ID: 1100971609

View in Genome Browser
Species Human (GRCh38)
Location 12:100076993-100077015
Sequence GAATCACTTATAATCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100971609 Original CRISPR GAATCACTTATAATCCCACA TGG (reversed) Intronic
908167309 1:61471182-61471204 GAAGCACTTAGAATAACACACGG - Intergenic
911930597 1:103898469-103898491 AAATAACTTAGAATCCCACTAGG - Intergenic
912042960 1:105415754-105415776 TAATCACTTACAATCCCACATGG - Intergenic
912096553 1:106151021-106151043 AATTGACTTATAATTCCACATGG - Intergenic
916742382 1:167657577-167657599 AAATTACTAATAATCCCATAAGG - Intronic
921684060 1:218069968-218069990 GCATCTCTTAGAAACCCACAGGG + Intergenic
922878241 1:228958186-228958208 GAATGTCATATTATCCCACAAGG + Intergenic
1065387016 10:25143842-25143864 GAATCACTTTTATCTCCACATGG + Intergenic
1068371461 10:56121638-56121660 GAAATAGTTATAACCCCACATGG - Intergenic
1069092383 10:64216694-64216716 GATTGACTTCTAAACCCACATGG - Intergenic
1074653164 10:115548109-115548131 TAATTGCTTATAGTCCCACACGG - Intronic
1079159719 11:17980529-17980551 AATTCACTCATAATCCCACCTGG + Intronic
1084856018 11:71987000-71987022 GAACCACTTATAAACCAACCTGG - Exonic
1085564265 11:77499190-77499212 AATTCACTTATAATCCTACCAGG + Intergenic
1088076547 11:105856156-105856178 AAATCACTTAGGAACCCACATGG - Intronic
1088634293 11:111804790-111804812 AAAACACTGATAATCCCAAATGG + Intronic
1097432636 12:59528843-59528865 AAATCACTTCTAAAACCACAGGG + Intergenic
1097570873 12:61329720-61329742 GAATCAGTTATAGAACCACATGG + Intergenic
1099537358 12:83860975-83860997 GAATCACTTAAAAGCCCAGGAGG - Intergenic
1099915575 12:88888197-88888219 AAATCCCTTATAATCCCAAAAGG + Intergenic
1100971609 12:100076993-100077015 GAATCACTTATAATCCCACATGG - Intronic
1102503451 12:113368739-113368761 GAGTCCCCTATAATCCTACAAGG - Intronic
1104717591 12:131026303-131026325 GAATCCCTTATTCTCCCAAAGGG + Intronic
1107649358 13:42528519-42528541 GAAACACATATAATCCCTGAAGG + Intergenic
1112841265 13:103581379-103581401 GAATTACCTATAAGCCAACATGG + Intergenic
1114815788 14:25956223-25956245 CAATGAGTTATCATCCCACAGGG + Intergenic
1115232740 14:31178960-31178982 TATTCACTTAAAATCCCAGAAGG + Intronic
1116321424 14:43469781-43469803 GTAGAACTGATAATCCCACAAGG - Intergenic
1118069499 14:62230923-62230945 TAATGACTTACAATTCCACATGG - Intergenic
1120044135 14:79787879-79787901 GAATGAGTAATAATCTCACAAGG + Intronic
1120804765 14:88735519-88735541 GAACTAATTATAATCCCAAAAGG - Intronic
1122993694 14:105250977-105250999 GAACCACTTAGAATCCAAGAGGG - Exonic
1123177996 14:106440239-106440261 GAAGCACACATATTCCCACAGGG - Intergenic
1124005627 15:25793500-25793522 GAACTACTTATAATCACTCAGGG - Intronic
1124600129 15:31127153-31127175 GAATCACCTAGAAACCCAGAAGG - Intronic
1125399507 15:39285582-39285604 GGATCACTAATAATCACAAAAGG + Intergenic
1126345298 15:47687294-47687316 GAAGCACTTAGAATGCAACAGGG + Intronic
1128796365 15:70469582-70469604 GCATCACTTTTAACTCCACATGG + Intergenic
1129457709 15:75684417-75684439 GAATCACTTACAAGCCCTTAAGG - Intronic
1130274154 15:82467952-82467974 GAATCACTTACAAGCCCTTAAGG + Intergenic
1130466500 15:84195326-84195348 GAATCACTTACAAGCCCTTAAGG + Intergenic
1130497764 15:84478210-84478232 GAATCACTTACAAGCCCTTAAGG - Intergenic
1130588796 15:85199919-85199941 GAATCACTTACAAGCCCTTAAGG + Intergenic
1132142231 15:99405612-99405634 GCAACACTTATAATCCAACAAGG + Intergenic
1133253260 16:4498904-4498926 CAATCAGTTCTAATCCAACAAGG - Intronic
1133831555 16:9328011-9328033 GAATCACCTTTTATCTCACAAGG + Intergenic
1138222108 16:55260686-55260708 GCATCTCTTCCAATCCCACAGGG + Intergenic
1138701770 16:58870734-58870756 GAATAACCTATAATGCAACATGG - Intergenic
1145893111 17:28432617-28432639 GGATCACTTATTATCCTACATGG - Intergenic
1150313934 17:64152910-64152932 GAATCACTTATTGTCCCTGAGGG + Intronic
1151186202 17:72365759-72365781 GAATCATTTGGAATCCCACTTGG - Intergenic
1153067088 18:1058572-1058594 GATTGACTCATAATTCCACATGG + Intergenic
1153337586 18:3940364-3940386 TAATCACTTGTTACCCCACAGGG - Intronic
1153786643 18:8541365-8541387 AAATCAGTTATAATCCCAAAGGG - Intergenic
1154113325 18:11589467-11589489 GAATCTTTAATATTCCCACAAGG + Intergenic
1155238015 18:23841095-23841117 GAATCAAATAAAATCCCATATGG + Intronic
1155802198 18:30120955-30120977 GAATCAGTCAAAATCCCAGAAGG + Intergenic
925881742 2:8358432-8358454 GAATCACATAAAATGCCACGAGG + Intergenic
930325326 2:49909459-49909481 GAATTTTTTAGAATCCCACATGG + Intergenic
930484511 2:51995525-51995547 GAATGACTCAGAATCCCACTGGG - Intergenic
930499301 2:52191939-52191961 GTATCACTAATAATCTCATAAGG - Intergenic
934011724 2:87826450-87826472 GAATCATTTGTAAACCAACAAGG - Intergenic
938660179 2:133478553-133478575 GAATCAATTATAGTCCACCAGGG + Intronic
939373916 2:141339221-141339243 GAATCACTTATAATCTAATTAGG - Intronic
944701078 2:202246636-202246658 TAATGACTTATAGTTCCACATGG - Intergenic
945531074 2:210953138-210953160 GAATTAATCTTAATCCCACAGGG - Intergenic
1172559293 20:35871795-35871817 AAATCTCTTGTAATTCCACAAGG - Exonic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1177898075 21:26879008-26879030 GAATCACTTAAATACCCACATGG - Intergenic
1178761722 21:35409475-35409497 GAATGATTTATAATCCCTCTGGG + Intronic
1179280438 21:39929657-39929679 GAATCAGTCATAATTCCCCAGGG - Intergenic
1184892125 22:47386528-47386550 AAATGACTTTTGATCCCACATGG + Intergenic
951753864 3:26067579-26067601 GCACCACTTATAATGCCTCAAGG - Intergenic
952170514 3:30801622-30801644 ACATCAGCTATAATCCCACAGGG + Intronic
958135685 3:89487044-89487066 GAATAGCTAATAATCACACAAGG + Intergenic
965655157 3:170975804-170975826 GAATGACTTCTGAGCCCACAAGG + Intergenic
969634297 4:8357445-8357467 ATATCACTTATAACTCCACATGG - Intergenic
970616365 4:17771867-17771889 AAGTCACTTATAACCCAACACGG - Intronic
970968538 4:21954691-21954713 GAATCACTTATTATCTCATTAGG + Intergenic
971015203 4:22481961-22481983 AAATTACATTTAATCCCACATGG + Intronic
971609380 4:28702821-28702843 AAATCTCTTAGAATCTCACAAGG + Intergenic
972160058 4:36213762-36213784 ATATCACTTAAAATCCCAGAAGG + Intronic
972786296 4:42329653-42329675 AAATCACTTATAGTTACACAAGG + Intergenic
974321228 4:60352901-60352923 GCTTCACTTAAAAGCCCACAGGG + Intergenic
975737458 4:77395021-77395043 GAATTCCTTATAATCCTAGAGGG - Intronic
976379496 4:84383244-84383266 GAATCAATGATAATCCATCAAGG + Intergenic
976961678 4:90983920-90983942 GAATTACTTGTAATCTCTCAAGG - Intronic
977643796 4:99388411-99388433 TAATCACATATGTTCCCACAAGG + Intergenic
978314325 4:107418733-107418755 GACACACTTAGAGTCCCACAGGG + Intergenic
980416959 4:132502134-132502156 AAATAACTTATGATCCTACAGGG - Intergenic
984949705 4:184997993-184998015 GAATGATTTATAATCCCCAATGG + Intergenic
985692492 5:1321205-1321227 GAGGCACTTCTAATCCCACACGG + Intronic
988935706 5:36080545-36080567 GAAGCAATTATATACCCACATGG - Intergenic
990020973 5:51127417-51127439 GACTGACTCATAGTCCCACATGG - Intergenic
990044045 5:51406747-51406769 GTAGCACTTATAATCACACTAGG + Intergenic
997510036 5:134447831-134447853 GAATCACTTGGAAACCTACATGG - Intergenic
997686497 5:135791802-135791824 ATATTACTTATAATGCCACAGGG + Intergenic
998537744 5:142950298-142950320 TAATCAGTTTTAATCCAACATGG - Intronic
999885633 5:155919944-155919966 GAATCACTGCAAATGCCACAGGG - Intronic
1005110952 6:22281006-22281028 GAAACTCTCATAATACCACAAGG - Intergenic
1006746252 6:36344871-36344893 GAATCGCTTAAAATCCCAGGAGG - Intergenic
1010014904 6:71093194-71093216 GAATTAATTATACTGCCACACGG - Intergenic
1012666763 6:101980742-101980764 GAAACAGTTATAATGCCACGTGG + Intronic
1014569753 6:122994934-122994956 TAATCACTTAAAATCCTAGAAGG + Intergenic
1014661642 6:124180251-124180273 AATTGACTTACAATCCCACATGG + Intronic
1015054945 6:128889203-128889225 GAATTATTCACAATCCCACATGG + Intronic
1025070613 7:55894992-55895014 AAATCACTTATAATATCACCTGG - Intronic
1033026187 7:137775160-137775182 GAAGAACTAATAATGCCACATGG - Intronic
1033458551 7:141524612-141524634 GTATCAATTATACTCCCACCAGG + Intergenic
1036110742 8:5898696-5898718 GAATCTCTTAAAATCCACCAAGG + Intergenic
1043276671 8:78405140-78405162 GAAACATTTAGAATGCCACAAGG - Intergenic
1048031177 8:130633755-130633777 TGATCACTTATACACCCACAAGG + Intergenic
1050097287 9:2079822-2079844 GAATAACTTGTAATGCCACATGG + Intronic
1051396504 9:16627668-16627690 GAAACACTTCTAATACCACAGGG - Intronic
1055068290 9:72141059-72141081 GAATCACTCATTCTCCCCCATGG - Intronic
1055676022 9:78662178-78662200 GAAGCACTTAATATCCCCCATGG - Intergenic
1186221863 X:7357382-7357404 GAATCACTTATAATCAATCCTGG - Intergenic
1187327284 X:18302706-18302728 CAAGCACCTATAATCCCACCTGG + Intronic
1189427411 X:40913625-40913647 GAATCTCTTTTAAATCCACAGGG + Intergenic
1190568702 X:51759801-51759823 GCATGACTAATAATCCCACTTGG - Intergenic
1193246126 X:79232231-79232253 GTACCACTGATATTCCCACAAGG + Intergenic
1197159258 X:123305522-123305544 GAATCCCTTATAATTGGACAAGG - Intronic
1199132760 X:144212097-144212119 GAATCATTTGTAAACCAACAAGG + Intergenic
1200272072 X:154695452-154695474 GAATCACTTAGAGTCCCATTGGG - Intronic
1200752758 Y:6961823-6961845 GAATCCCCTATAATTCCCCAAGG - Intronic
1201541818 Y:15112955-15112977 GAATCACATATAGACCCATAAGG - Intergenic