ID: 1100979081

View in Genome Browser
Species Human (GRCh38)
Location 12:100150705-100150727
Sequence TTTTGTATTTTTAGTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979079_1100979081 3 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1100979078_1100979081 4 Left 1100979078 12:100150678-100150700 CCCACCAGCATGTCTAGCTAAAA No data
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1100979080_1100979081 0 Left 1100979080 12:100150682-100150704 CCAGCATGTCTAGCTAAAATTTT No data
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1100979077_1100979081 28 Left 1100979077 12:100150654-100150676 CCTGAGTAGCAGGGATTACAGGC 0: 378
1: 74647
2: 208210
3: 229929
4: 175092
Right 1100979081 12:100150705-100150727 TTTTGTATTTTTAGTAGAGAAGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979081 Original CRISPR TTTTGTATTTTTAGTAGAGA AGG Intergenic
Too many off-targets to display for this crispr