ID: 1100977434

View in Genome Browser
Species Human (GRCh38)
Location 12:100137105-100137127
Sequence TAGGAAAAGCTATCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100977434 Original CRISPR TAGGAAAAGCTATCTGAGGC TGG (reversed) Intronic
901234272 1:7659236-7659258 TTTGAAAAACTATCAGAGGCTGG + Intronic
902547424 1:17198808-17198830 TGGGAAAAGCCAGCTGGGGCAGG + Intergenic
902642824 1:17777682-17777704 TAGAAAGTGCCATCTGAGGCCGG + Intronic
905042962 1:34975556-34975578 GAGGAAAAGCTATCAGAGACTGG + Intergenic
905489356 1:38331605-38331627 TAGGAGAAGCTATAAGAAGCAGG + Intergenic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
908238964 1:62173018-62173040 TAGAAAATGCTAGCAGAGGCCGG + Intergenic
909013494 1:70358954-70358976 TCAGAAAAGCTTTCTGGGGCTGG + Intronic
909330181 1:74400190-74400212 TAGGAATAGACATCTGAGGAAGG + Intronic
911315968 1:96357170-96357192 AAGGAAAAGATATCTGGGGATGG - Intergenic
912861250 1:113215936-113215958 TATGAAGAACTATCTGAGACTGG + Intergenic
913154155 1:116077958-116077980 TAAGAAATGATATCTCAGGCTGG + Intergenic
913368618 1:118071150-118071172 TAGGAAGTGCTATATGAGGTGGG - Intronic
914718496 1:150270121-150270143 TAGGCAAAGGAATCTGAGGATGG + Intronic
916117586 1:161500482-161500504 TAGGAAATGCTCCCTGAGGCAGG - Intergenic
916921953 1:169478191-169478213 TAGGAAAGGATATTTCAGGCTGG - Intronic
917044052 1:170836879-170836901 TAGGAAAAGTTAACAGTGGCTGG - Intergenic
918342405 1:183578661-183578683 TTAGAAAAACTATCTGGGGCTGG - Intronic
919956254 1:202419781-202419803 AACCAAAAACTATCTGAGGCAGG + Intronic
920172181 1:204079001-204079023 TAGGAAAAGATTTCTGGGCCGGG + Intronic
921659589 1:217785287-217785309 TATGAAGAGCTACCTGAGACTGG + Intronic
922421816 1:225465548-225465570 CAGGAAAAGACATCTGATGCTGG - Intergenic
923447264 1:234083770-234083792 TGGGAAAAGCATTGTGAGGCAGG + Intronic
923501681 1:234570603-234570625 TAGGGAAAGGTAGCTGAGGGTGG - Intergenic
923724690 1:236495890-236495912 TTGAAAGAGCTATCTGAGGCCGG + Intergenic
1063738834 10:8794813-8794835 TACAAAGAGCTATCTGAGACTGG + Intergenic
1064300125 10:14115850-14115872 TATGAAGAGATACCTGAGGCTGG - Intronic
1064808511 10:19165573-19165595 TAGGAAAAACTACCAGAGACAGG + Intronic
1065161120 10:22923403-22923425 TAGGCAAAGATTTCTTAGGCAGG + Intergenic
1065969536 10:30795541-30795563 TATGAAGAACTATCTGAGACTGG + Intergenic
1066111263 10:32199080-32199102 TATGAAAAGCTATCTCTTGCTGG - Intergenic
1067995029 10:51262599-51262621 TATTAAAAACTACCTGAGGCTGG + Intronic
1068742747 10:60492779-60492801 TAAGAAAAGCTAACTGAGCCGGG + Intronic
1069282950 10:66678285-66678307 TAGTAAAGGCTTTCTGAGTCAGG - Intronic
1070245580 10:74728528-74728550 GAGTAAAATCTTTCTGAGGCTGG + Intergenic
1070378832 10:75861107-75861129 TTGGAACAGCTATCTGAGGCAGG - Intronic
1071853890 10:89603774-89603796 TGGAAAAAGCTATCTGGGGTTGG - Intronic
1071977675 10:90971178-90971200 TATAAAAAGATATCTGAGACTGG - Intergenic
1072119427 10:92393118-92393140 GAGGAAAAGCTACGTGTGGCAGG + Intergenic
1072476279 10:95763219-95763241 TCAGAAAAACTATCAGAGGCCGG - Intronic
1075685445 10:124361946-124361968 TAAGAAACTCTTTCTGAGGCTGG - Intergenic
1077195135 11:1276056-1276078 CTGTAAAAGCTTTCTGAGGCGGG - Exonic
1077844489 11:6010657-6010679 TATGACAAACTACCTGAGGCTGG - Intergenic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1079992006 11:27256110-27256132 TATAAAAAACTACCTGAGGCTGG + Intergenic
1080126793 11:28744522-28744544 TATAAAAAACTACCTGAGGCTGG + Intergenic
1081393703 11:42560113-42560135 TATGAAGACATATCTGAGGCTGG - Intergenic
1081464966 11:43308037-43308059 TAGAAAAAGCAATCCGGGGCAGG - Intergenic
1082191159 11:49246927-49246949 TATGACAATGTATCTGAGGCTGG + Intergenic
1083229544 11:61307432-61307454 GAGAAAAAGTTATCTGAAGCAGG - Intronic
1083770105 11:64862371-64862393 TGGGAAATGCAATCTGAAGCTGG - Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083909106 11:65695270-65695292 CAAAAAAAGCTATCTGGGGCTGG - Intergenic
1085198202 11:74684708-74684730 TGGGAAATGCCATCAGAGGCAGG + Intergenic
1086348117 11:85918585-85918607 AACCAAAAGCTATCTGAGACAGG + Intronic
1086674960 11:89594111-89594133 TATGACAATGTATCTGAGGCTGG - Intergenic
1086772194 11:90780495-90780517 TATGAAGAACTATCTGAGACTGG + Intergenic
1086872606 11:92056719-92056741 TATGGAAATCTATGTGAGGCAGG - Intergenic
1087518906 11:99203892-99203914 TAAGAAATGTTATATGAGGCCGG - Intronic
1089318066 11:117605615-117605637 GAGGAAGAGGTGTCTGAGGCGGG + Intronic
1089334810 11:117715879-117715901 TAGGAATTGGTATCTGAGGACGG - Intronic
1089623907 11:119739430-119739452 CAGGACCAGCTGTCTGAGGCTGG - Intergenic
1090175028 11:124641005-124641027 TAAGAAAGGCTATTTTAGGCCGG + Intronic
1090456404 11:126853615-126853637 TATGAAGAGCTGTCTTAGGCTGG - Intronic
1090677904 11:129020951-129020973 TCAGAAAAGCTATCTGGGACCGG + Intronic
1092751782 12:11725958-11725980 TAGGAAGGAATATCTGAGGCTGG - Intronic
1093591054 12:20903416-20903438 TATGAAGAGCTACCTGAGACTGG + Intronic
1093881815 12:24413049-24413071 CAAGAAAATCTAACTGAGGCCGG - Intergenic
1096160537 12:49373268-49373290 TAGAAAATGCAATGTGAGGCTGG - Intronic
1098445265 12:70560131-70560153 TAAGAAAAGGTATATGAGGCTGG - Intronic
1099311851 12:81035806-81035828 TAAGAAAAGCTTTATGAGGTAGG + Intronic
1100445553 12:94656603-94656625 TAGGATAAGGCTTCTGAGGCTGG - Intergenic
1100837215 12:98577854-98577876 TAAGAAATGCACTCTGAGGCCGG + Intergenic
1100977434 12:100137105-100137127 TAGGAAAAGCTATCTGAGGCTGG - Intronic
1102822761 12:115922303-115922325 TAGAAAGAACTATCTGAGACTGG - Intergenic
1103180976 12:118911253-118911275 CAGAAAAATCTATCTGAGACTGG + Intergenic
1103365048 12:120375946-120375968 TTGCAACAGCTCTCTGAGGCAGG + Intergenic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104525016 12:129513055-129513077 TAGAAAAGAATATCTGAGGCTGG + Intronic
1105366496 13:19770232-19770254 AAGAAATAGCTATCTAAGGCAGG + Intronic
1106603542 13:31207856-31207878 TAGGAAAAGAGATCTGCTGCTGG - Intronic
1107676439 13:42802613-42802635 TATAAAAAGCTACCTGAGACTGG - Intergenic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1108857889 13:54818757-54818779 AAAGAAAAGCTATATTAGGCCGG - Intergenic
1109819607 13:67636096-67636118 TAGGAAAAGCTAGGTGAAGAAGG - Intergenic
1110274144 13:73624335-73624357 TAGAAAAAGCTATCAAAAGCTGG - Intergenic
1110564964 13:76948892-76948914 TAAGATAAGCTTTTTGAGGCAGG + Intronic
1110690599 13:78426877-78426899 TAGGAATAGATATCTCAGGAAGG - Intergenic
1111282824 13:86049840-86049862 TAGAAAAAGCTACACGAGGCTGG + Intergenic
1111754270 13:92372820-92372842 TAAGAAAAGCTATCTGAACTGGG + Intronic
1111868741 13:93803374-93803396 TAGGAAAAGGTATCTTATACTGG - Intronic
1111901677 13:94207194-94207216 TAGGAACAGGTATCTCAGACAGG - Intronic
1112684192 13:101803973-101803995 TAGGAATAGGTGTGTGAGGCTGG + Intronic
1112725916 13:102304313-102304335 TAGCAACAGGAATCTGAGGCAGG - Intronic
1113745050 13:112738492-112738514 TAGGAAAAGCAATGTGAGCTGGG + Intronic
1113782749 13:112986057-112986079 AAGGAAATGCCTTCTGAGGCAGG - Intronic
1115885069 14:37962120-37962142 TATGAAGAACTACCTGAGGCTGG + Intronic
1117975015 14:61288624-61288646 TAGGAAAAGTTCTGTGAGGATGG + Intronic
1119504072 14:75156647-75156669 TTTGAAAAACTATCTCAGGCCGG + Intronic
1120337197 14:83172104-83172126 TATGAAAGGGTATCTGAGGCAGG - Intergenic
1121519661 14:94577336-94577358 TAGGAAAAGCTTTGTGAAGGTGG - Intronic
1121877590 14:97467706-97467728 TATAAAGAACTATCTGAGGCTGG + Intergenic
1122031107 14:98913223-98913245 TAGGACCAGCTATGTGAGCCTGG + Intergenic
1122543942 14:102512091-102512113 TAGAAAAAGGTCTCTGGGGCAGG - Intergenic
1122585381 14:102802530-102802552 TATGAAAAAATACCTGAGGCTGG + Intronic
1123155983 14:106226451-106226473 TAGGAAAGAGTACCTGAGGCTGG + Intergenic
1124663059 15:31566968-31566990 TATGAAGAAATATCTGAGGCTGG - Intronic
1126023769 15:44427024-44427046 TAGGGAGAGCTGCCTGAGGCCGG - Intergenic
1129310868 15:74708051-74708073 TTTGAAAAGACATCTGAGGCTGG + Intergenic
1130404540 15:83586243-83586265 GAGGAAAAGCAATCTAAGGAAGG - Intronic
1131209126 15:90478285-90478307 AAAGAAAAACTATTTGAGGCTGG - Intronic
1132153077 15:99475953-99475975 TAGGTAATGCTATCTGGGGTGGG - Intergenic
1132559734 16:588095-588117 TCAGAAACGCTTTCTGAGGCCGG - Intergenic
1133341883 16:5041909-5041931 TAGGAACAGCTCCTTGAGGCAGG + Intronic
1138233716 16:55361423-55361445 TAATAATAGCTATCTTAGGCTGG + Intergenic
1138842810 16:60529385-60529407 TATAAAGAGCTACCTGAGGCTGG - Intergenic
1141688700 16:85584627-85584649 TGGCGAAAGCCATCTGAGGCTGG + Intergenic
1142758180 17:2028011-2028033 TAGGAAAAGTTGGCTGGGGCTGG + Intergenic
1143261877 17:5605541-5605563 CAACAAAAGCTAACTGAGGCCGG - Intronic
1143935330 17:10478209-10478231 TAGGGAATGCTTTCTGAAGCTGG + Intergenic
1144114738 17:12077004-12077026 TAGGAAAGTCATTCTGAGGCAGG + Intronic
1144673551 17:17146599-17146621 CAGGAAGAGCCATCTGAGGCTGG + Intronic
1145002668 17:19316277-19316299 AATTAAAAGCTATCTGAGGATGG + Intronic
1145804238 17:27715098-27715120 TGGGGACAGCCATCTGAGGCAGG - Intergenic
1145896436 17:28460671-28460693 TAGGAAAAAGGATTTGAGGCTGG - Intronic
1148825741 17:50392613-50392635 TAGGGAGCGCCATCTGAGGCAGG + Intronic
1149695002 17:58609840-58609862 GATGAAAAGCTACATGAGGCAGG - Intronic
1152452473 17:80390765-80390787 TAGAAAAAGCTATCCTAGGCCGG + Intronic
1153329739 18:3861820-3861842 TTGGAAAAGCTTATTGAGGCAGG - Intronic
1153405267 18:4731562-4731584 TAGGAAAAGCTCTCAAAGGAAGG + Intergenic
1155737692 18:29244260-29244282 TACAAAAAACTATCTGAGTCTGG - Intergenic
1156245056 18:35290084-35290106 TCGGGAAAGCTCTCTGGGGCAGG - Exonic
1156451456 18:37268691-37268713 TCAGAAAAGCTACCTGGGGCAGG + Intronic
1158681345 18:59569925-59569947 TAAGAAAAGGGAGCTGAGGCCGG - Intronic
1158698630 18:59726219-59726241 TAGAAAAATCTACCTGCGGCTGG - Intergenic
1158827034 18:61233673-61233695 TAGGCAAAGATTTCTGAAGCAGG + Intergenic
1159070953 18:63623797-63623819 TATAAAGAGCTATCTGAGGCTGG + Intergenic
1161351619 19:3795562-3795584 TATGAAAAGTCATATGAGGCCGG - Intronic
1162142185 19:8591734-8591756 TAAAAACAGCTATCAGAGGCCGG - Intronic
1163233542 19:16018914-16018936 TAGAAAAGCCTCTCTGAGGCAGG + Intergenic
1163842563 19:19620167-19620189 TAGGGAAAGCTCTCTGATGAAGG + Intergenic
1165442070 19:35834479-35834501 CAGCAAAAGCTAACTGATGCAGG + Intronic
1165610712 19:37149820-37149842 GAGGAAAAGGTCTATGAGGCTGG + Exonic
925653355 2:6116776-6116798 TATGAAGAACTATCTGAGACTGG - Intergenic
926868849 2:17390676-17390698 TAGGAAGAAATATCTGAGACTGG - Intergenic
928345911 2:30495937-30495959 TATAAAAAACTATCTGAGACTGG + Intronic
931855898 2:66301621-66301643 TCGGAAATGCAAGCTGAGGCTGG + Intergenic
935678535 2:105616986-105617008 AAGGAAAAGCTGCCTGAGGTTGG - Intergenic
935976744 2:108585895-108585917 TAGAAAATGGTGTCTGAGGCCGG + Intronic
936055624 2:109259996-109260018 TTGGAAAAGATATCTCTGGCCGG - Intronic
936329520 2:111535738-111535760 TATGAAGAAATATCTGAGGCTGG + Intergenic
937698465 2:124836386-124836408 GAGGATAAGCTGTCTGTGGCAGG - Intronic
938145891 2:128834753-128834775 TGGGAAAATGTATCTGAGACAGG - Intergenic
938204507 2:129407528-129407550 TATGACAAATTATCTGAGGCAGG + Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
942683288 2:178502462-178502484 TGAAAAAAGTTATCTGAGGCAGG + Intronic
942862509 2:180632622-180632644 TAGGTACAGCTTTCTAAGGCAGG - Intergenic
944473751 2:200083361-200083383 TAGAAAAAGCCAGCTGGGGCCGG + Intergenic
945525023 2:210877842-210877864 TCGAGAAAGCTATCTGAGACAGG + Intergenic
946190028 2:218003162-218003184 AAGGGAAAGCTACCAGAGGCAGG + Intergenic
946581248 2:221130155-221130177 TAGAAAGAAATATCTGAGGCGGG - Intergenic
947451196 2:230210781-230210803 TAGGAATAGGTGACTGAGGCAGG + Intronic
948244167 2:236464219-236464241 TATTAAAAGATATCTGTGGCAGG - Intronic
1168834689 20:870230-870252 TAAGAACAGGTGTCTGAGGCTGG + Exonic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1169998823 20:11591646-11591668 TAGAGCCAGCTATCTGAGGCTGG - Intergenic
1171090752 20:22283866-22283888 AAGGCAAAGCTATCTGAGGCTGG - Intergenic
1171298337 20:24038216-24038238 TATGAAGAACTAACTGAGGCAGG + Intergenic
1172133592 20:32672854-32672876 TAGGAAAAGGTCTCTGCTGCCGG - Intergenic
1173607577 20:44342653-44342675 TAGAAAAAGCCCTCAGAGGCCGG + Intronic
1173960163 20:47064900-47064922 TAGTAAAACATACCTGAGGCTGG + Intronic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175168321 20:57062214-57062236 GAAGCAAAGCTTTCTGAGGCAGG - Intergenic
1175288597 20:57856653-57856675 CAGGGAAAGCTATCTGAAGGTGG - Intergenic
1175799161 20:61791429-61791451 TAGGAAAGTCCATCTTAGGCCGG + Intronic
1176011058 20:62895855-62895877 TGGAAAAGGCTGTCTGAGGCCGG + Intronic
1176066571 20:63200062-63200084 AACAAAAAGCTATTTGAGGCGGG + Intronic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1176964755 21:15199618-15199640 TAGGATCAGCTATGTGAGGCAGG + Intergenic
1177258749 21:18700819-18700841 TATAAAGAACTATCTGAGGCTGG - Intergenic
1178883826 21:36469054-36469076 TAGGAAATACTAGCTGAGTCCGG - Intronic
1179174951 21:39001380-39001402 TAGGAAAAGACATCACAGGCAGG - Intergenic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1184100414 22:42339052-42339074 TCAGAAAAGCTCTGTGAGGCAGG + Intronic
1184736867 22:46404113-46404135 TAGAAAATGCTACATGAGGCTGG + Intronic
949492900 3:4606392-4606414 AACCAAAAGGTATCTGAGGCAGG + Intronic
951325028 3:21291615-21291637 TATGAAGAACTATCTGAGACTGG + Intergenic
951418308 3:22451752-22451774 TAAGAGTGGCTATCTGAGGCTGG - Intergenic
951778708 3:26339580-26339602 TATAAATAGCTATCTGAGACTGG + Intergenic
954666077 3:52253165-52253187 TAGGAAAGGGGGTCTGAGGCTGG - Intergenic
954910447 3:54102322-54102344 TATAAAAAGCTACCTGAGGCCGG - Intergenic
955553216 3:60107258-60107280 TAAGAAAAGCTATCTGTAACAGG - Intronic
955860271 3:63322103-63322125 TAGGAAAAGCTTCCTGATGGAGG + Intronic
956149205 3:66223391-66223413 TAGGCAAAGCCAGCTGAGGTGGG + Intronic
956351065 3:68337118-68337140 TAGAAAGAACTACCTGAGGCTGG + Intronic
958265984 3:91437407-91437429 TAGGAAAAGCTATCTTGAGTAGG + Intergenic
958754418 3:98233803-98233825 TATAAAAAGCTACCTGAGACTGG - Intergenic
959399338 3:105880206-105880228 TAGAAAAGGCTGTCTTAGGCCGG - Intergenic
959799684 3:110477428-110477450 TAGAAAAAATTATCTGATGCAGG + Intergenic
959959188 3:112276935-112276957 GGGAAATAGCTATCTGAGGCAGG - Intronic
960608457 3:119532203-119532225 TTTGAAATGCCATCTGAGGCTGG + Intronic
962257143 3:133880300-133880322 TAGGAAAAGAAGGCTGAGGCAGG + Intronic
963617448 3:147559577-147559599 TATGAAGAACTATCTGAGACAGG - Intergenic
963676091 3:148314079-148314101 TATTAAAAGCTTTCAGAGGCAGG - Intergenic
963882462 3:150544337-150544359 TAGGAAAGTCATTCTGAGGCAGG + Exonic
963900432 3:150727828-150727850 TGGGAAAAGCTCTCTGGGGCAGG + Intergenic
963956326 3:151258436-151258458 CATGAAATGCTATCTGAGGCTGG + Intronic
964129064 3:153267506-153267528 TAAGAAAAGGTAATTGAGGCCGG + Intergenic
964302076 3:155299975-155299997 TATAAAAAGCTACCTGAGACTGG + Intergenic
967735315 3:192945566-192945588 AAGGAAAAGTAATGTGAGGCAGG - Intergenic
969361537 4:6667163-6667185 TAAGAAATGGTTTCTGAGGCTGG - Intergenic
969695621 4:8732676-8732698 TACAAAAAACTATCTGAGACTGG - Intergenic
970090291 4:12399722-12399744 TATAAAGAACTATCTGAGGCTGG + Intergenic
970288946 4:14550872-14550894 TAGGAAAATCTCTCTGAGTCAGG - Intergenic
970707113 4:18817253-18817275 CATAAAAAGATATCTGAGGCAGG - Intergenic
970935406 4:21564637-21564659 TATGAAGAGATACCTGAGGCTGG + Intronic
971948069 4:33306980-33307002 TATGAAAAAATATCTGAGGCTGG + Intergenic
972096334 4:35351265-35351287 TATAAAAAACTATCTGAGACTGG + Intergenic
972292468 4:37702692-37702714 TAGCAGAATATATCTGAGGCTGG + Intergenic
972722396 4:41713418-41713440 TATAAAGAGTTATCTGAGGCTGG + Intergenic
973743223 4:53938358-53938380 TAGAAAAAACTATTTTAGGCTGG + Intronic
974195632 4:58570771-58570793 TAGAAAGAACTATCTGAGACTGG - Intergenic
974296314 4:60003615-60003637 TATAAAAAGCTGTCTGAGACTGG + Intergenic
974790334 4:66680549-66680571 TATAAAAAACTACCTGAGGCTGG + Intergenic
974930193 4:68352275-68352297 AATCAAAAGGTATCTGAGGCAGG - Intergenic
975594503 4:76036285-76036307 TAGGAAAAGCTACCTTAAGAAGG - Intronic
977916671 4:102601844-102601866 TGGGAAAAGCAATCAGGGGCAGG - Intronic
979125843 4:116970369-116970391 TATAAAGAGCTATCTGAGACTGG - Intergenic
980247702 4:130268254-130268276 TATAAAAAGCTACCTGAGACTGG - Intergenic
980410570 4:132413273-132413295 TATAAAGAACTATCTGAGGCTGG - Intergenic
980435971 4:132774323-132774345 TAGGAAAACCTCACTGAAGCTGG - Intergenic
980522165 4:133949002-133949024 TAGGAATAGATATCTCAGGAAGG - Intergenic
980606737 4:135101372-135101394 TAGGAGAAAATATCTGATGCAGG + Intergenic
980872886 4:138630271-138630293 TAGGAAAAGCAAACTTAGACAGG - Intergenic
982007734 4:151079547-151079569 TAGTACCAGCTACCTGAGGCAGG - Intergenic
983020694 4:162671998-162672020 TACAAAGAGCTACCTGAGGCTGG - Intergenic
984197975 4:176682636-176682658 TAGTAAAAGGTATTTTAGGCTGG + Intergenic
985514061 5:329500-329522 TAGAAAAAACAATCTCAGGCTGG - Intronic
986298015 5:6455691-6455713 TTGGAAAAGCTGCCTGACGCTGG + Intronic
987138825 5:14924797-14924819 TAGAAAAACATATTTGAGGCTGG - Intergenic
987711767 5:21510124-21510146 TAGGAAGAAATATCTGAGACTGG + Intergenic
988147123 5:27324152-27324174 AATGAAAAGCTATCTGACGCTGG + Intergenic
988205456 5:28127616-28127638 TAAGGAAACCTATCTGAGTCTGG + Intergenic
988254694 5:28807354-28807376 GAGGAAAAGTTATCTGAGGCTGG + Intergenic
988588835 5:32531257-32531279 TAGAAAAAGACATGTGAGGCTGG - Intergenic
989195550 5:38713075-38713097 TATGAAAAGCCATATTAGGCAGG + Intergenic
990098679 5:52155020-52155042 TAGGCAAAGCTTTGTGATGCGGG + Intergenic
990847344 5:60157775-60157797 TGGGAAAAGCTAACTGAGTTGGG - Intronic
990910255 5:60844645-60844667 GAGGAAAACCTAGCTGAGGCTGG + Intergenic
992276820 5:75129318-75129340 TATAAAAAACTACCTGAGGCTGG - Intronic
998974106 5:147625275-147625297 TAGAAAGAACTATCTGGGGCTGG - Intronic
1001600991 5:172928252-172928274 TGGCGAAAGCTATCTCAGGCTGG + Intronic
1003547613 6:7073735-7073757 TAGAAAAAGCTTGCTGATGCTGG - Intergenic
1006676753 6:35770329-35770351 GAGGAAAAGCTCCCTGGGGCAGG - Intergenic
1006802334 6:36767150-36767172 TACGAAAAACTATCAGAGGCCGG - Intronic
1008141893 6:47841386-47841408 TAGGAAGAGCTGACAGAGGCAGG + Intergenic
1008989368 6:57585223-57585245 TAGGAAAAGCTATCTTGAGTAGG - Intronic
1009732880 6:67633421-67633443 TAGAAAGAACTATCTGAGACCGG - Intergenic
1011911177 6:92441414-92441436 TAGCAAAAGCTTACTGATGCAGG - Intergenic
1011944806 6:92887689-92887711 TAAGAAAAGCCACTTGAGGCCGG - Intergenic
1012135765 6:95553914-95553936 TATGAATATTTATCTGAGGCTGG + Intergenic
1012427586 6:99131341-99131363 GAGGAGATGCTATCTGAGCCAGG - Intergenic
1012780191 6:103547684-103547706 TATAAAGAACTATCTGAGGCTGG + Intergenic
1013539714 6:111095882-111095904 TATGAAGAAATATCTGAGGCTGG - Intronic
1013715971 6:112961911-112961933 TATAAAGAGCTACCTGAGGCTGG - Intergenic
1014226561 6:118854647-118854669 TATGAAAACCTACATGAGGCTGG - Intronic
1015396585 6:132741479-132741501 TTCTAAAAGATATCTGAGGCTGG - Intergenic
1015846571 6:137526199-137526221 TATAAAGAACTATCTGAGGCTGG - Intergenic
1018178518 6:161199874-161199896 TATGAAGAGCTACCTGAGACTGG - Intronic
1018801703 6:167227669-167227691 TAGAAAGAGCCAACTGAGGCTGG - Intergenic
1019975082 7:4574619-4574641 TATAAAGAACTATCTGAGGCTGG - Intergenic
1020168327 7:5824978-5825000 TAGGAAAAGCTCCTTCAGGCCGG - Intergenic
1020234742 7:6347028-6347050 TAGAAAAAGTCATCTGAGGCTGG + Intronic
1022488715 7:30800351-30800373 TGGGAAAGGCTGTCTGAGCCTGG - Intronic
1023802762 7:43849318-43849340 TAGGGAAAGCTATGTGGGGAGGG - Intergenic
1024407782 7:49002273-49002295 TAGGACAAGCCATCTGATCCTGG - Intergenic
1024579171 7:50788004-50788026 TAGGAACAGCGATCTCAAGCAGG + Intronic
1024841667 7:53593965-53593987 TATGAAGAACTATTTGAGGCTGG - Intergenic
1026267756 7:68810242-68810264 TAGGAAAACGAATCTGAGGAGGG + Intergenic
1026521792 7:71124178-71124200 TAGGAAAGGTCTTCTGAGGCCGG - Intergenic
1026879311 7:73898691-73898713 TAAGAAAAGCCAACTGAGGCCGG - Intergenic
1027570522 7:79860302-79860324 GAAGAAAAGCTATCTGAGGCTGG + Intergenic
1027885306 7:83896956-83896978 GAGGAATAGCTATCTGATGCAGG - Intergenic
1028351317 7:89853062-89853084 TATAAAAAGCTACCTGAGACTGG - Intergenic
1028424050 7:90666235-90666257 TAAGAAAAGATATCTGAGCTGGG - Intronic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031532192 7:122888084-122888106 AAGTAATAGCTTTCTGAGGCAGG + Intergenic
1031773015 7:125869936-125869958 TATAAAAAACTATCTGAGACTGG + Intergenic
1032530828 7:132618246-132618268 GAGGAAAAGCTTCCTGAGGAAGG - Intronic
1034838947 7:154377775-154377797 TATGAAGAGCTAACTGAGGCTGG - Intronic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1037201854 8:16264300-16264322 AACCAAAAACTATCTGAGGCAGG + Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1037807019 8:22063722-22063744 GAGGAAGAGGTATCTGAGGTCGG - Intronic
1038560296 8:28571286-28571308 AGGGAAAAATTATCTGAGGCAGG - Exonic
1039229523 8:35428104-35428126 TGGGAAAAGCTACCTGAGTAAGG - Intronic
1040590240 8:48785735-48785757 TAGGCAAAGATTTCTGAGGGAGG + Intergenic
1042764295 8:72303253-72303275 TATAAAAAACTATCTGAGACTGG - Intergenic
1044280748 8:90352632-90352654 TAGGTACAGCTATCTTATGCAGG + Intergenic
1044357188 8:91236228-91236250 AATGAAAAGCAATTTGAGGCTGG + Intronic
1044890143 8:96826515-96826537 TAAAAAAAGATACCTGAGGCAGG - Intronic
1045038080 8:98193042-98193064 TAGGATAAGCTATGTGAATCTGG + Exonic
1045361810 8:101439933-101439955 TAGAAAAGGCTCTCTGAAGCCGG + Intergenic
1046344868 8:112910369-112910391 TAGGTACAGTTATCTGAGGAAGG - Intronic
1048744074 8:137593653-137593675 TATGAAGAAATATCTGAGGCTGG - Intergenic
1048790989 8:138103424-138103446 TAGGACAGGCTGTCTGGGGCAGG - Intergenic
1048822302 8:138391429-138391451 CAGGAAGATCTATGTGAGGCTGG - Intronic
1049151619 8:141038642-141038664 TAGGAAATGATACCTGAGGGAGG - Intergenic
1050379053 9:5006472-5006494 TATAAAGAGCTATCTGAGACTGG + Intronic
1051921586 9:22273380-22273402 TACAAAAAGCTATCTAAGTCTGG + Intergenic
1052496109 9:29226726-29226748 TAGAAAAAGAGATCTTAGGCAGG - Intergenic
1052524018 9:29589200-29589222 TAGAAAGAAATATCTGAGGCTGG - Intergenic
1053306047 9:36985639-36985661 CAAGAAGAGCTTTCTGAGGCCGG + Intronic
1057692987 9:97302961-97302983 AAAGAAAAGCTATCTGAGTCAGG - Intergenic
1058938006 9:109786816-109786838 TAGAAAAAGCTAAGTGAGGGGGG + Intronic
1059230197 9:112713692-112713714 AAAAAAAAGGTATCTGAGGCCGG + Intronic
1059695739 9:116728714-116728736 GAGGAAAAGGTATCTGAGTAGGG - Intronic
1061243584 9:129389094-129389116 TAGGAAAAGATCTTTGGGGCTGG - Intergenic
1061325394 9:129860954-129860976 TAGGAACAGCTTTCAGAGGGTGG - Exonic
1061443176 9:130620967-130620989 TAGCAAAAGCTGTCAGATGCTGG + Intronic
1061870068 9:133515754-133515776 CAGCAGAAGCCATCTGAGGCTGG - Intronic
1185888458 X:3803058-3803080 TAAGAAAAATTATCTGGGGCTGG + Intergenic
1186087885 X:6010821-6010843 TAGAAAAAGATATTTGAGGCTGG - Intronic
1187004010 X:15213878-15213900 AAAGAAAAGCTATCAGATGCTGG - Intergenic
1187726269 X:22205561-22205583 CAGGAAAAGATGTCTGAGTCTGG + Intronic
1193818810 X:86137015-86137037 TATCAAAAGCTATCTTTGGCCGG - Intergenic
1194691363 X:96990177-96990199 TAGAAAAAGCTATTTGTGCCAGG + Intronic
1194987528 X:100507011-100507033 AACGAAAAGGTATCTGAGACAGG + Intergenic
1195024802 X:100865922-100865944 CATGGAAAGATATCTGAGGCTGG + Intronic
1195250990 X:103046908-103046930 TATAAAAAACTATCTGAGACTGG - Intergenic
1195568238 X:106370163-106370185 GAGTAAAAGCTTTCTGAGGCCGG - Intergenic
1195632047 X:107067410-107067432 GAGGAAAAACTAACTGAGGGAGG - Exonic
1195914309 X:109920884-109920906 TAGAAACAACTATCTGAAGCTGG - Intergenic
1196764482 X:119230388-119230410 TAGAAGAAGCAATCTGGGGCCGG - Intergenic
1197789044 X:130232432-130232454 TAGGAGAAACTATCTGAGAAAGG + Intronic
1198880417 X:141274697-141274719 TATGAAAAGCTGCCTGAGACTGG + Intergenic
1199170598 X:144731029-144731051 TACAAAAAGCTACCTGAGACTGG + Intergenic
1199403608 X:147429626-147429648 TACAAAAAACTATCTGAGACTGG + Intergenic
1200822604 Y:7602342-7602364 TTGGAAAAGGTTACTGAGGCAGG + Intergenic
1201508092 Y:14726786-14726808 TAGAAAAAGATATTTGAGGCTGG + Intronic
1202237699 Y:22731675-22731697 TTGGAAAAGGTTACTGAGGCAGG - Intergenic