ID: 1100987522

View in Genome Browser
Species Human (GRCh38)
Location 12:100217565-100217587
Sequence CAGCACTACAGCTCACAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100987522 Original CRISPR CAGCACTACAGCTCACAGAT TGG Intronic
902342499 1:15793199-15793221 CAACATTACAGCCCACAGACTGG - Intergenic
903826809 1:26151661-26151683 CAGCACTCCTGCTCTCAGAGAGG - Intergenic
904439402 1:30520518-30520540 CAGCACAAAACCTCAGAGATGGG + Intergenic
904466127 1:30708518-30708540 CAGCAGTCCATTTCACAGATGGG + Intergenic
909540822 1:76789675-76789697 CTGCACTACACCTCACATAAAGG - Intergenic
912174276 1:107138973-107138995 CAGCACTACAGGACAAAGGTGGG + Intergenic
915271501 1:154756961-154756983 GAGCACTGCAGCTCAGAGAGAGG + Intronic
916418353 1:164613213-164613235 AAACACTATAGCTCACAAATTGG - Intronic
920589698 1:207205171-207205193 CAGCACTTCAGCTCACCGCGGGG - Intergenic
923077016 1:230618763-230618785 TTGCACTACACCTCACAAATGGG + Intergenic
1067319303 10:45202480-45202502 GGGCACTGAAGCTCACAGATAGG - Intergenic
1069384854 10:67874827-67874849 CAACATTACAGCCCACAGACTGG - Intergenic
1070520416 10:77248138-77248160 TAGCAATACAGCTCAGAGAAAGG - Intronic
1070919703 10:80176840-80176862 CAGGACCACAGCTCACAGTGGGG - Intronic
1071793608 10:88982122-88982144 CAGCTCTACAGCTTACTGGTTGG + Intronic
1075248252 10:120844094-120844116 CAGCGCAGTAGCTCACAGATGGG - Intergenic
1078467786 11:11562928-11562950 CAGCCCTCAAGTTCACAGATCGG + Intronic
1079146096 11:17853385-17853407 CAGGTCTACAGATAACAGATGGG - Intronic
1080842419 11:35997248-35997270 CAGCATTGCAGCTCACAGACTGG + Intronic
1081931793 11:46876618-46876640 CAGGGCTACAGACCACAGATGGG - Exonic
1083878496 11:65537080-65537102 CAGCAGCACTGCTGACAGATGGG + Exonic
1084431489 11:69113884-69113906 CAGCACTAGAGCCCAGAGACAGG - Intergenic
1087021558 11:93608323-93608345 CAGCACTACAGCTCATCTCTGGG - Intergenic
1087107385 11:94423802-94423824 CAGGGCTACAGCACACAGCTGGG + Intronic
1087928274 11:103945864-103945886 CAGCAGTAAAGCTCATACATAGG - Intronic
1089054992 11:115578153-115578175 CAACACTGCAGCCCACAGACTGG - Intergenic
1091505585 12:1064524-1064546 TAGGACTACAGCTAAAAGATTGG + Intronic
1094531157 12:31276536-31276558 CACCACTACAGCTCCCAGAGGGG - Intergenic
1094605890 12:31948740-31948762 CAACATTACAGCCCACAGACTGG - Intergenic
1098754150 12:74336849-74336871 TAGCACTACAGCTAAAAGAGTGG - Intergenic
1100987522 12:100217565-100217587 CAGCACTACAGCTCACAGATTGG + Intronic
1101112391 12:101498681-101498703 CATCACTACAGATCCCAGATGGG - Intergenic
1102804870 12:115770805-115770827 CAGAACTTCAGATCACAGGTGGG - Intergenic
1103509429 12:121464527-121464549 CAGCACGACAGGTCTCAGGTGGG + Intronic
1105003767 12:132708424-132708446 CAGCCCCACAGCTCTCAGACAGG + Intergenic
1106189956 13:27442952-27442974 CGGCACTACAGCTCAGAGCCTGG + Intronic
1107402996 13:40087268-40087290 CAGCACCTCAGCTCCCAGCTCGG - Intergenic
1108473748 13:50792467-50792489 CAGCACGACTCCACACAGATAGG + Intronic
1109449918 13:62498352-62498374 CAGCACTTCAGCTCTATGATTGG - Intergenic
1110551763 13:76818654-76818676 AAAAACTTCAGCTCACAGATGGG + Intergenic
1115499492 14:34036621-34036643 CAGCACTCAAGCTCAGAGCTGGG + Intronic
1116115170 14:40639432-40639454 CAGCATTACAACACACAGTTTGG + Intergenic
1116483361 14:45417707-45417729 CAGCACTCCAACTCCCAGATAGG - Intergenic
1117143123 14:52810046-52810068 CAGAAATACAGGTCACAGCTTGG - Intergenic
1119737882 14:76995543-76995565 AAGCCCCACAGCTCACAGAAAGG + Intergenic
1119807752 14:77493350-77493372 CAGCACTGCATCTGACAGAATGG + Intronic
1121589876 14:95096050-95096072 CAGCAGCACAGCTCACTGAAAGG + Exonic
1122662850 14:103309562-103309584 CAGCACAGCAGCTGACAAATGGG + Intergenic
1124693469 15:31844914-31844936 CATGTCTCCAGCTCACAGATGGG - Intronic
1126795563 15:52258063-52258085 GAGCTCTGCAGCTCACAGCTGGG + Intronic
1127580247 15:60331988-60332010 CCTCAATACAGCACACAGATGGG - Intergenic
1128138554 15:65282542-65282564 CAGCAAGACTGCTCACAGGTGGG - Intronic
1129006632 15:72379283-72379305 CAACATTACAGCCCACAGACTGG + Intergenic
1129938616 15:79473555-79473577 AAAAACTACAGCTCACAGAATGG - Intergenic
1129965250 15:79729226-79729248 CAGAACTAAAACTCAGAGATGGG - Intergenic
1136657440 16:31718605-31718627 CAGTAACACAGCTCACAGGTAGG - Intronic
1136673740 16:31880381-31880403 CAGTAACACAGCTCACAGGTAGG - Intronic
1138590624 16:57997799-57997821 CAGCACCACAGCTCCCACAGTGG - Exonic
1139246886 16:65453219-65453241 CAGCTCTACACCTAACACATTGG - Intergenic
1144805432 17:17963149-17963171 CACCACCACAGTTTACAGATTGG + Intronic
1146839807 17:36143164-36143186 CAGGAGTCCAGGTCACAGATTGG + Intergenic
1148331183 17:46814832-46814854 CAGCAGGACATCTGACAGATGGG + Intronic
1157649015 18:49308608-49308630 CTGCAGTACAGATCATAGATGGG - Intronic
1158518496 18:58150735-58150757 GACCACTACAGCTCACAAAGGGG - Intronic
1158620905 18:59031816-59031838 CAGCACTTCCCATCACAGATGGG - Intergenic
1160419266 18:78732864-78732886 CAGCACTCCAGCAAACAGCTGGG - Intergenic
1162890589 19:13730340-13730362 CTGCACTCCAGCTCAATGATAGG - Intergenic
1164310223 19:24039376-24039398 CAGTAATACAACTCACACATAGG - Intronic
1165221512 19:34320414-34320436 CAGCACTACCGTTCAGAGACAGG - Intronic
1165647446 19:37454442-37454464 TAGCACTACAGCTGGCAGAGCGG - Intronic
1167403802 19:49290680-49290702 CAGCACAACTGGACACAGATGGG + Exonic
929711459 2:44271021-44271043 CAACATTACAGCCCACAGACTGG - Intergenic
931696096 2:64871686-64871708 GAGCCCTACTGCTCACAGACGGG + Intergenic
935088257 2:99869401-99869423 CAGCTCTACAGCTGACACATGGG - Intronic
941354534 2:164473436-164473458 TAGCCCTACAGCTGACTGATAGG - Intergenic
944796515 2:203191187-203191209 CAACATTACAGCCCACAGACTGG - Intronic
944900748 2:204213105-204213127 CAGCACTTCACCTCACACTTGGG - Intergenic
944969120 2:204971332-204971354 CAGAACTAAAGCTCAGGGATGGG + Intronic
947469218 2:230385162-230385184 CAGAACAACAGCTCACAGGCTGG - Intronic
1170828978 20:19823514-19823536 CAACATTACAGCCCACAGACTGG + Intergenic
1174575809 20:51536306-51536328 CAGCACTATATCTCACAGCCAGG - Intronic
1174771810 20:53307331-53307353 CAGCTCTATAGCTCAGAGAGAGG - Intronic
1174789391 20:53463603-53463625 GAGAACTACTGCTCTCAGATAGG - Intronic
1174950844 20:55040343-55040365 CAGCACTACAACTGACACATAGG - Intergenic
1174953953 20:55075050-55075072 CAACATTACAGCCCACAGACTGG - Intergenic
1177224320 21:18234209-18234231 CATCACTTCCGCTCACAGAGGGG - Intronic
1178063250 21:28874955-28874977 CAGCACTACATCTCACCTCTGGG - Exonic
1178327032 21:31654469-31654491 CAGCACAGCAGCCCACAGAGAGG - Intergenic
1181597656 22:23927086-23927108 CAGAATTCCAGCTCACAGATTGG + Intergenic
1182661968 22:31931572-31931594 CAGCACCACAGGTCATAGCTGGG + Intergenic
1183023546 22:35046645-35046667 CTGCACTACTGCTCATAGTTGGG - Intergenic
951379226 3:21962609-21962631 CAGCAGTTCAGCTCCCAGAAGGG + Intronic
957577310 3:82025927-82025949 CAGCACTAAATCTAAGAGATAGG + Intergenic
957748370 3:84375747-84375769 CAGCACAACAGCTGAAAGTTGGG - Intergenic
964599527 3:158481620-158481642 GAGCACAGCAGCTCACAGACTGG + Intronic
964738518 3:159941444-159941466 CACCACTACAGCACACTGAGTGG + Intergenic
967477422 3:189937908-189937930 CAGCATTAGAGCCTACAGATGGG + Intergenic
972867500 4:43252106-43252128 TGGCAGTACAGTTCACAGATTGG + Intergenic
973624757 4:52760194-52760216 CTGCACTACTGCTCACAGCCAGG + Intergenic
974067695 4:57095062-57095084 CAGCACTTCAGCACAAAGTTTGG - Intronic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
978002049 4:103567958-103567980 CAGCAAGAGAACTCACAGATAGG + Intergenic
979762674 4:124426346-124426368 CACCATTAGAGCTCACAGAATGG + Intergenic
984874669 4:184356613-184356635 CAGCACTGCTGCCAACAGATAGG + Intergenic
992146154 5:73851281-73851303 CTGCATTACAGCTCTCATATGGG - Intronic
998266197 5:140669476-140669498 CACCACCACAGCTCGCAGCTGGG - Exonic
1000980369 5:167810475-167810497 CAGCCTTACAGCTTCCAGATGGG - Intronic
1003488272 6:6598038-6598060 GAGCACTAAAGCACACAGAGAGG - Intronic
1003952428 6:11128459-11128481 AAGCAGTACAGCTCACAGGTCGG - Intronic
1006461612 6:34162382-34162404 CAGCTCTACACCTCCTAGATGGG - Intergenic
1007093321 6:39198166-39198188 CAGCAAGGCAGCTAACAGATGGG + Intronic
1007555353 6:42761109-42761131 CACCACTACATCTCACTGATAGG - Intronic
1007637855 6:43310267-43310289 CAACATTACAGCCCACAGACTGG - Intronic
1009942064 6:70301758-70301780 AGGCACTGCAGCTCACAGATTGG + Intronic
1014839711 6:126204332-126204354 AAGCAATGTAGCTCACAGATGGG - Intergenic
1019192952 6:170264154-170264176 CAGCCTTTCAGTTCACAGATGGG - Intergenic
1023482799 7:40652768-40652790 CAGCACTGTAGCAAACAGATCGG - Intronic
1024789017 7:52941144-52941166 CTGCACTAAAGCTAACAGACAGG - Intergenic
1031480075 7:122267751-122267773 CAGCACTGCAGGCCACAGAAGGG + Intergenic
1033257526 7:139815024-139815046 CAGTATTTCAGCTCACAGCTGGG - Intronic
1037541089 8:19872088-19872110 CAGCTCTACTCCTCACAGATGGG + Intergenic
1043504211 8:80886463-80886485 CAGCCCTACAGCAGAGAGATGGG - Intergenic
1045770764 8:105737344-105737366 CAGCATTGCAGCCCACAGACTGG + Intronic
1050020534 9:1279965-1279987 CATCAGTACAGTTCACAGCTGGG + Intergenic
1050827497 9:9966995-9967017 AGGGACTACAGATCACAGATAGG + Intronic
1053298660 9:36933498-36933520 CAGAACTAGAGCTCAGAGAGGGG + Intronic
1055758340 9:79579319-79579341 CAGCATTACAGGTGAAAGATGGG - Intronic
1056561132 9:87730781-87730803 CAGAACTACAGATCAGAGACAGG - Intronic
1056580415 9:87885391-87885413 CAGCAATAGAGGTCCCAGATGGG - Exonic
1057351260 9:94300645-94300667 CAGCACCAGAGCTCACACACAGG + Exonic
1061311947 9:129769359-129769381 CAGCACTACAGCTCCCCTCTGGG - Intergenic
1061908837 9:133712323-133712345 CATCACCCCACCTCACAGATGGG - Intronic
1062097505 9:134710757-134710779 CACCACTGCACCCCACAGATGGG - Intronic
1062286154 9:135773408-135773430 TAGCACTACAGAGCACAGAGGGG + Intronic
1186120850 X:6359481-6359503 AAACAATTCAGCTCACAGATGGG - Intergenic
1188271801 X:28150311-28150333 CAGCACTACAGCACACTGATGGG + Intergenic
1189170327 X:38903236-38903258 CAACACTACAGCTCACTGTAGGG - Intergenic
1193356305 X:80523528-80523550 CAGCACTACAGCTCCTTGCTAGG + Intergenic
1194537491 X:95123132-95123154 AAGCACTACAGAGAACAGATTGG + Intergenic
1195296252 X:103481088-103481110 CAGCACCACAGCTTCCAGAGAGG - Intergenic
1196648662 X:118146468-118146490 CAACATTGCAGCCCACAGATTGG - Intergenic
1199728042 X:150604338-150604360 CATGACAACAGCTGACAGATAGG + Intronic