ID: 1100979792

View in Genome Browser
Species Human (GRCh38)
Location 12:100155142-100155164
Sequence ATGGGGCCTGGACGGCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979792_1100979805 21 Left 1100979792 12:100155142-100155164 CCTGTTAGCCGTCCAGGCCCCAT No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979792_1100979803 10 Left 1100979792 12:100155142-100155164 CCTGTTAGCCGTCCAGGCCCCAT No data
Right 1100979803 12:100155175-100155197 AGGTGCCATGGCAGTTCCTGTGG No data
1100979792_1100979800 -2 Left 1100979792 12:100155142-100155164 CCTGTTAGCCGTCCAGGCCCCAT No data
Right 1100979800 12:100155163-100155185 ATGGTCACCCATAGGTGCCATGG No data
1100979792_1100979796 -10 Left 1100979792 12:100155142-100155164 CCTGTTAGCCGTCCAGGCCCCAT No data
Right 1100979796 12:100155155-100155177 CAGGCCCCATGGTCACCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979792 Original CRISPR ATGGGGCCTGGACGGCTAAC AGG (reversed) Intergenic
No off target data available for this crispr