG - Intronic
1085502421 11:77036168-77036190 TTGCATTCCCCAAATGTGCCAGG + Intronic
1085817220 11:79752080-79752102 TTGTATTCCCCATGTGTCCAGGG + Intergenic
1086101399 11:83103636-83103658 TTGAGTGCCTAATATGTGCCAGG + Intergenic
1086130153 11:83392981-83393003 TTGAAATCCCAATGTTTCCATGG + Intergenic
1086204258 11:84239124-84239146 TTGAAATCCCACTACATGCATGG + Intronic
1086327146 11:85713737-85713759 TTGAGTACCTAATATGTGCCAGG - Intronic
1086539934 11:87896843-87896865 TTGAGTGCCTAATATGTGCTGGG - Intergenic
1086772716 11:90789378-90789400 TTGAATTTCCCTTATGTGTATGG + Intergenic
1087117050 11:94536655-94536677 TTGAATGCCAATTATGTGCCAGG - Intergenic
1087281799 11:96219169-96219191 TTGAGTGCCCAGTATGTGAAGGG - Intronic
1087758883 11:102084657-102084679 TTGAATACCAATTCTGTGCAAGG + Intergenic
1088155232 11:106794841-106794863 TTGAATGCCTAATATGTGCTAGG - Intronic
1088262379 11:107956297-107956319 CTGAATGCCCACTATGTGCTAGG + Intronic
1088838716 11:113603881-113603903 TTGAATTCCTACTATGTGCCAGG - Intergenic
1088851184 11:113704822-113704844 CTGAATTCCCACTTTGTGCCAGG - Intronic
1089130746 11:116209994-116210016 TTGGATTCCCAATCTGTACAGGG - Intergenic
1089321721 11:117631001-117631023 TTGAGTGCCCACTATGTGCCAGG - Intronic
1090520422 11:127473530-127473552 TTAAATTCCCATTATCTGTATGG - Intergenic
1090529955 11:127580228-127580250 TTGAATTATCACTATGTGCCAGG - Intergenic
1090644170 11:128754071-128754093 TTGAAAAGCCAATATGGGCAAGG - Intronic
1091392491 12:134208-134230 TTGAAGGCCCACTATGTGCTGGG + Intronic
1091435457 12:469328-469350 TTGAGATCCTAATATGTGCTCGG - Intronic
1092837947 12:12509710-12509732 TTGAATTCTAATTATGTGCCAGG - Intronic
1095408239 12:41891665-41891687 TTGAATGCCAAATATGTACCAGG - Intergenic
1095751401 12:45716075-45716097 TTGTATTCCAAAAATGTGAAAGG - Intergenic
1096402148 12:51316193-51316215 TTAAATGCCCAATATGGGCTAGG + Intronic
1096817944 12:54213459-54213481 TTGGATTCCCAGTATGTACTAGG + Intergenic
1097400481 12:59122487-59122509 TTGACTACCCATTATGTGCAAGG - Intergenic
1097526516 12:60743730-60743752 TTGAAAGCCCATTATGTTCAAGG - Intergenic
1097722439 12:63037615-63037637 TTGAGTGCCTAATATGTGCCAGG - Intergenic
1098140435 12:67445163-67445185 TTGAGTTCCTAATAGGTGCTAGG + Intergenic
1098340622 12:69447078-69447100 CTGAATGCCCAATAGTTGCAGGG + Intergenic
1099237880 12:80103671-80103693 TTGAATGCCAACTATGTGCAAGG - Intergenic
1100009135 12:89932968-89932990 TTTAATTCCTACTATGTGTAAGG - Intergenic
1100959685 12:99948550-99948572 TTGAATTCCCAATATGTGCAAGG - Intronic
1101485551 12:105155088-105155110 TTGAATTCCTACTATTTGCCAGG + Intronic
1101627687 12:106461641-106461663 CTGAATACCCACTATGTGCCAGG - Intronic
1103144139 12:118579629-118579651 TTGAATGCCCAATTTGTGCTAGG + Intergenic
1104816390 12:131648396-131648418 TTGCACTTCCACTATGTGCAAGG + Intergenic
1105065515 12:133193968-133193990 TTGAATTTCCTTTCTGTGCAGGG + Intronic
1105784107 13:23731061-23731083 TTGAATTCTTAATATATGCTAGG - Intronic
1106300914 13:28464531-28464553 TGGATTTCCTAATATGTGCAAGG + Intronic
1106675603 13:31954777-31954799 TTGAACTCCCAGGATGTTCAAGG - Intergenic
1106683621 13:32033662-32033684 TTGAATACCTACTATGTGCCAGG + Intronic
1107295047 13:38899364-38899386 CTGGTTTCCCAATATCTGCATGG + Intergenic
1107631671 13:42349386-42349408 ATGAATTCATAATATGTACAGGG + Intergenic
1108564173 13:51678319-51678341 TTGAGTTCCCAATTTGTAAAAGG - Intronic
1108940117 13:55942368-55942390 TTTATTTAACAATATGTGCATGG + Intergenic
1109204006 13:59461673-59461695 TTGAGTTCCTATTATGTTCAAGG - Intergenic
1110101500 13:71611851-71611873 TAAAATTCCCAAGATGTGCATGG + Intronic
1110315143 13:74097907-74097929 TTGAATTCTGAATATCTGCATGG - Intronic
1110827915 13:79994664-79994686 TTGAGTTTCCAACATGTGCCAGG + Intergenic
1112133124 13:96545964-96545986 TTGAGTGCCCACTATGTGCCAGG - Intronic
1112585827 13:100717856-100717878 TTGAATGCCTACTATGTGCGGGG + Intergenic
1112626294 13:101108301-101108323 TTGAAATCCTATTATGTGCCAGG + Intronic
1113221269 13:108105801-108105823 TTGAATTTCCAATATTGGAAGGG - Intergenic
1113817632 13:113185317-113185339 TTGAATGCCTACTAGGTGCAAGG - Intronic
1115166183 14:30451225-30451247 TTAAATTCCCCATAGGTGCTGGG - Intergenic
1115737640 14:36351824-36351846 TTTAGTGCCCACTATGTGCAGGG + Intergenic
1116537595 14:46054191-46054213 TTGCATTTCTAATATGTGCAGGG - Intergenic
1117186083 14:53242338-53242360 TTGAATTCCCATGTTGTGGAAGG + Intergenic
1117430873 14:55659395-55659417 TCAATTTCCCACTATGTGCATGG - Intronic
1117884357 14:60344032-60344054 CTGAACTCCCATTATGTGAAAGG - Intergenic
1117980518 14:61338209-61338231 CTGAATCCCAAACATGTGCAGGG - Intronic
1118637378 14:67760173-67760195 TTCCATTCCCAATTTGTGCCTGG + Intronic
1119689538 14:76660626-76660648 TTGAATACCTACTATGTGCCGGG - Intergenic
1119894810 14:78211091-78211113 TTGAATACTCACTATGTGCCAGG - Intergenic
1120549966 14:85858428-85858450 TTGAATATCCATTATGTGCCAGG + Intergenic
1120885226 14:89446731-89446753 TTGAATGCCTACTATGTGCCAGG - Intronic
1121202118 14:92126859-92126881 TTGAACAACCACTATGTGCAGGG + Intronic
1122848842 14:104515778-104515800 CTGAATGCCCACTATGTGCCAGG + Intronic
1125077047 15:35631811-35631833 ATGGATTCCCAATCTATGCAGGG - Intergenic
1126858710 15:52863301-52863323 TTGAATGCCTACTATGTGCTAGG + Intergenic
1127765727 15:62184171-62184193 TTGCATGCCTAATATATGCAGGG - Intergenic
1128643954 15:69361269-69361291 TTGACTGCCTACTATGTGCAAGG + Intronic
1128840506 15:70847065-70847087 TTAAATTCCCATTACATGCAAGG - Intronic
1130346377 15:83049834-83049856 TTGAATGCCCATCATATGCATGG - Intronic
1130785924 15:87096579-87096601 CTGAATTGCCAATATATACAGGG - Intergenic
1131774291 15:95777183-95777205 TTGAAATCCTACTATGTGCCAGG + Intergenic
1132232707 15:100196032-100196054 TTGAACACCTACTATGTGCAGGG - Intronic
1133833289 16:9343729-9343751 TTGAATTATCAGTATGTGCTAGG + Intergenic
1134051337 16:11139879-11139901 TTGAATGCCAACTATGTGCTAGG + Intronic
1134830150 16:17316337-17316359 CTGAATTCCCCAAATCTGCATGG - Intronic
1135075814 16:19392742-19392764 TTGAATACCTACTATGTGCCAGG + Intergenic
1135176684 16:20236113-20236135 TTGAGTGCCTAATATGTGCTGGG - Intergenic
1136048154 16:27631756-27631778 TTGAGTACCCACTATGTGCCAGG + Intronic
1136230222 16:28881312-28881334 TTGAATTCCTACTGTGTGCCAGG - Intronic
1137234351 16:46601902-46601924 TTGAGTACCTACTATGTGCAGGG - Intronic
1137368383 16:47881154-47881176 TTGAATACCCATTATGTGTGAGG - Intergenic
1137769541 16:51004847-51004869 TTGAGTTCCTACTATGTGCCAGG - Intergenic
1138867424 16:60839842-60839864 TTGAATACCTACTATGTGCTAGG + Intergenic
1139057416 16:63202111-63202133 GTGTATTCCAAACATGTGCATGG - Intergenic
1139527631 16:67526596-67526618 TTGAACTCCCACTATGAGCCAGG + Intronic
1139616097 16:68093627-68093649 TTGAGTACCTATTATGTGCAAGG + Intronic
1140144448 16:72292408-72292430 TTGAATTCCTACTATGTGCAAGG - Intergenic
1140275594 16:73505944-73505966 TTGAGTTCCTACTGTGTGCAAGG + Intergenic
1141378046 16:83549720-83549742 TTGAATTTCCAATAAGAGAAAGG + Intronic
1146712275 17:35052691-35052713 TTGAATGCCCACTATGTGCAGGG + Intronic
1147488170 17:40838906-40838928 TTGAATGCCCAGTGTGTGCCAGG + Intergenic
1148187326 17:45654159-45654181 TTGAATGCCCACTGTGTGCAAGG + Intergenic
1149003604 17:51781795-51781817 TTGAATTCTTACTATGTGCTAGG + Intronic
1149394508 17:56225580-56225602 TTGAGTGCCTACTATGTGCAAGG - Intronic
1149434051 17:56618446-56618468 TTGAATCCCTACTATGTGCCAGG + Intergenic
1150244694 17:63665541-63665563 TTGAATTCCCACTATGTGTAAGG + Intronic
1150955991 17:69861104-69861126 TTGAATTACCAAAATGTCTATGG + Intergenic
1156155270 18:34294748-34294770 TTGAACTTACAATATGTGCCAGG + Intergenic
1157107008 18:44783234-44783256 TTTCAATCCCAAAATGTGCAGGG - Intronic
1157690063 18:49674345-49674367 TTGAATACCCGCTATTTGCAGGG + Intergenic
1158200092 18:54930399-54930421 TTGAGGTCCAAATATGTGCCAGG - Intronic
1158847921 18:61464016-61464038 TTGAATCCCTAATATCTGCCGGG - Intronic
1158867901 18:61655603-61655625 TGAAATTCCCATTATGTGCCAGG - Intergenic
1159269489 18:66130297-66130319 TTGTAATCCCTATATGTGGAGGG - Intergenic
1164136953 19:22424933-22424955 TTGAATGCACTCTATGTGCAAGG + Intronic
1164155394 19:22593311-22593333 TTGAGTACCTACTATGTGCAAGG + Intergenic
1164455955 19:28406941-28406963 TTGACTCCCCAGTATTTGCAGGG - Intergenic
1164490305 19:28705514-28705536 TTGAGTACCTACTATGTGCAGGG - Intergenic
1166015417 19:39975919-39975941 TTGAACACCCACTATGTGCCAGG + Intronic
1167701215 19:51047261-51047283 TTGAGTTCTCACTCTGTGCAAGG + Intergenic
925005098 2:436972-436994 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005101 2:436996-437018 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005130 2:437299-437321 ATGAGCTCCCACTATGTGCATGG + Intergenic
925005136 2:437348-437370 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925753986 2:7116346-7116368 TTGAACACCTACTATGTGCAGGG + Intergenic
926356492 2:12045494-12045516 TTGAGTACCCAGTATGTGCCAGG + Intergenic
926567061 2:14487795-14487817 TTGAATCACCAATTTGTGCTTGG - Intergenic
926857692 2:17274686-17274708 TTGAATGCCAACTATGTGCCAGG + Intergenic
927187661 2:20493423-20493445 TTGAATCCCTACTATGTGCCAGG + Intergenic
928151636 2:28835571-28835593 TTGACTACCCACTATGTGCCAGG - Intronic
928377942 2:30791363-30791385 TTGAATACCTACTATGTGCCAGG - Intronic
928432613 2:31233585-31233607 ATAAATTCCCAATACTTGCAGGG + Intronic
929417692 2:41760627-41760649 TTGAATGCCCATTATGTGCATGG - Intergenic
929629626 2:43446068-43446090 TTGAATTCTTCATGTGTGCAAGG + Intronic
929920856 2:46170541-46170563 TTGAATACCTACTATGTGCCAGG - Intronic
930430791 2:51273331-51273353 TTGAATGTCTAATATGTGCTAGG + Intergenic
930952686 2:57162520-57162542 TTGACTTCCTATTATGTACAAGG - Intergenic
931165433 2:59742077-59742099 CTGAGTTCCTACTATGTGCATGG + Intergenic
931256647 2:60580018-60580040 TTGAATGCCTACTATGGGCAAGG + Intergenic
933408994 2:81900874-81900896 TTGATATGACAATATGTGCAGGG - Intergenic
933539604 2:83621875-83621897 CTGAATTCCCAATATCTCCAAGG + Intergenic
933625417 2:84592436-84592458 ATGAATTACCAATATTGGCAAGG + Intronic
933940268 2:87239416-87239438 CTGAATGCCCACTCTGTGCAGGG + Intergenic
934085601 2:88506550-88506572 TTGAATTCTTAATAGGTGCCAGG + Intergenic
935722107 2:105988817-105988839 TTGCATTCTCATTATGGGCAAGG - Intergenic
936352870 2:111726360-111726382 CTGAATGCCCACTCTGTGCAGGG - Intergenic
936784911 2:116083100-116083122 TAGAATTCCTAATACATGCAAGG + Intergenic
937521980 2:122722754-122722776 TTTATTTCCCCATATTTGCATGG - Intergenic
938576382 2:132608363-132608385 GTGTATTCACAAGATGTGCAGGG - Intronic
938831897 2:135058942-135058964 TTGAGTTCTCAATATTTGCTAGG + Intronic
939073823 2:137576405-137576427 TCTAATTCCCACTATGTGAAGGG - Intronic
939675180 2:145063276-145063298 TTGTATTCCAGATATTTGCATGG - Intergenic
939763320 2:146212266-146212288 TATAATTCTCAATATGTGTATGG + Intergenic
939907433 2:147934261-147934283 TTGATTTCCTATTGTGTGCATGG - Exonic
940082229 2:149816343-149816365 TTGATTTCTCAATTTCTGCAAGG + Intergenic
940430374 2:153583527-153583549 GTGAATTCCCAATATGGGAGAGG + Intergenic
940682944 2:156808760-156808782 TTGAATACCCACCATGTGCCAGG + Intergenic
940739331 2:157489262-157489284 TTGAATGCCTACTATGTGCTGGG + Intergenic
940749059 2:157603357-157603379 CTGACTGCCCACTATGTGCATGG + Intronic
941258990 2:163272829-163272851 GTGAATTCCCAAAGTGTGAAAGG - Intergenic
942774721 2:179567619-179567641 TTGAGCTGACAATATGTGCAAGG - Intronic
943481299 2:188421564-188421586 TTGAGTGCCCAATATGTGTCAGG + Intronic
943664490 2:190594536-190594558 TTGAATACCTACCATGTGCAAGG - Intergenic
943824724 2:192374852-192374874 CTGAATTCCTACTATGTACAAGG + Intergenic
944044542 2:195393900-195393922 TTGAACTTCCAATATGTACCAGG + Intergenic
944298620 2:198096058-198096080 TTGGATGCCTACTATGTGCAAGG + Intronic
945093565 2:206198543-206198565 TTGAATGTCCACTCTGTGCAAGG - Intronic
945854705 2:215055155-215055177 TTGAATACCCAGTATGTGCCAGG + Intronic
946581622 2:221134201-221134223 TTGAATTCCTTCTATGTGCCAGG - Intergenic
946698347 2:222384543-222384565 TTGTATTCCTAATATGTACCAGG - Intergenic
946993659 2:225365346-225365368 TGGAATTCCTACTATGTGCTAGG + Intergenic
947100859 2:226619906-226619928 TTGAACTCCTACTATGTGCCAGG - Intergenic
947235033 2:227932279-227932301 TGGAATTCCCATTGTTTGCATGG - Intergenic
948220936 2:236269324-236269346 TAAAATTCACAATATGTGCCAGG + Intergenic
1169051370 20:2581191-2581213 TTTAATTCACATTATGTGAAAGG - Intronic
1170095512 20:12641818-12641840 TTGAGTTCCCACTGTGTACATGG + Intergenic
1170261779 20:14416694-14416716 TTGAGTACCCACTATGTGCCAGG + Intronic
1170746267 20:19101678-19101700 TTGACTTCCTACTGTGTGCAAGG - Intergenic
1172852413 20:37976236-37976258 TTGAATGCCTAGTATGTGCCAGG - Intergenic
1172899637 20:38325080-38325102 TTGAATGCCCACCATGTGCCTGG + Intronic
1173414529 20:42844109-42844131 TTGAATGCCAACTATGTGCCAGG + Intronic
1173909477 20:46654053-46654075 TTACATTCCCACGATGTGCAAGG + Intronic
1174257174 20:49265629-49265651 TTGAGTGCCTAATATGTGCCAGG + Intronic
1174859812 20:54080516-54080538 TTAAATACCCAATATGGCCAGGG - Intergenic
1174909022 20:54586486-54586508 TTGAGTTCTCAATATGTGAGGGG + Intronic
1175146660 20:56901644-56901666 TTAAATTCCCAGTGTGAGCAGGG - Intergenic
1177089349 21:16747732-16747754 TTGAGTACCCAATATGTACTAGG + Intergenic
1177186165 21:17799802-17799824 TTGAGTACCCACTATGTGCCCGG - Intronic
1177588636 21:23132146-23132168 TTAAATTCCAATTATATGCATGG + Intergenic
1178607707 21:34054109-34054131 TTGAATGCCAACTATGTGCCAGG - Intergenic
1178958704 21:37044831-37044853 TTGAATACCTACTATGTGCCAGG + Intergenic
1179078946 21:38152230-38152252 TAGAATTCCCGCTATGTGCCAGG + Intronic
1182770567 22:32793074-32793096 TTGAATACCTACTATGTACAAGG - Intronic
1183973941 22:41499210-41499232 TTGAATCTCCAGTATGTGCCAGG + Intronic
1184493233 22:44822556-44822578 TTGATTTCCAAATGTGTGCTTGG + Intronic
1185408367 22:50670569-50670591 TTGAATACACAGTATTTGCAGGG - Intergenic
950198159 3:11024003-11024025 TTGAATACCTACTATGTGCCTGG + Intronic
950272844 3:11632859-11632881 TTTAATACCCATTATGTGCCAGG - Intronic
950779121 3:15375875-15375897 TTGAGTTCCAATTATGTGCCCGG + Intergenic
950862933 3:16166278-16166300 TTGAATTTCTACTATGTGCCAGG - Intergenic
951028344 3:17853017-17853039 TTGAGTTCCTATTATGTGCCAGG - Intronic
951090689 3:18570263-18570285 GTGAATGCCTTATATGTGCAAGG - Intergenic
951469240 3:23037660-23037682 TTGAACTCCCACTATGTACCAGG + Intergenic
951649186 3:24930561-24930583 TTGAACTCCTATTATGTGCCAGG - Intergenic
952143291 3:30503061-30503083 TTGAGTTCCTACTATGTGCCAGG - Intergenic
952293858 3:32043685-32043707 TTGAGTTCCTACTATGTGTAGGG - Intronic
952296119 3:32063624-32063646 TTGTAATCCCTATATGTGAAGGG + Intronic
952539791 3:34355933-34355955 TAGAATACCCACTATGTGCCAGG - Intergenic
953134593 3:40171765-40171787 TTGAGCTTCCACTATGTGCAAGG + Intronic
954011797 3:47646761-47646783 ATGACTTCCCAATGTCTGCAAGG + Intronic
954482931 3:50818296-50818318 TTGAATTCCTAATATTTTCTGGG + Intronic
955188319 3:56736191-56736213 TTGAGTACCCAGTATGTGCCAGG + Intronic
956046735 3:65203633-65203655 TTGAACTCCCACTATGTACTAGG + Intergenic
956090649 3:65663047-65663069 TTGAATTCCCAGTATGTGCTAGG - Intronic
956565115 3:70627488-70627510 TTGAAGTCCTACTGTGTGCAAGG - Intergenic
956582325 3:70828054-70828076 TTGAACACCTACTATGTGCATGG - Intergenic
957246407 3:77722092-77722114 TTGAATGCCTACTATGTGCTGGG - Intergenic
959397426 3:105858340-105858362 TTGAATACCTGCTATGTGCAAGG + Intronic
959678636 3:109066637-109066659 TGGAATGACCACTATGTGCAAGG - Intronic
959834652 3:110904446-110904468 TTGAATGTCCACTATATGCATGG + Intergenic
960000095 3:112722438-112722460 TTGACTTCCCAAACTTTGCAGGG + Intergenic
960135818 3:114103783-114103805 TTGAAGTCCTAATATGTACTAGG - Intergenic
960756699 3:121021623-121021645 TTTAATTTCCATTATTTGCATGG - Intronic
960827079 3:121799555-121799577 TTGAATTCCTACTGTGTGCAAGG + Intronic
960888630 3:122421970-122421992 TTGAATGTCTACTATGTGCAAGG + Exonic
960915831 3:122694008-122694030 TTGAATGCTTAATATGTGCCAGG + Intronic
960951705 3:123003109-123003131 TTGAATGTCCAGTAAGTGCACGG + Intronic
961411407 3:126723891-126723913 TTAAGTGCCTAATATGTGCAAGG - Intronic
961983616 3:131107678-131107700 TTGTATTTCCAATATGTGTTTGG + Intronic
962308269 3:134307874-134307896 TTGATCACCTAATATGTGCAAGG - Intergenic
962478156 3:135775353-135775375 TTGAATTCCTAGTTTGTTCAGGG - Intergenic
962585350 3:136837482-136837504 TTGAATTTCCACCATTTGCAAGG + Intronic
962684238 3:137831226-137831248 GTGAATTGCCAATTTGTGCTAGG + Intergenic
962908891 3:139829773-139829795 TTTGATTCCCACTCTGTGCATGG + Intergenic
963066905 3:141271413-141271435 TTGAAGTCCCAAAAAGGGCAAGG + Intronic
963402129 3:144812131-144812153 TTGAATTCATACTATGTACAAGG - Intergenic
964722538 3:159781611-159781633 TTGAATGCCCACTATGTGTTAGG + Intronic
964793600 3:160475039-160475061 TTGGATTCTCACTATGTGCCAGG - Intronic
965250030 3:166331210-166331232 TTGAATACCTATTATGTGCCAGG - Intergenic
965788978 3:172367289-172367311 TTGAATTACTACTATGTGCTGGG + Intronic
965807853 3:172560284-172560306 TTGATTGCCTAATATGTGCTAGG - Intergenic
965878811 3:173363078-173363100 TTGAGTACCTAATATATGCATGG + Intergenic
966330286 3:178804300-178804322 TAGAATTCCAAATATGTTAATGG - Intronic
966391338 3:179455749-179455771 ATGAATTTCCAACATGGGCAGGG + Intergenic
966471614 3:180295782-180295804 TTGAGTTCCTACTATGTGCTAGG + Intergenic
966619139 3:181945295-181945317 TTGCATACCCACTATGTGCATGG + Intergenic
966699533 3:182831926-182831948 CTGAAGGCCCAATATGTGCATGG - Intronic
967270318 3:187727487-187727509 ATGAAATCCAAATAGGTGCAAGG - Intronic
967572427 3:191045736-191045758 TTGAATTCACAATATGTCTGTGG + Intergenic
967616310 3:191571811-191571833 TTGAATTCCTATTATGTGTTAGG - Intergenic
967679936 3:192349901-192349923 CTGAATACCTAATATGTGCCAGG + Intronic
968793505 4:2686352-2686374 TTGAACACCCAATATGTGCCAGG + Intronic
970011662 4:11465920-11465942 TTGAATTCCCATTAGGTACTAGG - Intergenic
970185564 4:13447677-13447699 TTGAATTCTCACTATTTGCCAGG - Intronic
970331931 4:14995479-14995501 TTGAAAGCCTACTATGTGCAAGG + Intergenic
970500937 4:16676487-16676509 TTGAGTTCCCACTCTGTGCAAGG + Intronic
970844704 4:20522820-20522842 TTGAGCTCCCAGTATGTGCTGGG + Intronic
970932159 4:21524827-21524849 TTGACTTCCTGTTATGTGCAAGG - Intronic
971035337 4:22686807-22686829 TTGAAGTTCCTTTATGTGCAGGG + Intergenic
971345210 4:25805738-25805760 TTTACTTTCCATTATGTGCAAGG + Intronic
971425578 4:26511888-26511910 TTGCATTCACAGTGTGTGCATGG + Intergenic
971608694 4:28692632-28692654 TTGAATTACGATCATGTGCAGGG + Intergenic
971875056 4:32297881-32297903 TTGAATTCCCAAGTTGTGGGAGG - Intergenic
972327829 4:38034541-38034563 TTGAATGCTTATTATGTGCAGGG + Intronic
973012725 4:45096295-45096317 TTGAGTTCCTATTATGTGCCAGG - Intergenic
973158141 4:46983425-46983447 TTCAACGCCTAATATGTGCAAGG - Intronic
973340393 4:48997473-48997495 TTGAGTGCCCACTATGTGCCAGG - Intronic
974768219 4:66376449-66376471 TTGAGTTCCCATTAAGTGAAAGG + Intergenic
975230083 4:71923067-71923089 TGTAATTCCCAATGTTTGCAGGG + Intergenic
975289916 4:72665588-72665610 TTGAATTGCAAATATATGCCAGG + Intergenic
975406262 4:73994183-73994205 TTGAATACCTAGTATGTGCTAGG + Intergenic
975760677 4:77616642-77616664 TTGAACTCCCACCATGTGCCAGG - Intergenic
976097541 4:81525645-81525667 CTGAATGCCCACTATGTGCCAGG + Intronic
976778600 4:88733928-88733950 TTGAGTGCTCACTATGTGCAAGG - Intronic
976821803 4:89215184-89215206 TGGAATTACCAATATGTAAAAGG - Intergenic
976863214 4:89691148-89691170 TTGAATTCACAATACCTGCAGGG + Intergenic
977717506 4:100198136-100198158 TTGAGTACCTACTATGTGCAAGG + Intergenic
977758196 4:100698776-100698798 TTGAATTCTGATTATGTGCCAGG - Intronic
978623351 4:110656504-110656526 TTGAGTTCTCACTATGTGCCAGG - Intergenic
978636430 4:110813084-110813106 TTGAATTCCCTCTATGCACAAGG + Intergenic
979267783 4:118723750-118723772 TTGAATGCCCATTATGTGTGAGG + Intronic
979306501 4:119150610-119150632 TTTAATTCACACTATGTGCCAGG + Intronic
980913366 4:139013088-139013110 TTGAATACACATTATGTGCCAGG - Intergenic
981761955 4:148204414-148204436 TTGAATTCCTATTATGTGACAGG + Intronic
982465991 4:155733125-155733147 TTGAATGCCTACTATGTGCCAGG + Intergenic
982600248 4:157440813-157440835 TTGAATACTTAATATATGCATGG + Intergenic
982643175 4:157988108-157988130 TTGAATACCTACTATGTGCCAGG - Intergenic
983823611 4:172229196-172229218 TTGAATGCTCACTATGTGCCAGG - Intronic
983859273 4:172685050-172685072 TAGAATGCTTAATATGTGCAAGG - Intronic
984542465 4:181057071-181057093 TTGAATACCTAATATAAGCAAGG + Intergenic
986716457 5:10527570-10527592 CTGAAGTCTCATTATGTGCAAGG - Intergenic
987632323 5:20490846-20490868 TTGAGTTTTCAATATGTACAAGG - Intronic
987713832 5:21539977-21539999 TTAAATTCCCAATAAGTACTAGG + Intergenic
987958919 5:24777817-24777839 TTGAATTCATATTATTTGCATGG + Intergenic
988208456 5:28171553-28171575 TTGTAATCCCAACATGTGGAGGG - Intergenic
988217250 5:28290926-28290948 TTGAATGCCTACTATGTGCCAGG - Intergenic
989117595 5:37970519-37970541 TTGAGTACCTATTATGTGCAAGG + Intergenic
989610818 5:43289236-43289258 TTGAAATCCTAATATAAGCAAGG - Intergenic
990504641 5:56432324-56432346 TTGAGTTCCTACTATGTGCCAGG + Intergenic
990795548 5:59535896-59535918 TTGAATGTCAAGTATGTGCAAGG - Intronic
991089805 5:62683331-62683353 TTGAATACCTACTATGTGCCAGG + Intergenic
991641057 5:68752956-68752978 TTAAATACCTACTATGTGCAAGG + Intergenic
992304893 5:75426666-75426688 TTGAATACCTACTATGTGCTGGG + Intronic
993105321 5:83593602-83593624 TTGCATTTCTAATATGTTCACGG + Intergenic
993958979 5:94273240-94273262 TTGAGTTCTTACTATGTGCAAGG - Intronic
994052483 5:95378634-95378656 CTGAATGCCTACTATGTGCAAGG - Intergenic
994125402 5:96164578-96164600 TTGAATACCCACTCTGTGCCAGG + Intergenic
994759149 5:103832114-103832136 TTGAATTCCTAAAATATGCCAGG + Intergenic
994862342 5:105213768-105213790 TTGATCACCTAATATGTGCAAGG - Intergenic
994940005 5:106311072-106311094 CTGAATTCCCAAAAAGTACAAGG + Intergenic
994986011 5:106934389-106934411 ATGAATTCCTACTATGTGCTAGG - Intergenic
995061195 5:107813462-107813484 TTGAGTGCCCACTATGTGCTAGG + Intergenic
995165724 5:109039329-109039351 TTGAATGCCTACTATGTGCAAGG + Intronic
995767957 5:115639346-115639368 GTGAATTCCCAGTATCTGAATGG + Intergenic
996105849 5:119501697-119501719 TTGGATGCCCAATATGTTCCAGG + Intronic
996294615 5:121896839-121896861 TTGAATACCTACTATGTGCTAGG - Intergenic
996325133 5:122264511-122264533 TTGCATTTCCAATATGTCCCAGG + Intergenic
996805480 5:127449413-127449435 TTGAGTTCCTACTATGTGCCAGG + Intronic
996960641 5:129244711-129244733 TTGAGTACACAATATGTGCCAGG - Intergenic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
997452771 5:133996680-133996702 TTGAATGCCTATTATGTGCCAGG - Intronic
997650083 5:135510545-135510567 TTGAATGCCAACTATGTGCCTGG - Intergenic
998637833 5:143976062-143976084 TTGGGTTCCCACTATCTGCAAGG - Intergenic
998778667 5:145631659-145631681 TTGAATGCCCATTATGTGCCAGG - Intronic
998839811 5:146241325-146241347 TTGAATGCCTACTATGTGCCAGG + Intronic
998890005 5:146735889-146735911 TTGAATACCAAATATGTGGTGGG + Intronic
998953185 5:147412512-147412534 TTGAGCTCTCAATATGTGCAAGG - Intronic
999075833 5:148794453-148794475 TTGAATTCCTACCATGTGCCAGG + Intergenic
999076506 5:148800906-148800928 TTGAGTGCCCATTATGTGCCAGG + Intergenic
999192645 5:149759965-149759987 TGGAACACCCATTATGTGCAAGG + Intronic
999726309 5:154441095-154441117 TTGAGTACCTAATATGTGCAAGG + Intergenic
1000228818 5:159295975-159295997 TTGAATGCTCACTATGTGCCAGG - Intergenic
1000542336 5:162555378-162555400 TGGAATACCCAATATGTGATAGG - Intergenic
1001213212 5:169830437-169830459 TTGAATTCTTACTATGTGCTGGG - Intronic
1001293413 5:170482392-170482414 TTGAATCCCTAATGTGTGCCAGG + Intronic
1003753850 6:9093582-9093604 TTCAAGTCTCAATATGTGGATGG + Intergenic
1003831831 6:10020485-10020507 TTGAACACCTACTATGTGCAGGG - Intronic
1003899709 6:10642934-10642956 TTGAATTCTTAGTATGTGCCAGG + Intergenic
1004650341 6:17601274-17601296 CTAAATTCCCAAAATGTACAAGG + Intronic
1006236279 6:32636136-32636158 TAAAATTCCAAATATTTGCAAGG - Intronic
1006708558 6:36044879-36044901 TTGGACTCCCAATAAGTACAGGG - Intronic
1007895045 6:45346535-45346557 TTGAATTCCTATTATATGCCAGG - Intronic
1008143429 6:47859575-47859597 TTGAATGCCTAACATGTGCCTGG + Intergenic
1008748228 6:54699405-54699427 TTGAGTTGCCATTATGTGAAAGG + Intergenic
1009002886 6:57741912-57741934 TTAAATTCCCAATAAGTACTAGG - Intergenic
1009687314 6:66979208-66979230 TTGAATACCTAATATGTGCCAGG - Intergenic
1009953221 6:70420378-70420400 ATGAATTCTGACTATGTGCAAGG + Intronic
1010103135 6:72133797-72133819 TTGGATTTCCATTATGTGCTAGG - Intronic
1010161183 6:72857893-72857915 TTGAATGCCTACTATGTGCTGGG + Intronic
1010433019 6:75800082-75800104 TTGAATTCCCAATATGTGTCAGG - Intronic
1010437810 6:75855456-75855478 ATGAATTCCAAATATCAGCAAGG - Intronic
1011001681 6:82596055-82596077 TTAAATTCCTAATTTGTGGAAGG + Intergenic
1011111914 6:83847881-83847903 TTGAATACCTACTATGTGCCAGG - Intergenic
1011328839 6:86181453-86181475 TTAATTTCCTAATATTTGCATGG + Intergenic
1011781507 6:90794929-90794951 TTGAATGCCTACTATGTGCTTGG + Intergenic
1011860887 6:91754493-91754515 TTAAATTCACATTATATGCAAGG + Intergenic
1011961803 6:93100435-93100457 TTGAATACCCACTATGTGACAGG + Intergenic
1012412504 6:98975129-98975151 CTGAAATCACACTATGTGCATGG - Intergenic
1013146550 6:107400044-107400066 GTGAATTCCCAGTATGTGAGTGG + Intronic
1013219345 6:108063535-108063557 TTGAATACCAACTATGTGCTAGG - Intronic
1013449753 6:110268502-110268524 TTGAACTTCCAGCATGTGCATGG + Intronic
1013555644 6:111254466-111254488 TTGAATACTTAAGATGTGCAAGG - Intergenic
1013745259 6:113337841-113337863 TTGAATGCCTACTATGTGCCAGG - Intergenic
1014013956 6:116508221-116508243 TTGAACTCCCACTGTGTGCCAGG - Intronic
1014428434 6:121337511-121337533 CTGAATTCCCAAGATATCCATGG + Intergenic
1014903937 6:127003522-127003544 TTGAATTCCCAGTGTATGCCAGG + Intergenic
1015707344 6:136102350-136102372 TTGAATACCAACTATGTGCCAGG + Intronic
1016108373 6:140190265-140190287 TTCAATGCCTAATTTGTGCAGGG - Intergenic
1016512816 6:144862807-144862829 TTGTAATCCCCATATGTGGAGGG + Intergenic
1016526553 6:145007765-145007787 ATGAATGCCCAGTTTGTGCAAGG - Intergenic
1018604478 6:165583077-165583099 TTGAATGCCTACTATGTGCGGGG + Intronic
1018857519 6:167685287-167685309 TTGAACTTCCCATATGTGCTAGG - Intergenic
1020252384 7:6479831-6479853 TTGACCACCCACTATGTGCAAGG - Intronic
1021238880 7:18176411-18176433 TGGAATTCCAAATATTTGCTTGG + Intronic
1021903598 7:25311847-25311869 TTGTATTCCTCATATGTGGAGGG + Intergenic
1022320381 7:29282305-29282327 CTGAGTGCCCACTATGTGCAGGG + Intronic
1022640125 7:32174270-32174292 TTGAATTCCCTCAATGTGCCAGG + Intronic
1022999356 7:35791586-35791608 TTGAGTGCCTACTATGTGCAAGG + Intergenic
1024459412 7:49644698-49644720 TTGAATTCCTTCTATGTGCTTGG + Intergenic
1024849887 7:53699920-53699942 TTGAATGCCCATTCTGTGCCGGG - Intergenic
1027290338 7:76702404-76702426 TTGAGTACCTACTATGTGCAAGG + Intergenic
1027443424 7:78245373-78245395 TTGAATGCCCACAATGTGCTAGG - Intronic
1027625632 7:80541596-80541618 TTGATTTCCCAATAAATGGATGG + Intronic
1027796978 7:82707931-82707953 TTGAATACTTAATATGTGCCAGG + Intergenic
1028070294 7:86441925-86441947 TTGTATTTCCAATGTCTGCAAGG - Intergenic
1028401485 7:90430379-90430401 GTGAATTCCCAAAATGTGAGAGG + Intronic
1028547863 7:92024608-92024630 TTGAGTACCTATTATGTGCAGGG - Intronic
1028842160 7:95440480-95440502 TTGAATTCCCAGTAACTGCTTGG - Intergenic
1029982116 7:104888578-104888600 TTGAAGTCCTACTATGTGCCAGG + Intronic
1029992460 7:104974672-104974694 TTGAATGCCCACTATGTGTCAGG - Intergenic
1031206863 7:118770459-118770481 TTGAAATTCCAATATGTACTAGG + Intergenic
1032102206 7:128990474-128990496 TTGAGTGCCCACTATGTGCCAGG - Intronic
1032418541 7:131758478-131758500 TTGAGCTCCCAGTATGTGCCAGG - Intergenic
1032647128 7:133837161-133837183 TTGAATGCCTACTATGTGCCAGG + Intronic
1033243589 7:139700858-139700880 TTGAATACCTACTATGTGCATGG - Intronic
1033924038 7:146434872-146434894 TTGAATCCCCTATGTGTGCCAGG + Intronic
1034747154 7:153532936-153532958 TTGCATTCCTACTATGTGCTAGG - Intergenic
1034882070 7:154770405-154770427 TTGAATTCCCAAGATGAGGGAGG - Intronic
1035936008 8:3840456-3840478 TTGAATGCCTATTATGTTCAGGG - Intronic
1036502989 8:9330475-9330497 TTGAATTCTCAGTATATGAAGGG - Intergenic
1036581947 8:10082854-10082876 TTGAATTCCTACTCTGTTCACGG - Intronic
1036947031 8:13104057-13104079 TTCAATTTCCATTCTGTGCAAGG - Intronic
1037807183 8:22065028-22065050 TTGAATGCTCATTATGTGCTAGG - Intronic
1038145588 8:24892326-24892348 TTGCATGTCCAATATGTGCTAGG - Intergenic
1038217237 8:25573500-25573522 CCCAATCCCCAATATGTGCAAGG - Intergenic
1038390007 8:27188291-27188313 TTGACCACCCAATATGTGCTAGG - Intergenic
1038763923 8:30410018-30410040 TTGAATACCTACTATGTGCCTGG + Intronic
1039165365 8:34673455-34673477 TTGAGTGCCCACTATGTGCTAGG + Intergenic
1039206738 8:35164018-35164040 TTGTAATCCCCATATGTGGAGGG + Intergenic
1039229032 8:35422719-35422741 TTGAATACCTACTATGTGCCAGG + Intronic
1039752990 8:40495184-40495206 TTGAATTTCCATGAGGTGCAGGG + Intergenic
1040642975 8:49362188-49362210 ATGAATTCGCTATAAGTGCATGG + Intergenic
1041283631 8:56237320-56237342 TTGAATTCAAAACATGTACAAGG + Intergenic
1042086595 8:65115733-65115755 TTGTAATCCCCATATGTGGAAGG - Intergenic
1042382024 8:68127813-68127835 TTGAGCTCCCACTAAGTGCATGG - Intronic
1042427662 8:68667523-68667545 TTGAATTCCTACCCTGTGCAAGG + Intronic
1043711784 8:83428643-83428665 TTAAATTACTAAAATGTGCAGGG - Intergenic
1044482755 8:92712103-92712125 ATAAATGCCCAATATGTGCTTGG + Intergenic
1044848540 8:96405806-96405828 TTGAGCACCCAATATATGCAAGG + Intergenic
1045496305 8:102712325-102712347 TTGAATACCTACTATGTGCCAGG - Intergenic
1045764702 8:105653337-105653359 TTGAATTGCCACTATATGCCAGG + Intronic
1046096880 8:109573098-109573120 TAGACTTCCCACTATGTGCCAGG + Intergenic
1046697212 8:117355822-117355844 TTGAATTCTTAATATCTGCCAGG - Intergenic
1046710661 8:117507436-117507458 TTTAATACCTAATATGTGCCAGG - Intergenic
1046760228 8:118012738-118012760 TTGAATGTCCATTATGTGCCAGG - Intronic
1046871788 8:119211949-119211971 CTGAATACCTACTATGTGCAAGG + Intronic
1047025508 8:120819361-120819383 TTGTATTCCTATTGTGTGCAAGG - Intergenic
1047438762 8:124857848-124857870 AATAATTCCCAATATGTGCCAGG - Intergenic
1047818754 8:128494954-128494976 TTGAATACCCTCTATGTGCAAGG - Intergenic
1048513494 8:135082929-135082951 TTGAGTTCCTACTATGTGCCAGG - Intergenic
1048896313 8:138995592-138995614 ATGAAGTCCCAAGATCTGCAGGG + Intergenic
1050170608 9:2811991-2812013 TTGAATGCCTACTATGTGCCAGG + Intronic
1050466407 9:5928904-5928926 TTGACTGCCCACTGTGTGCAAGG - Intronic
1050853463 9:10319386-10319408 TGAAATTCAAAATATGTGCAAGG + Intronic
1050876776 9:10649328-10649350 TTTAGTTCCCAACATGTGCTAGG + Intergenic
1050890033 9:10812989-10813011 TTGAAAACCCATTATGTGCCAGG - Intergenic
1051873485 9:21766426-21766448 TTGAGTTTCCACTATGTGCTAGG + Intergenic
1052021915 9:23534984-23535006 TTGAGTTCCTTATATGTGTAAGG - Intergenic
1052383798 9:27801554-27801576 TTGAATGCCTACTATGTGCCAGG - Intergenic
1054765353 9:69038184-69038206 TCAAATACCCAAGATGTGCAAGG - Intronic
1054838809 9:69712596-69712618 TTGAATTCCTACAATGTGCAAGG + Intronic
1055029960 9:71763901-71763923 TTGCATTCCTAGGATGTGCAAGG - Intronic
1055178110 9:73346137-73346159 TTGAATTCCCCTAATGTGAAGGG - Intergenic
1056017309 9:82403725-82403747 TTGAATGACCAATGTGTGCTAGG + Intergenic
1057867634 9:98693772-98693794 TTGAATCCCTACTATGTGCTGGG - Intronic
1058140241 9:101350104-101350126 TTAAGTTCCCATTATGTCCAAGG + Intergenic
1058172898 9:101704405-101704427 TTGAATCCCCACAATGTGCTAGG + Intronic
1058797324 9:108511299-108511321 TAAAATTCCTAATATATGCAAGG + Intergenic
1059021453 9:110580473-110580495 TTGAATACCCATTGTGTGCCAGG + Intergenic
1059866888 9:118524647-118524669 TTCATTTGACAATATGTGCATGG - Intergenic
1059956515 9:119521662-119521684 GTGAATTTCCAATATGTACAAGG - Intronic
1060299605 9:122367544-122367566 TTGAATATCTACTATGTGCAGGG - Intergenic
1061651662 9:132055128-132055150 TTGAGGGCCCACTATGTGCAGGG - Intronic
1186299565 X:8185073-8185095 TTGAATGCCTGAAATGTGCAAGG + Intergenic
1186847240 X:13542823-13542845 CTGAAATCCCAATATGCCCATGG + Intergenic
1188205894 X:27358084-27358106 TTCCATTCCCAACATGTGCCAGG - Intergenic
1188264847 X:28060318-28060340 TTGAATGCCAAATATGTGCCAGG + Intergenic
1188392576 X:29639573-29639595 CTGAATACACAATCTGTGCATGG + Intronic
1189211182 X:39284905-39284927 TTGAATACCCATTATCTGCCAGG - Intergenic
1189224898 X:39404267-39404289 TTGAGTACCCAATATGTACCAGG - Intergenic
1189599916 X:42613064-42613086 TTTAATTTCCATTATTTGCATGG + Intergenic
1189694780 X:43653396-43653418 TTGATTTCACAGTATGTGCTAGG - Intergenic
1189761089 X:44322326-44322348 TTGAACACCTACTATGTGCAAGG - Intronic
1190443963 X:50504466-50504488 TTGAATACTCAGTATGTGCCAGG + Intergenic
1191841830 X:65518760-65518782 TTGCATGCCCACTATGTGCCAGG - Intronic
1192272770 X:69598887-69598909 ATGAATTCCCAATATGTTGCTGG + Intergenic
1192480423 X:71480443-71480465 TTGAATTCCCACTATGTACCCGG + Intronic
1192590382 X:72354891-72354913 TTGAAGTCCTAGTATGTGCTGGG - Intronic
1192890273 X:75383239-75383261 TTGAATGCCAATTATGTGCCAGG - Intronic
1193137098 X:77984283-77984305 TTGAATGTCCATTATGTGCCCGG - Intronic
1193166413 X:78285777-78285799 TTGAGTGCCTACTATGTGCAAGG - Intronic
1194771268 X:97908707-97908729 TTGAGTGCTCACTATGTGCAAGG + Intergenic
1194800137 X:98263035-98263057 TTGAACTCCCATTATGTTCCAGG + Intergenic
1194970301 X:100335750-100335772 TTGAGTGCCCACTATGTGCCTGG - Intronic
1195134074 X:101886106-101886128 TTGAACTCCTACTATGTGCCAGG + Intronic
1195281393 X:103337920-103337942 TGGAATTCCACATATGTGAATGG + Intergenic
1195715204 X:107811851-107811873 TTGAATTCTCTCTATGTGCCAGG + Intergenic
1196185234 X:112738424-112738446 TTGAGCTCTCAATATGTGCCAGG + Intergenic
1196275243 X:113759117-113759139 TTGACTTCCTACTATGTGCACGG - Intergenic
1196399887 X:115303542-115303564 TTGAATTTAAAATATGTTCAAGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197237574 X:124085210-124085232 TTGAATGTACAAAATGTGCATGG + Intronic
1197613202 X:128661708-128661730 TTGAATGCCTACTATGTGCCAGG + Intergenic
1197954952 X:131936369-131936391 TTGAATGCCTATTATGTGCCAGG - Intergenic
1198217369 X:134568273-134568295 TTGAATGCCTACTATGTGCACGG + Intronic
1198514128 X:137387328-137387350 TTGAATGCCTACTATGTGCCAGG + Intergenic
1198662105 X:138980929-138980951 TTGAAATCCTAATATGTACAAGG + Intronic
1198681249 X:139184735-139184757 TTGAATACCTACTATGTGCCAGG - Intronic
1199178574 X:144823663-144823685 TTGAGTTCCTAATAAATGCATGG - Intergenic
1199651491 X:149949211-149949233 TTGAATTCTCAATATGACCATGG - Intergenic
1201686928 Y:16715196-16715218 TTGAATTCCTGTTATGTACAAGG - Intergenic
1202113600 Y:21449623-21449645 TTGAATTCCCTTTATGTTTAAGG + Intergenic