ID: 1100979791

View in Genome Browser
Species Human (GRCh38)
Location 12:100155137-100155159
Sequence GCCTGGACGGCTAACAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979791_1100979803 15 Left 1100979791 12:100155137-100155159 CCGAGCCTGTTAGCCGTCCAGGC No data
Right 1100979803 12:100155175-100155197 AGGTGCCATGGCAGTTCCTGTGG No data
1100979791_1100979800 3 Left 1100979791 12:100155137-100155159 CCGAGCCTGTTAGCCGTCCAGGC No data
Right 1100979800 12:100155163-100155185 ATGGTCACCCATAGGTGCCATGG No data
1100979791_1100979796 -5 Left 1100979791 12:100155137-100155159 CCGAGCCTGTTAGCCGTCCAGGC No data
Right 1100979796 12:100155155-100155177 CAGGCCCCATGGTCACCCATAGG No data
1100979791_1100979805 26 Left 1100979791 12:100155137-100155159 CCGAGCCTGTTAGCCGTCCAGGC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979791 Original CRISPR GCCTGGACGGCTAACAGGCT CGG (reversed) Intergenic
No off target data available for this crispr