ID: 1100979805

View in Genome Browser
Species Human (GRCh38)
Location 12:100155186-100155208
Sequence CAGTTCCTGTGGAATTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100979795_1100979805 9 Left 1100979795 12:100155154-100155176 CCAGGCCCCATGGTCACCCATAG No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979797_1100979805 4 Left 1100979797 12:100155159-100155181 CCCCATGGTCACCCATAGGTGCC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979799_1100979805 2 Left 1100979799 12:100155161-100155183 CCATGGTCACCCATAGGTGCCAT No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979792_1100979805 21 Left 1100979792 12:100155142-100155164 CCTGTTAGCCGTCCAGGCCCCAT No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979798_1100979805 3 Left 1100979798 12:100155160-100155182 CCCATGGTCACCCATAGGTGCCA No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979791_1100979805 26 Left 1100979791 12:100155137-100155159 CCGAGCCTGTTAGCCGTCCAGGC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979794_1100979805 13 Left 1100979794 12:100155150-100155172 CCGTCCAGGCCCCATGGTCACCC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979801_1100979805 -7 Left 1100979801 12:100155170-100155192 CCCATAGGTGCCATGGCAGTTCC No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data
1100979802_1100979805 -8 Left 1100979802 12:100155171-100155193 CCATAGGTGCCATGGCAGTTCCT No data
Right 1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100979805 Original CRISPR CAGTTCCTGTGGAATTCCCC AGG Intergenic
No off target data available for this crispr