ID: 1100979802

View in Genome Browser
Species Human (GRCh38)
Location 12:100155171-100155193
Sequence AGGAACTGCCATGGCACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979802_1100979813 20 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979813 12:100155214-100155236 CCAGGCAGCATACAGGTAACAGG No data
1100979802_1100979815 29 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979815 12:100155223-100155245 ATACAGGTAACAGGCCTGGAAGG No data
1100979802_1100979807 2 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979807 12:100155196-100155218 GGAATTCCCCAGGTGTTACCAGG No data
1100979802_1100979805 -8 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979802_1100979814 25 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979814 12:100155219-100155241 CAGCATACAGGTAACAGGCCTGG No data
1100979802_1100979811 13 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979811 12:100155207-100155229 GGTGTTACCAGGCAGCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979802 Original CRISPR AGGAACTGCCATGGCACCTA TGG (reversed) Intergenic
No off target data available for this crispr