ID: 1100979077

View in Genome Browser
Species Human (GRCh38)
Location 12:100150654-100150676
Sequence GCCTGTAATCCCTGCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 688256
Summary {0: 378, 1: 74647, 2: 208210, 3: 229929, 4: 175092}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979077_1100979081 28 Left 1100979077 12:100150654-100150676 CCTGAGTAGCAGGGATTACAGGC 0: 378
1: 74647
2: 208210
3: 229929
4: 175092
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979077 Original CRISPR GCCTGTAATCCCTGCTACTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr