ID: 1100971997

View in Genome Browser
Species Human (GRCh38)
Location 12:100080222-100080244
Sequence TTTTCCAGGCACATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 4, 1: 7, 2: 24, 3: 45, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100971997_1100972003 23 Left 1100971997 12:100080222-100080244 CCTTGCACCATGTGCCTGGAAAA 0: 4
1: 7
2: 24
3: 45
4: 271
Right 1100972003 12:100080268-100080290 AGTCCATGAAAGCAGCCAAGAGG 0: 1
1: 59
2: 396
3: 760
4: 1303
1100971997_1100972005 27 Left 1100971997 12:100080222-100080244 CCTTGCACCATGTGCCTGGAAAA 0: 4
1: 7
2: 24
3: 45
4: 271
Right 1100972005 12:100080272-100080294 CATGAAAGCAGCCAAGAGGAAGG 0: 4
1: 44
2: 301
3: 612
4: 1285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100971997 Original CRISPR TTTTCCAGGCACATGGTGCA AGG (reversed) Intronic
900313743 1:2047214-2047236 TTCTCCAGGCACCTGGCACACGG - Intergenic
903886918 1:26546076-26546098 CTTCCCAGGCACCTGCTGCAAGG - Intronic
904275330 1:29380094-29380116 TTTTCCATGCACTTGGTGCTGGG + Intergenic
906083374 1:43108633-43108655 TTTTCCAGGTGCACAGTGCAAGG + Intergenic
906139779 1:43527178-43527200 TGTTCCAGCCCCAGGGTGCAGGG - Intronic
907398314 1:54208002-54208024 TTTTCCAGGCACATTTTGTCTGG + Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908946630 1:69505928-69505950 GTTTCCAGGGACATGGCCCACGG + Intergenic
909152434 1:72025498-72025520 GTTTTCAGGCACATAGTGCCTGG + Intronic
909235892 1:73152472-73152494 TTTTCCAGGTGCATGGTGCAAGG + Intergenic
909271545 1:73628830-73628852 TTTTCTAGGTGCATTGTGCAAGG + Intergenic
909728938 1:78870951-78870973 TTTTCCAGGCTAAGAGTGCAAGG + Intergenic
909751408 1:79165829-79165851 TTTTCCAGGCACACAGTGCAAGG - Intergenic
910141264 1:84029767-84029789 TTTTCAAGTCACATGGTAAATGG - Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
912102969 1:106234273-106234295 TTTTCCAGGGGAAGGGTGCAAGG - Intergenic
914910250 1:151779838-151779860 TTTTCCCCTCACATGGTGAAGGG + Intronic
917189922 1:172404507-172404529 TGTCCCAGCCACATGGTCCAAGG + Intronic
917710781 1:177681845-177681867 GTTTCCAGGCAGATGGAGAAGGG + Intergenic
921531304 1:216285644-216285666 TTTTCCAGGCACACGATGCAAGG - Intronic
921594246 1:217037747-217037769 TTTTACAGGCTCTTGGTGGAAGG - Intronic
923826816 1:237509508-237509530 TTTCCCAGGAGTATGGTGCAAGG + Intronic
924434726 1:244028903-244028925 TTATCCAGGCAAAGGCTGCAGGG - Intergenic
924806637 1:247366686-247366708 TTTTCCAGGTGCATGGTGGAAGG - Intergenic
1063948486 10:11200581-11200603 TTACCCAGGAACATGGTGCAGGG + Intronic
1064970476 10:21061001-21061023 GTTTCCAGGCACCTGGTGTTAGG - Intronic
1066226103 10:33385318-33385340 TTTTCCAGGTATTTGGTGCTAGG + Intergenic
1066463044 10:35629039-35629061 TTTTCCAGGCAGATGCTTTAAGG + Intergenic
1067447725 10:46362604-46362626 TTTGCCAGGGACATGGGGAAGGG + Intergenic
1067920819 10:50455438-50455460 TTTACCAGACAGTTGGTGCAGGG - Intronic
1068221585 10:54052255-54052277 TTTTCTAGGCACATGGTACAAGG - Intronic
1069029959 10:63585192-63585214 CTTTCCAGGCACAGGGTGCTAGG + Intronic
1069603785 10:69726954-69726976 TTTTCCTTGGACATGGTGCTTGG + Intergenic
1070083024 10:73207246-73207268 CTTTCTAGGTACAGGGTGCAAGG - Intronic
1071235098 10:83636358-83636380 TATTCCAGGCACTTGGAGTACGG + Intergenic
1071243550 10:83737879-83737901 TTTTCCAGGCACATCCTTAACGG + Intergenic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1071683096 10:87727365-87727387 TTGTCCTGGCACATGGTGGACGG + Exonic
1071962847 10:90823506-90823528 TTTTACAGGCTCATAGTGGAAGG + Intronic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1075651968 10:124133245-124133267 TTTTCCTGCCCCATGGTTCAAGG + Intergenic
1078718839 11:13864816-13864838 TTTTCCATGGACATGGGGGATGG - Intergenic
1079170607 11:18091625-18091647 TTTTCTAGGCAAAGGGTTCATGG - Intronic
1081097597 11:38958095-38958117 TTTTCCAGGCAAATGGGAAAAGG + Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1081495287 11:43602999-43603021 TTTTCCAGGCACAGGGAGGCTGG + Intronic
1084247801 11:67872041-67872063 TTTTCCAGGCACAGACTACAGGG - Intergenic
1085000379 11:73028162-73028184 TTTTCCAGGTACATGGTGTGAGG - Intronic
1085582456 11:77666684-77666706 TTTTCCAGGTTCATGGTCCTTGG - Exonic
1086595134 11:88561486-88561508 ATTTCCAGGCACATGGAACTGGG - Intronic
1086848632 11:91782855-91782877 TTTTCCAGGTGGATGGCGCAAGG + Intergenic
1087447040 11:98268614-98268636 TTTTCCAGGTGCATAGTGCAAGG + Intergenic
1087497637 11:98910402-98910424 TTTTCCAGGTGCTTGGTGCAAGG - Intergenic
1087511552 11:99101781-99101803 TTTTCCAGGCACATGGTGTGAGG + Intronic
1087763714 11:102127728-102127750 TTTTCCAGGAGCACGATGCAAGG - Intronic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1089919363 11:122193818-122193840 TTTTCCAGCCTCATGGAGGAAGG + Intergenic
1091206581 11:133825360-133825382 TGTTCCAGGAAGCTGGTGCATGG + Intergenic
1091852954 12:3715126-3715148 GGTTCCAGGCACTGGGTGCATGG + Intronic
1091983013 12:4881810-4881832 TTTTCCAGGCACCTGATTCCTGG - Intergenic
1092418083 12:8307436-8307458 TTTTCCAGGCACAGACTACAGGG - Intergenic
1093234241 12:16586455-16586477 TTGTCCAGACACATTGTCCAGGG - Intronic
1095359453 12:41318946-41318968 TCTTCCAGAAACATGGTACAAGG - Intronic
1098521098 12:71436295-71436317 TTTTCCAGACACATGGTGCAAGG + Intronic
1099075414 12:78102146-78102168 TTTTACAGGCTCATAGTGGAAGG - Intronic
1099164314 12:79284222-79284244 TTTTATAAGCACATGGTGTAAGG + Intronic
1099214644 12:79838972-79838994 TTTTCTAGGCACACAGTGCAAGG - Intronic
1099470993 12:83047759-83047781 TTTACAAAGCACATGTTGCATGG + Intronic
1100747391 12:97661196-97661218 TTTTGCAGGCTCAAGGTGTAAGG - Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1101189442 12:102316192-102316214 TTTCCCTGGCTCATGGGGCAAGG - Intergenic
1101210861 12:102534157-102534179 CTTTCTAGGTACATGGTGTAAGG - Intergenic
1102515461 12:113443310-113443332 TTTTCCATGCTCATGGTGATTGG + Intergenic
1102747946 12:115266422-115266444 TATTGCAGGCCCATGGTGCATGG + Intergenic
1104757952 12:131280604-131280626 TTTTCCAGGTACCTGAGGCACGG - Intergenic
1106218288 13:27722312-27722334 GTTTCCAGGAACATGGTGGGGGG - Intergenic
1107570646 13:41654438-41654460 TTTTCCAGGGACAGGGTAGAGGG + Intronic
1107737329 13:43413477-43413499 TTTTCCAGCTGCATGGTGAATGG - Intronic
1108828876 13:54452470-54452492 TTTTCCAGGCCCTCAGTGCAAGG + Intergenic
1109632833 13:65075462-65075484 TTTCCCATGCAAAGGGTGCATGG + Intergenic
1109904171 13:68816603-68816625 TTTTCCATGCACTAGGGGCAAGG + Intergenic
1110487945 13:76068472-76068494 TTTTCCAGGTGCACAGTGCAAGG - Intergenic
1110507067 13:76299307-76299329 TTTCTCAGGCAGATGGTCCAAGG - Intergenic
1111123406 13:83881720-83881742 CTATCCAGGCACGTAGTGCAAGG + Exonic
1111343156 13:86914239-86914261 TTTTCCAGGTGCACGGTGCAAGG - Intergenic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1112915885 13:104549972-104549994 CTATCCAGGCACATGGAGCATGG - Intergenic
1113923844 13:113929538-113929560 TTTCCCAGGCACTTGGGCCAAGG + Intergenic
1114361573 14:21979238-21979260 TTTTGAAGGCACATAGGGCAGGG + Intergenic
1114516908 14:23306484-23306506 TTTTCCAGGCACACAGTTCAGGG + Intronic
1114972049 14:28043638-28043660 TTTGCCAGGTACTTGGTGAAAGG + Intergenic
1115068551 14:29294846-29294868 TTTTCCAGGTGCATAGGGCAAGG - Intergenic
1115178464 14:30593538-30593560 AATTCCAAGCAAATGGTGCATGG - Exonic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1115989915 14:39141087-39141109 TTTTACAGGCTCATGGGGGAAGG - Intergenic
1117697015 14:58375952-58375974 TGTTCCAGGGACATGGGGGAGGG + Intergenic
1117751629 14:58929922-58929944 TTTTCCAGGTGAATGGTGAACGG + Intergenic
1118643498 14:67815963-67815985 TTTTCCCAGCACAGAGTGCAGGG + Exonic
1119696208 14:76715223-76715245 TTTTCCATTCACATGGCACAGGG + Intergenic
1120144367 14:80963418-80963440 TTTACCCATCACATGGTGCATGG + Intronic
1123839120 15:24228758-24228780 TTATTCAGGAACATGGTGTATGG - Intergenic
1124072219 15:26406035-26406057 TATGCCAGGCACATGGGGGAAGG + Intergenic
1124702420 15:31927609-31927631 TTTGCCAGGCTCATGGCACACGG - Intergenic
1125233394 15:37483812-37483834 TTTTCCACGCACATGGTTCAAGG + Intergenic
1125737087 15:41934288-41934310 ACTTCCTGGCACATGGTTCAGGG - Intronic
1126354537 15:47781419-47781441 TTTGCCACTCACATGGTGGAAGG - Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127525592 15:59789752-59789774 TTTTACAGGCTCATGGTAGAAGG + Intergenic
1127659757 15:61089504-61089526 TCTTTCAGGAACTTGGTGCAAGG + Intronic
1129767597 15:78180250-78180272 TTTCACAGGCACATGGGGAATGG + Intronic
1130196088 15:81781469-81781491 TCTTCCAGGCATGTGGTTCAGGG + Intergenic
1130795051 15:87198873-87198895 TTTTCTCGGCACTGGGTGCATGG + Intergenic
1133357438 16:5147037-5147059 TTTTCCAGGCACAGACTACAGGG - Intergenic
1133794208 16:9033192-9033214 TTTTCCAGGTGCGTGGTGCATGG - Intergenic
1134331934 16:13259377-13259399 TTTTTGAGGCACATAGTGCAAGG + Intergenic
1135293040 16:21256576-21256598 TGTTACAGGAACATGGTTCAGGG - Intronic
1139117848 16:63978820-63978842 TTTTCAAGGCCCAGGGTTCAAGG - Intergenic
1139281688 16:65775976-65775998 TTTTCCAGGATCATATTGCATGG - Intergenic
1140251586 16:73299288-73299310 TTTTCCAGGGACATTTTGCTTGG + Intergenic
1140938540 16:79698819-79698841 TGTTCCAGCCTCATGGTGAAAGG + Intergenic
1142170451 16:88619374-88619396 GCTTCCAGGCCCATGGAGCAAGG - Intronic
1142249112 16:88983059-88983081 TGTTCCCGGCACAAGGCGCAGGG + Intergenic
1143296028 17:5872805-5872827 TTTTCCACACATATGGTGGAAGG - Intronic
1144300825 17:13921990-13922012 TTTTATAGGCACAGGATGCAGGG - Intergenic
1145779777 17:27554747-27554769 TTTTCCAGGGACAGGGAGCGGGG - Intronic
1146408075 17:32556971-32556993 TTTTACAGACAAATGATGCAGGG + Intronic
1148111383 17:45146398-45146420 CTTTCCTGGCACATGATGCTTGG + Intergenic
1150816014 17:68392344-68392366 TTTTTAAGTCATATGGTGCAAGG - Intronic
1150987046 17:70210513-70210535 TTTTCCAGTCTCTTTGTGCATGG - Intergenic
1151226909 17:72654720-72654742 TTTGCCAGGCACTTGGTGGCTGG + Intronic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1155213857 18:23625220-23625242 TGGGCCAGGCACACGGTGCAAGG - Intronic
1156817608 18:41329253-41329275 TTTTACAGGCTCATTGTGGAAGG + Intergenic
1157185524 18:45537112-45537134 TTTGCCAGGCACATTGTCCTAGG + Intronic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1159315150 18:66763519-66763541 ATTACCAGGCACATGGTGCCAGG - Intergenic
1159606364 18:70478857-70478879 TTTTACAGGCTCATGGTGGAAGG + Intergenic
1159756378 18:72370951-72370973 TTTTCCAGGTGCACGGTGCAAGG - Intergenic
1159765267 18:72481136-72481158 TTTTCCAGGTGCACGGTGAAAGG - Intergenic
1161140232 19:2642897-2642919 TTTCCGGTGCACATGGTGCAGGG - Intronic
1161140304 19:2643273-2643295 TTTCCGGTGCACATGGTGCAGGG - Intronic
1162530234 19:11231751-11231773 CTTTCCAGGTACCTGGTGTAGGG - Intronic
1163127205 19:15250798-15250820 TCTGCCAAGCACATGGGGCAGGG - Intronic
1163391099 19:17030333-17030355 TTTTCCATGGACAAGGGGCAAGG + Intergenic
1165974741 19:39665874-39665896 TTTTCCAGGCTCATGGTGCAAGG + Intergenic
1167167077 19:47805535-47805557 TTGACAAGGCTCATGGTGCAGGG + Intronic
1167826205 19:51975859-51975881 GTTTACAGGCACCTGCTGCAGGG + Intronic
925318935 2:2947016-2947038 GTCTCAAGGCACATGGGGCAAGG + Intergenic
927520368 2:23694746-23694768 TCTGCCAGGCACAAGGTGGATGG - Intronic
930007380 2:46909044-46909066 TTATCCAGGCCCATGCTGCCGGG + Exonic
930456684 2:51614948-51614970 TTTTCCAGGAGCATGGTGCAAGG + Intergenic
930484886 2:51999142-51999164 TTTTCTAGGCACATGGTGCAAGG - Intergenic
931154150 2:59608459-59608481 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
931926138 2:67074574-67074596 TTTGCCAATCACATGGTTCAGGG - Intergenic
931949790 2:67349885-67349907 TTTTCCAGGCACACAACGCAAGG + Intergenic
932317974 2:70798824-70798846 TTTTCCAGGCACACAGTGCAAGG + Intergenic
933029725 2:77313217-77313239 TTTTCCTGGGACCTGGTGCTGGG + Intronic
933029745 2:77313293-77313315 TTTTCCTGGGACCTGGTGCTGGG + Intronic
933029758 2:77313331-77313353 TTTTCCTGGGACCTGGTGCTGGG + Intronic
933181345 2:79230684-79230706 TTTTCCAGGCACATGGTACAAGG - Intronic
933454393 2:82502491-82502513 TTTTCCAGGCACATAGTGTAAGG - Intergenic
935209164 2:100923641-100923663 TTTTCCAGGCACCTTGGGCCCGG - Intronic
935231956 2:101106714-101106736 TTTCCCAGGCTAGTGGTGCAAGG + Intronic
936728852 2:115357242-115357264 TTTTACAGGCACTAGGTGGAAGG - Intronic
937643093 2:124235899-124235921 TTTGCAACCCACATGGTGCATGG + Intronic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
939835612 2:147125824-147125846 TTTTCCAGGCTCACGGTACAAGG - Intergenic
940186241 2:150987009-150987031 GTTTCCAGGTACAGGGTGCTTGG - Intergenic
941862062 2:170293008-170293030 TTTTCCACACACTTGTTGCAGGG + Intronic
941888428 2:170553245-170553267 TTTTCTAGGCACATAGTGCAAGG - Intronic
942800003 2:179863582-179863604 GTTTCCAGGAAAATGGTGCTTGG - Intergenic
943417834 2:187630696-187630718 TTTTCCAGGAGCATGGTGTAAGG - Intergenic
944315339 2:198279163-198279185 TTTTCCCGATACATGGTCCAAGG + Intronic
944921531 2:204419068-204419090 TTTTCCAGGGAAATTGTGCCTGG - Intergenic
947903199 2:233739692-233739714 TTTTACAGGCTCATGGGGGAAGG + Intronic
947904614 2:233751349-233751371 TTTTACAGGCTCATGGGGGAAGG + Intronic
948773230 2:240263150-240263172 TTTTGCAAGCACATGATGCAAGG - Intergenic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1172495594 20:35381382-35381404 CTTTCCAGGCCCTTGCTGCATGG - Intronic
1173066564 20:39718685-39718707 CTTTGCAGGCACATGGAGAAGGG + Intergenic
1175167526 20:57055294-57055316 TGTTCTTGGCACAAGGTGCAAGG + Intergenic
1177406413 21:20673730-20673752 TATCCAAGGCACATGGTGCAAGG - Intergenic
1177473874 21:21593813-21593835 TTTTCCAGGCACAAGGTACAAGG + Intergenic
1177564165 21:22796517-22796539 TTTTATAGGCACAGGATGCAGGG + Intergenic
1177606072 21:23379187-23379209 TTTTCTAGGCACACAGTGCAAGG - Intergenic
1178614060 21:34114955-34114977 CTTAGCAGGCACTTGGTGCAGGG + Intronic
1179273925 21:39873678-39873700 TTTTCCAGTCACCTGGCACAAGG + Intronic
1179634091 21:42696385-42696407 TTTTCTAGGGACAAGGGGCAGGG + Intronic
1179882269 21:44297882-44297904 ATTTCCAGGCACATGATGGCTGG - Exonic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1181318992 22:21990431-21990453 TATTCCACCCACATGGTGCTGGG + Intergenic
1181893517 22:26085806-26085828 TTTTAAAGGCACATGGAGCTGGG - Intergenic
1182341453 22:29624539-29624561 CTTTACAGGCACTTGGTTCAGGG + Intronic
1182628022 22:31662464-31662486 TTTTCCAGGTACATGAGGAAAGG - Intergenic
1183052014 22:35270507-35270529 TTTTCCATGGACCTGGGGCAGGG - Intronic
1183724417 22:39580585-39580607 TTTTCCAGGCAGAGGGAACACGG + Intronic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
950787648 3:15449684-15449706 TTTCCCAGGTACCTGGAGCATGG + Intronic
952114633 3:30163910-30163932 TTTCCAGGTCACATGGTGCAAGG - Intergenic
954878105 3:53816500-53816522 TTCTACAGCCACAGGGTGCATGG + Exonic
956248058 3:67205832-67205854 CTTTCCAGGCACTTGGTGCAGGG - Intergenic
956327487 3:68069991-68070013 TTTTCCAGGCGCATGGTGCAAGG + Intronic
956354704 3:68378187-68378209 TTTTCAAGGCACATGGTTCAAGG - Intronic
956475000 3:69610290-69610312 TTTTCCAAGCACACAGTGCGAGG - Intergenic
956880592 3:73507315-73507337 TTATCCAGGCATATGGTGGCAGG - Intronic
956938493 3:74131324-74131346 TTTTACAGGCTCATAGTGGAAGG - Intergenic
957062009 3:75489866-75489888 TTTTCCAGGCACAGACTACAGGG - Intergenic
957765698 3:84621591-84621613 TTTTGCAGGAATATGGTGCAAGG + Intergenic
958721674 3:97851527-97851549 TTTTCCAGGCAAAGAGAGCAAGG + Intronic
959788444 3:110329203-110329225 TTTTCCAGGCACACAGTGTGAGG - Intergenic
959923125 3:111891644-111891666 TTTTCCATGGACATGGGGGAGGG - Intronic
960695559 3:120393031-120393053 TTTTCCCAGAACATGGTGGAAGG + Exonic
960858044 3:122123164-122123186 TTTTCCAGGCGCATGGTTGGTGG - Intergenic
961291394 3:125849535-125849557 TTTTCCAGGCACAGACTACAGGG + Intergenic
962156831 3:132956835-132956857 TATTCCAGGCACACGGGGCAGGG - Intergenic
962288051 3:134105164-134105186 TTTTGCAGGCACATTGTTCTTGG - Intronic
964729948 3:159854166-159854188 ATTTCCAGGCCCATGATGGAAGG - Intronic
964926451 3:161963888-161963910 TTTTATAGGTGCATGGTGCAAGG - Intergenic
965194048 3:165571927-165571949 TTTTCCAGGGACTTGGGGGAAGG + Intergenic
967577240 3:191108114-191108136 TTTTCCAGTCTCAGGATGCAAGG - Intergenic
969005902 4:4019957-4019979 TTTTCCAGGCACAGACTACAGGG - Intergenic
969807047 4:9617333-9617355 TTTTCCAGGCACAGACTACAGGG + Intergenic
970068240 4:12123988-12124010 TTTTCCTGGCACATGGGAGAAGG + Intergenic
970291153 4:14573704-14573726 GTTTCCAGGCTCAAGGTGAAAGG - Intergenic
970487019 4:16535079-16535101 TTTTCCATGCATCTGGAGCAAGG + Intronic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
971720881 4:30244192-30244214 TTTTCGAGGTGCATGGTGTAAGG + Intergenic
971996564 4:33972919-33972941 TTTTCTAGCTACATGGTACATGG - Intergenic
974843442 4:67323641-67323663 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
975039766 4:69731385-69731407 TTTTCCATGAACAGGGTGCAAGG - Intronic
975417606 4:74123186-74123208 ATTTCCAGTAACATAGTGCAAGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976442316 4:85089402-85089424 TTTTCCAGGTGCACCGTGCAAGG - Intergenic
976833927 4:89348444-89348466 TTTTCTATGCACTTGGTGCTGGG + Intergenic
978768688 4:112431592-112431614 TTTTCTTGGCCCCTGGTGCAGGG + Exonic
981242437 4:142493388-142493410 TTTTCTAGGTGCATAGTGCAAGG - Intronic
982830431 4:160053352-160053374 TTTTCCACTGACATGGTTCATGG - Intergenic
985429964 4:189869919-189869941 TTTACCATGAACATGGTGAAAGG + Intergenic
986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG + Intergenic
986360806 5:6976063-6976085 TTTTACAGGCTCTTGGTGGAAGG + Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
986869190 5:12027725-12027747 TTTTCCAGGCACAAGGTCCAAGG + Intergenic
987102528 5:14604906-14604928 TTTCCCAGGTGCATGGTGCAAGG + Intronic
987541522 5:19261692-19261714 TTTTACAGGCTCTTGGTGGAAGG + Intergenic
987863023 5:23509025-23509047 TTTTCAGGGCTCATGGTGCTGGG - Exonic
989726811 5:44597136-44597158 TTTTCCAGGTGCACAGTGCAAGG + Intergenic
990125967 5:52518255-52518277 TTTTTCAGGCGCATGGTGCAAGG - Intergenic
990376736 5:55177885-55177907 TTTTCAAGGGACTTGGGGCAGGG - Intergenic
991119382 5:62993947-62993969 TTTTCCAGGAGCATGGTGCAAGG + Intergenic
991149417 5:63349014-63349036 CTTTCTAGTCATATGGTGCATGG + Intergenic
992435328 5:76750659-76750681 TCTGCCAGGCACATGGGACATGG + Intergenic
994440761 5:99800347-99800369 TTTTCCAGGTGCACAGTGCAAGG + Intergenic
995179766 5:109219916-109219938 TTTTCCATGGACAGGGTGTAAGG - Intergenic
995988734 5:118210115-118210137 TTTTCCAGGTGCAAGGTTCAAGG - Intergenic
996191627 5:120550385-120550407 TTTTACAGGCACAGGGTGTAGGG + Intronic
997619091 5:135273141-135273163 ACTGCCAGGCACATGGTGCTGGG + Intronic
999926175 5:156380911-156380933 TTTTCCAGGCATTGTGTGCATGG + Intronic
1000336535 5:160245646-160245668 TCTTCCAGGCACCTGGTGCCAGG + Intergenic
1001684877 5:173585901-173585923 CTTTCCAGGAGTATGGTGCAAGG + Intergenic
1001704742 5:173733728-173733750 TTTTTCAGGAACATGGTCCCTGG - Intergenic
1002986782 6:2197557-2197579 TTGTGAAGGCAAATGGTGCAGGG - Intronic
1003092248 6:3114110-3114132 TTTCCCAGGCAGTTGTTGCAAGG + Exonic
1003868081 6:10381543-10381565 TTTCCCAGGCCCAGGGTGCGCGG + Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004271261 6:14197839-14197861 TTGCCAAGGCACATGGTGCCTGG + Intergenic
1006085217 6:31590215-31590237 TTCTCCAGGCATAGGGTGCATGG + Intronic
1009816914 6:68748638-68748660 TTTTCCAGGTGCATGGTGCAAGG + Intronic
1010452603 6:76019566-76019588 TTGTCCATGCCCATGGTGGAGGG - Intronic
1011378551 6:86718336-86718358 TTTTACAGGCTCATAGTGGAAGG - Intergenic
1011542491 6:88447093-88447115 TTTTCCAGTCACAAGGTCCCTGG - Intergenic
1012622068 6:101357542-101357564 TTTTCCAGGAACCTGGCACAAGG - Intergenic
1013950924 6:115780962-115780984 ATTTCCTGACACATGGTACATGG + Intergenic
1015045147 6:128767964-128767986 TTTTCCAGGTGCATGGTACAAGG + Intergenic
1015330566 6:131973972-131973994 TTTTGCAGCCTCATGGTGCTGGG + Intergenic
1016071656 6:139746754-139746776 TTTTCCAGGCAGATGGTAGCGGG + Intergenic
1016155411 6:140800595-140800617 TTTTCCACACACTTAGTGCAGGG + Intergenic
1016219333 6:141647018-141647040 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
1016373686 6:143399077-143399099 TTTTCCAGGTACCTGGCCCAGGG - Intergenic
1017168390 6:151432082-151432104 TTAGCCAGGCACATGGTGGAGGG - Intronic
1019987993 7:4672136-4672158 TGTGCCCAGCACATGGTGCATGG + Intergenic
1021902892 7:25305098-25305120 TTTTGCAGGCAAATGATCCACGG - Intergenic
1022206155 7:28165618-28165640 TGTTCCAGGCAGAGGCTGCAAGG - Intronic
1022703318 7:32781443-32781465 TTTTACAGGCTCATGGTGGAAGG - Intergenic
1022844887 7:34200122-34200144 TTTGCCTGGCATATAGTGCATGG + Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023749159 7:43353649-43353671 TTTTCCATGCACTTGGTGCCAGG - Intronic
1024083887 7:45877920-45877942 TTTTACAGGCCCAAGGTGAAAGG - Intergenic
1024098324 7:46004225-46004247 TGTGCCAGGCACATGGTGGTAGG + Intergenic
1024336992 7:48219031-48219053 TATTCCAGGCACCGTGTGCAGGG + Intronic
1024887267 7:54158302-54158324 TTTCCCAGGCAAAAGATGCAGGG + Intergenic
1025812885 7:64886502-64886524 TTTACTGGGCACCTGGTGCAGGG + Intronic
1026215508 7:68344874-68344896 TTTAGCAGGCTCATGGTGCCAGG + Intergenic
1026896072 7:74010745-74010767 TTTCCCAGGCAGGTGGTGCAGGG - Intergenic
1030287863 7:107845015-107845037 TGCTCCAGCCACATGGTTCAGGG + Intergenic
1030829858 7:114208082-114208104 TTTTCCAGGTACACAGTGAAAGG - Intronic
1031287239 7:119885742-119885764 TTTCCCACGCACATGGTACAAGG + Intergenic
1031831856 7:126637632-126637654 TTTTCTAGCCACATGTTTCAGGG - Intronic
1035445183 7:158936449-158936471 TTTTCCATGCACTTGGTGCCAGG - Intronic
1035951778 8:4030119-4030141 TTTTCCAGGTGCATGATGCAAGG + Intronic
1036843293 8:12142704-12142726 TTTTGCAGGCACATGGATGAAGG - Intergenic
1038684356 8:29702778-29702800 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
1039002953 8:33001993-33002015 TTTTTCTGGTTCATGGTGCATGG + Intergenic
1039305118 8:36253130-36253152 TTTTCCAGGTATATGGTTGAAGG + Intergenic
1040743363 8:50608120-50608142 TTTTCCTGGATCATGTTGCAGGG + Intronic
1041082316 8:54225509-54225531 TTTGCAAGGCACATGCTTCAGGG - Intergenic
1043990579 8:86748280-86748302 TATTCCAGGCAGATGTTGAAAGG + Intergenic
1044013412 8:87022248-87022270 TTTTACAGGGTCATGGTGCTAGG + Intronic
1044163600 8:88952010-88952032 TTTTCCAGGCACCTGAAGAATGG - Intergenic
1045842838 8:106599816-106599838 TTTTCCAGGGACCTGGGGTAGGG + Intronic
1048694715 8:137012988-137013010 TTTTTCAGGCACACAGTGAAAGG + Intergenic
1048700044 8:137078296-137078318 TTTCCCGGGCACATGGTGTAAGG - Intergenic
1049102106 8:140587381-140587403 TTTTCCAGGCAGAGGGGCCAGGG + Intronic
1051266205 9:15311201-15311223 TTTTCCAGGCACTTGGGGCTGGG + Intergenic
1051788621 9:20774141-20774163 TTTTCCACACACCTGGGGCAGGG - Intronic
1051915081 9:22198482-22198504 TTTTCCAGGTACGTGGTGTAAGG - Intergenic
1055529784 9:77172461-77172483 TTTACCAGGCACCCCGTGCAGGG + Intergenic
1055557292 9:77488257-77488279 TTTTCCATGCACTTGGTGCCGGG - Intronic
1055650873 9:78405638-78405660 TATTGCAGGCACCTGTTGCAGGG - Intergenic
1055713293 9:79088799-79088821 TTTTCCAGGTTCACAGTGCAAGG + Intergenic
1056021778 9:82445500-82445522 TCTTCCAGGCCTATGGTGAAGGG - Intergenic
1056526101 9:87444361-87444383 TTTTTCATGCACATGGAGGAGGG - Intergenic
1057561392 9:96130670-96130692 TTTTCCAGGCAGAAGGGGAATGG + Intergenic
1057970682 9:99554610-99554632 CTTTCCAGCTCCATGGTGCATGG + Intergenic
1058004532 9:99901583-99901605 TTTTCCAGGTGCACAGTGCAAGG + Intergenic
1058475648 9:105329812-105329834 TTTTCCAGACAGATGGGGAAGGG - Intronic
1058576970 9:106414211-106414233 TTTTTCATGCAGATGATGCACGG - Intergenic
1061777342 9:132974214-132974236 TTTTCCAGGCACACAGCTCAGGG - Intronic
1186767913 X:12790610-12790632 TTTTAAGGACACATGGTGCAGGG + Intergenic
1186770592 X:12814301-12814323 TTTTCCTGGCAGAGGGAGCAGGG - Intronic
1188478897 X:30617331-30617353 TTTTCTATGCACTTGGTGCCAGG - Intergenic
1188553233 X:31383648-31383670 TTTTACAGGCACAGGATGGAGGG - Intronic
1188865207 X:35305674-35305696 TTTTACAGGTGCATGGTGCAAGG - Intergenic
1188986853 X:36775711-36775733 TAGTCTAGGCAGATGGTGCATGG - Intergenic
1189213281 X:39302594-39302616 TTTTCCATGGACAGGGTGGAGGG - Intergenic
1190511263 X:51176293-51176315 TTAACCAGGCACATGATGCCTGG - Intergenic
1191726954 X:64291812-64291834 TTGTCCAGGCTCATGAGGCATGG - Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1193758400 X:85436641-85436663 TTTTCCAGGTGCAGGGTGCAGGG - Intergenic
1194522526 X:94936169-94936191 TTTTGCAGGTGCATGGTGCAAGG - Intergenic
1194613618 X:96074573-96074595 TTTTCCATGCACTTGGTGTTGGG - Intergenic
1195021437 X:100832766-100832788 ATGGCCAGGGACATGGTGCATGG - Exonic
1195206984 X:102611056-102611078 TTTTCCAGGTGCACAGTGCAAGG - Intergenic
1195617348 X:106922715-106922737 TTATCCAAGCAAATGGTGGATGG + Intronic
1196071924 X:111534189-111534211 TTTTCCATGCCTGTGGTGCAGGG + Intergenic
1196518273 X:116640179-116640201 TTCACCAGGCACATGGTAAAGGG + Intergenic
1196540346 X:116900217-116900239 CTTTCCAGGCACATGGTGCAAGG + Intergenic
1197260576 X:124312939-124312961 TTTTCCACACACTTGGTGCCTGG - Intronic
1197787078 X:130209128-130209150 TTTGCCAGGCACATAGTACCTGG - Intronic
1200301820 X:154984022-154984044 TTTTCCATACACTTGGTGCTGGG + Intronic
1201592394 Y:15629260-15629282 TTTTCCAGGAACACGGTGCAAGG - Intergenic