ID: 1100979794

View in Genome Browser
Species Human (GRCh38)
Location 12:100155150-100155172
Sequence GGGTGACCATGGGGCCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979794_1100979805 13 Left 1100979794 12:100155150-100155172 CCGTCCAGGCCCCATGGTCACCC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979794_1100979803 2 Left 1100979794 12:100155150-100155172 CCGTCCAGGCCCCATGGTCACCC No data
Right 1100979803 12:100155175-100155197 AGGTGCCATGGCAGTTCCTGTGG No data
1100979794_1100979800 -10 Left 1100979794 12:100155150-100155172 CCGTCCAGGCCCCATGGTCACCC No data
Right 1100979800 12:100155163-100155185 ATGGTCACCCATAGGTGCCATGG No data
1100979794_1100979807 23 Left 1100979794 12:100155150-100155172 CCGTCCAGGCCCCATGGTCACCC No data
Right 1100979807 12:100155196-100155218 GGAATTCCCCAGGTGTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979794 Original CRISPR GGGTGACCATGGGGCCTGGA CGG (reversed) Intergenic
No off target data available for this crispr