ID: 1100979797

View in Genome Browser
Species Human (GRCh38)
Location 12:100155159-100155181
Sequence GGCACCTATGGGTGACCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979797_1100979811 25 Left 1100979797 12:100155159-100155181 CCCCATGGTCACCCATAGGTGCC No data
Right 1100979811 12:100155207-100155229 GGTGTTACCAGGCAGCATACAGG No data
1100979797_1100979807 14 Left 1100979797 12:100155159-100155181 CCCCATGGTCACCCATAGGTGCC No data
Right 1100979807 12:100155196-100155218 GGAATTCCCCAGGTGTTACCAGG No data
1100979797_1100979803 -7 Left 1100979797 12:100155159-100155181 CCCCATGGTCACCCATAGGTGCC No data
Right 1100979803 12:100155175-100155197 AGGTGCCATGGCAGTTCCTGTGG No data
1100979797_1100979805 4 Left 1100979797 12:100155159-100155181 CCCCATGGTCACCCATAGGTGCC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979797 Original CRISPR GGCACCTATGGGTGACCATG GGG (reversed) Intergenic
No off target data available for this crispr