ID: 1100979083

View in Genome Browser
Species Human (GRCh38)
Location 12:100150730-100150752
Sequence TTTCACTGTGTTGACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561295
Summary {0: 117, 1: 4222, 2: 31679, 3: 198252, 4: 327025}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979079_1100979083 28 Left 1100979079 12:100150679-100150701 CCACCAGCATGTCTAGCTAAAAT No data
Right 1100979083 12:100150730-100150752 TTTCACTGTGTTGACCAGGCTGG 0: 117
1: 4222
2: 31679
3: 198252
4: 327025
1100979078_1100979083 29 Left 1100979078 12:100150678-100150700 CCCACCAGCATGTCTAGCTAAAA No data
Right 1100979083 12:100150730-100150752 TTTCACTGTGTTGACCAGGCTGG 0: 117
1: 4222
2: 31679
3: 198252
4: 327025
1100979080_1100979083 25 Left 1100979080 12:100150682-100150704 CCAGCATGTCTAGCTAAAATTTT No data
Right 1100979083 12:100150730-100150752 TTTCACTGTGTTGACCAGGCTGG 0: 117
1: 4222
2: 31679
3: 198252
4: 327025

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979083 Original CRISPR TTTCACTGTGTTGACCAGGC TGG Intergenic
Too many off-targets to display for this crispr