ID: 1100979082

View in Genome Browser
Species Human (GRCh38)
Location 12:100150726-100150748
Sequence GGAGTTTCACTGTGTTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979079_1100979082 24 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979082 12:100150726-100150748 GGAGTTTCACTGTGTTGACCAGG No data
1100979080_1100979082 21 Left 1100979080 12:100150682-100150704 CCAGCATGTCTAGCTAAAATTTT No data
Right 1100979082 12:100150726-100150748 GGAGTTTCACTGTGTTGACCAGG No data
1100979078_1100979082 25 Left 1100979078 12:100150678-100150700 CCCACCAGCATGTCTAGCTAAAA No data
Right 1100979082 12:100150726-100150748 GGAGTTTCACTGTGTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979082 Original CRISPR GGAGTTTCACTGTGTTGACC AGG Intergenic
No off target data available for this crispr