ID: 1100979079

View in Genome Browser
Species Human (GRCh38)
Location 12:100150679-100150701
Sequence ATTTTAGCTAGACATGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979079_1100979083 28 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979083 12:100150730-100150752 TTTCACTGTGTTGACCAGGCTGG 0: 117
1: 4222
2: 31679
3: 198252
4: 327025
1100979079_1100979082 24 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979082 12:100150726-100150748 GGAGTTTCACTGTGTTGACCAGG No data
1100979079_1100979081 3 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979079 Original CRISPR ATTTTAGCTAGACATGCTGG TGG (reversed) Intergenic
No off target data available for this crispr