ID: 1100961956

View in Genome Browser
Species Human (GRCh38)
Location 12:99972540-99972562
Sequence CATCAAGAGCTGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100961947_1100961956 26 Left 1100961947 12:99972491-99972513 CCTTAAGGCAAAGCCTAATCCAG 0: 14
1: 355
2: 660
3: 622
4: 520
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1100961952_1100961956 -5 Left 1100961952 12:99972522-99972544 CCTAACTCTCTTCAATTCCATCA 0: 1
1: 18
2: 214
3: 550
4: 849
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1100961946_1100961956 27 Left 1100961946 12:99972490-99972512 CCCTTAAGGCAAAGCCTAATCCA 0: 15
1: 344
2: 642
3: 564
4: 476
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1100961950_1100961956 7 Left 1100961950 12:99972510-99972532 CCAGAGCAAGGCCCTAACTCTCT 0: 135
1: 429
2: 559
3: 472
4: 537
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1100961951_1100961956 -4 Left 1100961951 12:99972521-99972543 CCCTAACTCTCTTCAATTCCATC 0: 1
1: 17
2: 199
3: 516
4: 855
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1100961949_1100961956 13 Left 1100961949 12:99972504-99972526 CCTAATCCAGAGCAAGGCCCTAA 0: 201
1: 525
2: 640
3: 548
4: 488
Right 1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100961956 Original CRISPR CATCAAGAGCTGATGGAGCT GGG Intronic
900467378 1:2832463-2832485 CATCATGAGCTGATGGGTGTGGG + Intergenic
902897695 1:19490369-19490391 TAGCAATAGCTGATGGATCTAGG - Intergenic
910133510 1:83937753-83937775 CATTAAGAGTTGATTGAACTTGG - Intronic
912554788 1:110508198-110508220 CCTCAGCAGCTGGTGGAGCTGGG + Intergenic
915249414 1:154577727-154577749 CAGGAAGAGCTGGGGGAGCTGGG + Exonic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
917228903 1:172814556-172814578 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
919761454 1:201100607-201100629 CACCCAGACCTGAGGGAGCTTGG - Intronic
922645196 1:227279203-227279225 AATGAAGAGTTGATGGAGTTAGG - Intronic
924568519 1:245217972-245217994 CATCAACTGCTGGTGGAACTGGG + Intronic
1063580637 10:7303601-7303623 CATCAAGAGCTTATGGTTATTGG - Intronic
1063872911 10:10439025-10439047 CATGAAGAGCTTTTGGAGATTGG + Intergenic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1064249784 10:13698073-13698095 CATGGAGAGCTGATGGAGGGAGG + Intronic
1065570258 10:27063745-27063767 CATTAAGACCTGAGGGAGCCAGG - Intronic
1066058950 10:31705800-31705822 ACTCAAGAGCTGGTGGAGGTTGG - Intergenic
1068464643 10:57373873-57373895 CCTAAAGAGCTGATGGTCCTAGG - Intergenic
1068587877 10:58820399-58820421 GATCAGGATCTGAAGGAGCTGGG + Exonic
1070895905 10:79982736-79982758 AAACAAGAACTAATGGAGCTTGG + Intergenic
1071857598 10:89641935-89641957 CATCTTGAACTGCTGGAGCTAGG - Intronic
1073777614 10:106803589-106803611 CCTAAAGAGCTGATAGAGGTTGG - Intronic
1074084972 10:110202952-110202974 CATCAAGAGATGAAGGGGCAAGG - Intergenic
1074797144 10:116958573-116958595 CATCTAGAGCCAATGGATCTGGG + Intronic
1074827119 10:117222723-117222745 CATCAAGAGCAGCTGGGGCAGGG - Intergenic
1075052704 10:119194679-119194701 ATTCAAGAGGTGAGGGAGCTGGG - Intergenic
1076545910 10:131245733-131245755 CATAAAGAGCTGGTCGAGTTCGG + Intronic
1077637469 11:3853675-3853697 CATTAAGAGAAGATGGGGCTGGG - Intergenic
1080095820 11:28405087-28405109 CAACAAAAGCTTATGGAGCTTGG + Intergenic
1081036733 11:38157045-38157067 CATCAATAGCTGCTGTGGCTTGG + Intergenic
1085524320 11:77155411-77155433 CATAAAGAGCTGAAGGAGCTGGG - Intronic
1085772869 11:79340404-79340426 CATCAAGAGCTGGTGGTCCCTGG - Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1089059166 11:115612189-115612211 CCCCAAGACCTGCTGGAGCTGGG - Intergenic
1090249208 11:125239688-125239710 CATCAAGATCTGGTCGAGCGGGG - Intronic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1091705541 12:2690886-2690908 AATCAAGACCTGAAGGAGCGGGG - Exonic
1092952108 12:13515483-13515505 CATCAACAGCTGAAAGAGGTGGG - Intergenic
1094282250 12:28753250-28753272 AAGCAAGAGCTGATGGAGAGAGG - Intergenic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1098210785 12:68162822-68162844 CATCAAGAGTTATTAGAGCTTGG - Intergenic
1098713658 12:73801273-73801295 CAGCTAGAGCTGAAGCAGCTGGG - Intergenic
1099902148 12:88724272-88724294 GAGCAAGAGCTGCTGGAGGTAGG - Intergenic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1102791581 12:115650612-115650634 CATCAAAATCTAATGGGGCTGGG + Intergenic
1102983456 12:117260426-117260448 CATGAGAAGCTGGTGGAGCTAGG + Intronic
1103310244 12:120000719-120000741 TAGCAAAAGCTCATGGAGCTTGG + Intronic
1104435549 12:128753382-128753404 CATCGAGAGGGAATGGAGCTGGG + Intergenic
1105432611 13:20350954-20350976 CATCAGGCGCTGCTGGGGCTGGG + Intergenic
1105712684 13:23027971-23027993 CATCAAGAGATGAAGAAGCCTGG - Intergenic
1106864413 13:33948202-33948224 CAGCTAGAGCTGAAGCAGCTGGG - Intronic
1107082952 13:36394489-36394511 CGTTAAGGGCTGATGGAGCTGGG + Intergenic
1108838524 13:54582156-54582178 CATCAAAAGCTGTTCCAGCTGGG - Intergenic
1109673267 13:65637983-65638005 TATCAAGTGGTGATGGAGCGGGG - Intergenic
1114653704 14:24303189-24303211 CAACAAGAGCTGTAGGACCTTGG - Exonic
1114913788 14:27235350-27235372 CAAAAAAAGCTGATGGAACTTGG - Intergenic
1115758451 14:36553450-36553472 AATTAAGAGGTGATGTAGCTTGG - Intergenic
1116264763 14:42674169-42674191 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
1117054641 14:51899230-51899252 AGTCAAGAGCTGATGGAGGTAGG - Intronic
1118869334 14:69728024-69728046 GAGCAAGTGCTGTTGGAGCTGGG + Intronic
1119748668 14:77062394-77062416 CAACGTGAGCTGCTGGAGCTGGG + Intergenic
1122796023 14:104206661-104206683 CATCAGGAGCTGCTGGAGGTGGG - Intergenic
1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG + Intergenic
1128606501 15:69040100-69040122 CATCGTGAGCTGAGGGATCTGGG - Intronic
1128644218 15:69363041-69363063 AACCAACAGCTGAAGGAGCTCGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129510867 15:76121168-76121190 CCTCAAGAGAGGATGGAGCAGGG + Intronic
1129929525 15:79398818-79398840 CATCACAAGCTGATGGAATTAGG + Intronic
1133022098 16:2971277-2971299 CATAAAGAGGTGATAGAGCACGG - Exonic
1133518164 16:6530212-6530234 CCTCTAGATCTGATGGAGTTTGG + Intronic
1138691107 16:58769623-58769645 CAGCAAGAGCTGTTGGAGATGGG + Intergenic
1139430239 16:66907240-66907262 CATCATCAGCTCATGGTGCTTGG + Intergenic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1140110962 16:72004553-72004575 CATGAAGATCTGATGAAGCATGG - Intergenic
1140753404 16:78046230-78046252 CATAAAGGGCTGATTGAGCGGGG + Intronic
1140841759 16:78846088-78846110 CATCAGGAGCTGTGGGACCTTGG + Intronic
1142863844 17:2778685-2778707 CAGCAGTAGGTGATGGAGCTGGG - Intronic
1144859576 17:18292416-18292438 CAGCAGGAGCTGATGGAGAGTGG + Intronic
1147817155 17:43218297-43218319 CAGCCAGCCCTGATGGAGCTGGG - Exonic
1147958441 17:44151120-44151142 AATCAAGAGCTGATGCTGCTAGG + Intronic
1150473492 17:65457335-65457357 CATCTAGAGCAGGTGGAGTTGGG - Intergenic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1153483827 18:5575235-5575257 CCTCAATAGCTGATATAGCTTGG + Intronic
1154220328 18:12447360-12447382 CACTAAGAGCTTGTGGAGCTTGG - Exonic
1157321143 18:46635463-46635485 GGCCAATAGCTGATGGAGCTAGG - Intronic
1157805177 18:50652403-50652425 GATAAAGAGCTGATGCACCTGGG + Intronic
1159627629 18:70713260-70713282 CATGAACAGCTGAGGGAGATGGG + Intergenic
1164597749 19:29541321-29541343 AGTCAAGAGATGATGGGGCTTGG + Intronic
927132337 2:20071373-20071395 CATCTCTAGCCGATGGAGCTGGG - Intergenic
928173144 2:29016290-29016312 AATCAAGAGGTGGTGGGGCTTGG - Intronic
930616680 2:53601248-53601270 CATCAAGAAATTAGGGAGCTGGG - Intronic
931000056 2:57769200-57769222 CAACAAAAGCTTATGGAGCAAGG + Intergenic
932734720 2:74246661-74246683 TATCATGACTTGATGGAGCTGGG + Intronic
934090592 2:88547345-88547367 CATCCAGAGCTTAGGGATCTGGG + Intergenic
935702679 2:105825916-105825938 CATCAAGATCTAATGGAGCCAGG - Intronic
935793112 2:106612343-106612365 CATTAAGAACTGATAAAGCTAGG - Intergenic
936944812 2:117920886-117920908 CATCAAGAGATAATGGGGCCGGG + Intronic
936989444 2:118346903-118346925 CCTGCAGAGCTGCTGGAGCTAGG - Intergenic
941683774 2:168427068-168427090 CATCAAGAGTTGTTGCAGATTGG + Intergenic
944031586 2:195240832-195240854 CATGTAAAGCTGATGGAGCCTGG + Intergenic
946658930 2:221978773-221978795 CACCAAGAGGTGAGGAAGCTGGG - Intergenic
948490508 2:238309767-238309789 ATTCAAGGGCTGATGGAGTTGGG - Intergenic
1168899076 20:1344978-1345000 CCTCAAGACCTGCGGGAGCTGGG + Intronic
1170708197 20:18765173-18765195 AAGGAAGAGCTGAAGGAGCTGGG + Intergenic
1170767001 20:19298850-19298872 CTTCAAGGGGTGAGGGAGCTGGG + Intronic
1171201597 20:23246443-23246465 CATGCAAAGCTGATGGAGCTGGG - Intergenic
1173065776 20:39709579-39709601 CTTAAAGAGCTGACAGAGCTGGG + Intergenic
1173342739 20:42167555-42167577 CCTAAAGAGCACATGGAGCTAGG - Intronic
1174626465 20:51918917-51918939 CTTCAAGAGCTGATGCAGGTGGG + Intergenic
1177795292 21:25771157-25771179 CATCAAGAGCTTAAGAATCTTGG + Exonic
1178583231 21:33853304-33853326 AAGTCAGAGCTGATGGAGCTTGG - Intronic
1183092587 22:35532968-35532990 CAGCAATAATTGATGGAGCTGGG - Intergenic
1183291413 22:37003977-37003999 CAGCAAGAGGCTATGGAGCTGGG - Exonic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1184805807 22:46794198-46794220 CATCACAAGCTGGTGGAGTTAGG - Intronic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
950648682 3:14393688-14393710 CATCTAGAGCTGAGGGATCCTGG + Intergenic
952179530 3:30902991-30903013 CATCAAAAGATGGAGGAGCTAGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
953658278 3:44871390-44871412 AATCCACAGATGATGGAGCTGGG - Intronic
957609460 3:82448908-82448930 CAACTAGAGCTGAAGGGGCTGGG - Intergenic
962189368 3:133294424-133294446 CATCATGAGGTGATGGCTCTGGG - Intronic
962968466 3:140376284-140376306 CATCTATAGCTGATGGAGGTGGG - Intronic
963516604 3:146316842-146316864 CATCTGGAGCTGAAGCAGCTGGG + Intergenic
966395831 3:179501884-179501906 CAGCAAGAGATGATAGTGCTTGG - Intergenic
966494905 3:180568849-180568871 TATCAAAAAATGATGGAGCTCGG - Intergenic
968920889 4:3521740-3521762 AGTCAAGAGCTGCTGGCGCTGGG + Intronic
968925863 4:3547699-3547721 CATCACGACCTGAAGGTGCTTGG + Intergenic
969668579 4:8576380-8576402 CACCAATGGCTGATGGAGCTAGG - Intronic
973182677 4:47288825-47288847 CGTCAACAGCTGATGGAGCCTGG + Intronic
974101475 4:57422267-57422289 CAGCTAGAGCTGAAGCAGCTGGG - Intergenic
974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG + Intergenic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
979476087 4:121158879-121158901 CATCAAGTTCTGATTGTGCTGGG + Intronic
979934628 4:126675785-126675807 ACTCAAGAGCTAATGGAGCTAGG - Intergenic
980123573 4:128752020-128752042 TATCAAGGGCTGATGGAGGCTGG - Intergenic
984134613 4:175920052-175920074 CCTCTAAAGGTGATGGAGCTTGG + Intronic
988167839 5:27617164-27617186 CAACCTGAGATGATGGAGCTTGG - Intergenic
988353532 5:30142989-30143011 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
989090553 5:37725824-37725846 CATGAAAAGCTAATGGAGTTAGG - Intronic
990379711 5:55210890-55210912 CACCAATAGCTGATTGAGCCAGG - Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
992332746 5:75733916-75733938 CAAAAAGACCTGAGGGAGCTTGG - Intergenic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
995818956 5:116205050-116205072 AATAAAGAGCGGCTGGAGCTTGG - Intronic
996607723 5:125343716-125343738 CATCAAGAGCTGAAGGTCATGGG - Intergenic
999754581 5:154654662-154654684 TATCAAGAGCTCACTGAGCTGGG - Intergenic
1002280125 5:178124889-178124911 CAGAAAGAGCTGACGGAGATTGG - Exonic
1003240622 6:4342721-4342743 CATCAACAGTTGATGAAGTTGGG - Intergenic
1003481640 6:6539375-6539397 AGTCATGAGCTCATGGAGCTTGG - Intergenic
1003767895 6:9261534-9261556 CATCTGGAGCTGATGAACCTAGG + Intergenic
1004954692 6:20716430-20716452 CAGCAAGAGATGATGTGGCTTGG + Intronic
1011425029 6:87218602-87218624 CATGAAAAGCTGATGGAGAATGG + Exonic
1011683409 6:89804525-89804547 CTTCAAGAGTTAAAGGAGCTGGG - Intronic
1014136473 6:117895560-117895582 AAACAAGAGATGATGTAGCTTGG + Intergenic
1014600474 6:123405375-123405397 CATCTTGAGATGATGGAGATGGG - Intronic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1017439477 6:154450156-154450178 CATCAGGACCTGGAGGAGCTGGG - Exonic
1017906573 6:158760862-158760884 AAAGAAGAGCTGCTGGAGCTGGG - Intronic
1018566885 6:165163666-165163688 CAGCAAGAGGTGAAGCAGCTTGG + Intergenic
1018766857 6:166940831-166940853 CACCAAGAGCAGATGCAGCCAGG + Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019742537 7:2682039-2682061 CAGCCAGAGCGGCTGGAGCTGGG - Intronic
1025709678 7:63896587-63896609 CATCAAGAGCTTAAGAATCTTGG + Intergenic
1028158966 7:87464378-87464400 AGTCAAGAGCCAATGGAGCTGGG + Intronic
1028948782 7:96610393-96610415 TATCAAAAGCTGCTGGAGCCCGG - Intronic
1029926296 7:104322368-104322390 CATGAAGAACTGCTGGAGTTTGG - Intergenic
1032002508 7:128274590-128274612 AACCAAGATCTGCTGGAGCTTGG - Intergenic
1033572716 7:142648275-142648297 TATCAAGAGCTCAAGGAGATAGG - Intergenic
1034904828 7:154934672-154934694 CAGCTAGAGCTGAAGCAGCTGGG + Intronic
1035355274 7:158272877-158272899 AGTCAATAGCTGATGGGGCTTGG + Intronic
1035398154 7:158548486-158548508 CACCAAGAGCGGGCGGAGCTCGG - Intronic
1035689311 8:1549329-1549351 CATGAGCAGCTGGTGGAGCTCGG + Exonic
1035745358 8:1958726-1958748 CAGCAAGTGGTGATGCAGCTAGG - Intergenic
1036511462 8:9404166-9404188 CAGCAAGAGCTGAGAGAACTTGG - Intergenic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1038408042 8:27336737-27336759 CATGAAGAGCTGATGCAGAAAGG - Intronic
1040829226 8:51659355-51659377 CAGCACAAGCTGATGAAGCTGGG + Intronic
1042137332 8:65644878-65644900 GAACAGGAGCTGAAGGAGCTCGG + Intronic
1042220487 8:66468399-66468421 GAGCAAGAGCTGATCTAGCTAGG + Exonic
1043342169 8:79253028-79253050 CATTAACAGCTGATGGCACTGGG - Intergenic
1046387085 8:113519396-113519418 CATGAGGAGCTGACAGAGCTGGG - Intergenic
1047187324 8:122645821-122645843 CATCAAGATCTGAGGGTACTAGG - Intergenic
1048868979 8:138781733-138781755 CACCAAGTGGTGTTGGAGCTGGG - Intronic
1049364399 8:142229869-142229891 CATCTTGAGCTGAGGGATCTCGG + Intronic
1049797700 8:144504109-144504131 CAGAAAGGGCTGAAGGAGCTGGG - Exonic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1052885252 9:33640324-33640346 TATCAAGAGCTCAAGGAGATTGG - Intergenic
1053800744 9:41762877-41762899 CATCACGACCTGAAGGTGCTTGG + Intergenic
1054144452 9:61551958-61551980 CATCACGACCTGAAGGTGCTTGG - Intergenic
1054189174 9:61975029-61975051 CATCACGACCTGAAGGTGCTTGG + Intergenic
1054464140 9:65482917-65482939 CATCACGACCTGAAGGTGCTTGG - Intergenic
1054649347 9:67613588-67613610 CATCACGACCTGAAGGTGCTTGG - Intergenic
1055023882 9:71698701-71698723 TATGAAGAGCAGATGGACCTGGG + Intronic
1055788281 9:79894755-79894777 CATAAAGAGCTGGTGGAGGCTGG + Intergenic
1059139631 9:111840786-111840808 TAGCAAGTGATGATGGAGCTAGG - Intergenic
1061134168 9:128723863-128723885 CTTCAGGAGCTGGTGGAGATCGG + Intronic
1062273541 9:135720501-135720523 TAGGAAGAGATGATGGAGCTGGG - Intronic
1203787051 EBV:133898-133920 CGGGAAGAGCTGCTGGAGCTGGG + Intergenic
1188422297 X:30005013-30005035 GATCAAAAGCTGAGGGAGATGGG - Intergenic
1189382653 X:40512877-40512899 AATCAAGGGCTGAGGGAGTTGGG + Intergenic
1193234789 X:79093608-79093630 CAGCAGGACCTGATGGAGATAGG + Intergenic
1194554244 X:95337729-95337751 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
1196008385 X:110859537-110859559 AAGCAAAAGATGATGGAGCTGGG + Intergenic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1200050993 X:153431652-153431674 CATAAAGAGCTGAGGGCCCTCGG - Intergenic