ID: 1100987603

View in Genome Browser
Species Human (GRCh38)
Location 12:100218496-100218518
Sequence GAAGGATTAAAGAGTATTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100987603_1100987607 1 Left 1100987603 12:100218496-100218518 CCGGAAATACTCTTTAATCCTTC 0: 1
1: 0
2: 1
3: 12
4: 275
Right 1100987607 12:100218520-100218542 GATATAGGCATTCAAGAAATGGG 0: 1
1: 0
2: 1
3: 12
4: 209
1100987603_1100987606 0 Left 1100987603 12:100218496-100218518 CCGGAAATACTCTTTAATCCTTC 0: 1
1: 0
2: 1
3: 12
4: 275
Right 1100987606 12:100218519-100218541 TGATATAGGCATTCAAGAAATGG 0: 1
1: 0
2: 5
3: 25
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100987603 Original CRISPR GAAGGATTAAAGAGTATTTC CGG (reversed) Exonic
905602903 1:39269367-39269389 GAAGGAACCAAGAGTGTTTCAGG + Intronic
907559996 1:55379526-55379548 GGAGGGTTACAGAGTCTTTCAGG - Intergenic
907768123 1:57431113-57431135 GAAGCAAGAAAAAGTATTTCAGG + Intronic
908002538 1:59694620-59694642 GATATATTAAAAAGTATTTCTGG + Intronic
908823209 1:68108933-68108955 AAAGTATTAAAGAGCACTTCTGG + Intronic
908995121 1:70142388-70142410 CAAGGATGAAAGTGTATTTGAGG - Intronic
909278930 1:73723887-73723909 GAAGTGATAAAGAGTATGTCTGG + Intergenic
909669639 1:78173628-78173650 GAAGAAAAAAAGGGTATTTCAGG - Intergenic
911596987 1:99809106-99809128 GAAGGCTTCATAAGTATTTCAGG - Intergenic
912513690 1:110205034-110205056 GAAGTATTAAAAAGAATTTGGGG - Intergenic
912588595 1:110790358-110790380 GAAGGAATAAAGAGAATTAATGG + Intergenic
913696198 1:121328137-121328159 GAAGAATGAAGGATTATTTCAGG + Intronic
914141366 1:144951921-144951943 GAAGAATGAAGGATTATTTCAGG - Intronic
915515902 1:156412600-156412622 GGAAGATTCAACAGTATTTCTGG + Intronic
917147752 1:171911112-171911134 GAAGGATTTAAGTGGATTCCTGG - Intronic
918448127 1:184634455-184634477 CAAGGATTAAAGAGGATTTAGGG - Intergenic
918463791 1:184801492-184801514 GAAGGATGAAAGGGTGTTGCAGG - Intronic
919790465 1:201287128-201287150 GAAGGGAGAAAGAGAATTTCAGG - Intronic
922703200 1:227774369-227774391 GAAGGATGAAAGAGCAATGCCGG + Intronic
922923304 1:229327437-229327459 GAAGGACTAAGGAGCATTTTCGG - Intronic
924087715 1:240470352-240470374 GAAGGATTAAAGGCAATTTATGG + Intronic
1063901469 10:10737230-10737252 TAAGGATTAAAGAGAATTATAGG - Intergenic
1065655229 10:27941664-27941686 TAAGGATTAAGCAGTATGTCAGG + Intronic
1067122119 10:43482359-43482381 GTAGGATAAAAGAGGATTTATGG - Exonic
1069664878 10:70147746-70147768 GGAGGATGAACGAGTATGTCGGG + Exonic
1070230584 10:74562431-74562453 GATGGATTCAAGAGTATATTGGG + Intronic
1070328057 10:75400697-75400719 GAAGAATTAAGGAGTGTTTGTGG - Intronic
1070654826 10:78264162-78264184 GAAGGAAGAAAGATCATTTCAGG + Intergenic
1070864765 10:79701175-79701197 GTTCCATTAAAGAGTATTTCTGG + Intergenic
1070878552 10:79839303-79839325 GTTCCATTAAAGAGTATTTCTGG + Intergenic
1071021947 10:81068051-81068073 GATGTATTACAGAGCATTTCTGG + Intergenic
1071631663 10:87223393-87223415 GTTCCATTAAAGAGTATTTCTGG + Intergenic
1071645109 10:87355613-87355635 GTTCCATTAAAGAGTATTTCTGG + Intergenic
1072032116 10:91530847-91530869 GCAGGAACAAAGAGTCTTTCTGG + Intergenic
1072254912 10:93612480-93612502 ACAGGATTAAAGAGTTCTTCAGG - Intergenic
1072301177 10:94063882-94063904 GGAAGAGTAAAGAGTTTTTCAGG + Intronic
1072459641 10:95607318-95607340 TAAGATTTAAAGAGTATTTGAGG - Intronic
1072524020 10:96255577-96255599 AATGGATTAAAGAGTGTCTCAGG + Intronic
1072558472 10:96545384-96545406 TCAGGATTAAGGAGTTTTTCTGG - Intronic
1073630450 10:105142953-105142975 GAAGGATAAATCAGTATTTGGGG - Intronic
1073962221 10:108945489-108945511 GAAATATCAGAGAGTATTTCAGG + Intergenic
1074262374 10:111866881-111866903 TAAGGATTAAAAAGTATATCAGG + Intergenic
1074675105 10:115839565-115839587 GAATGATGAAGGAGGATTTCTGG - Intronic
1079928184 11:26522653-26522675 GAAGAATTAAGGAGAATTACAGG + Intronic
1080649425 11:34210305-34210327 GAAGGGATAAAAAGGATTTCAGG - Intronic
1081193492 11:40133161-40133183 GAAGGATTAATGAGAAGTTGGGG - Intronic
1081515126 11:43821278-43821300 GAAGGATTTAAGAGTAAAACTGG - Intronic
1082230753 11:49762953-49762975 GCTGGATTAAATGGTATTTCTGG + Intergenic
1086341957 11:85855876-85855898 GAAGGATGCAAGAGTATGTGAGG - Intronic
1086619300 11:88866020-88866042 GCTGGATTAAATGGTATTTCTGG - Intronic
1088039475 11:105360590-105360612 ATAAGATTAGAGAGTATTTCAGG - Intergenic
1088702759 11:112428269-112428291 GATGGATCAAATGGTATTTCTGG - Intergenic
1089932400 11:122327134-122327156 GAAAGGTTAAAGAATAATTCTGG - Intergenic
1090049742 11:123367487-123367509 GAAGGGTGAAATTGTATTTCAGG + Intergenic
1090468169 11:126954222-126954244 CAAGGATTATAGAGGAATTCTGG + Intronic
1092067107 12:5599862-5599884 GAAGAATTCAAAAGTATTTTGGG - Intronic
1092747028 12:11682717-11682739 GATGGATTAAAGACTTTTTATGG - Intronic
1093081597 12:14817858-14817880 GATGGGTCAAATAGTATTTCTGG + Intronic
1093679127 12:21980627-21980649 AAAGGAATAAAAGGTATTTCAGG + Intergenic
1094622626 12:32094862-32094884 GAAAGATGAAAGACAATTTCTGG + Intergenic
1095831813 12:46595820-46595842 GCTGGATCAAATAGTATTTCTGG + Intergenic
1095914377 12:47461331-47461353 AAAAGATTAAAAAGAATTTCTGG + Intergenic
1096404526 12:51333812-51333834 CAGGGATTTGAGAGTATTTCAGG + Intronic
1097326692 12:58285128-58285150 GAAGCATTAAAGGGTTTTTCAGG + Intergenic
1099680754 12:85824867-85824889 AAGGGATCAAAGAGTGTTTCAGG - Intronic
1099906645 12:88779177-88779199 GAAGGAAGGAAGAGTATTTATGG + Intergenic
1099973073 12:89520032-89520054 GTAGAATTACAGAGTATTTTTGG + Exonic
1100422683 12:94452710-94452732 GAAGGATGAAAGAATATGACGGG + Intronic
1100987603 12:100218496-100218518 GAAGGATTAAAGAGTATTTCCGG - Exonic
1101170096 12:102082935-102082957 GAAGAATTAAAGATGATTTTAGG + Intronic
1102423403 12:112821872-112821894 GAAGAATTAAAAAATATTTATGG - Intronic
1103143647 12:118574725-118574747 GCAAAATTAAATAGTATTTCAGG - Intergenic
1103464134 12:121128457-121128479 GAAGCATTAAAGAGTAGGTCAGG + Intergenic
1104121782 12:125806733-125806755 GAATGAACAAAGAGCATTTCAGG + Intergenic
1104143993 12:126015158-126015180 CATGGATCAAAGAGTAATTCTGG - Intergenic
1104499564 12:129271938-129271960 GCTGGGTTAAACAGTATTTCTGG + Intronic
1106492881 13:30244453-30244475 GCTGGATCAAAGGGTATTTCTGG + Intronic
1106948941 13:34861229-34861251 AAATGATTAAGAAGTATTTCAGG + Intergenic
1109143072 13:58740574-58740596 GAAAGATTTAAGAGTATCTGTGG - Intergenic
1109281908 13:60366440-60366462 GAAGGATAAGAGATTGTTTCTGG - Intergenic
1111159426 13:84374170-84374192 GAAGGATTAAGTAATTTTTCTGG - Intergenic
1111545216 13:89724667-89724689 GAAAAATTAAACAGTATTACTGG - Intergenic
1112614067 13:100985453-100985475 AAAGGACTAAAGTATATTTCAGG - Intergenic
1116471133 14:45286893-45286915 GCAGGTTTAATAAGTATTTCTGG - Intergenic
1116582939 14:46665051-46665073 GAAGTGTTAATGTGTATTTCTGG - Intergenic
1117458738 14:55923729-55923751 GAAGGAAAAAAGTGTATTCCTGG - Intergenic
1117651833 14:57915580-57915602 GAATGATAAAATAGTATATCGGG - Intronic
1117665617 14:58053049-58053071 GATGGATTCAAGAGTAATTTAGG - Intronic
1118595762 14:67434626-67434648 GGAGGACTAAAGAATGTTTCAGG + Intergenic
1119272721 14:73323806-73323828 AAAGGTTGAAAGACTATTTCAGG + Intronic
1120396673 14:83975822-83975844 GAAGCATTAAATATCATTTCAGG - Intergenic
1120872345 14:89348860-89348882 GAAGGATTATAGAGGAGCTCTGG - Intronic
1121355725 14:93212951-93212973 GACGGATCAAAGTGTATTTGTGG + Intronic
1122675313 14:103407908-103407930 AGAAGAGTAAAGAGTATTTCAGG - Intronic
1123255949 15:17548567-17548589 GAAGTTTCAAAGAGTACTTCTGG - Intergenic
1123261772 15:17651015-17651037 GAAGTTTCAAAGAGTACTTCTGG - Intergenic
1123708683 15:22969521-22969543 GAAGGATTTCAGAGCATTCCAGG - Intronic
1123966474 15:25464876-25464898 GAAGCTTTTAAGAGTATTACAGG - Intergenic
1126397690 15:48236369-48236391 GAAGAAATATAGAGTATTCCAGG + Intronic
1126681819 15:51209699-51209721 GTAGGATTAAAAAATACTTCAGG + Exonic
1127605989 15:60589348-60589370 GGAGGCTTAAAGGGAATTTCTGG - Intronic
1129306042 15:74663560-74663582 AAAGGATTTTGGAGTATTTCTGG - Intronic
1131561668 15:93448970-93448992 GAAAGAATAGATAGTATTTCAGG + Intergenic
1132525547 16:412457-412479 AGAGGATTAAAGAGAATTGCTGG + Exonic
1133489569 16:6254359-6254381 GAATCATTAAAGAGAATTTACGG + Intronic
1134570666 16:15288148-15288170 GAGGGATTAAGGAGCATTTTTGG + Intergenic
1134731715 16:16467924-16467946 GAGGGATTAAGGAGCATTTTTGG - Intergenic
1134935734 16:18244077-18244099 GAGGGATTAAGGAGCATTTTTGG + Intergenic
1135415146 16:22263306-22263328 AAATTAATAAAGAGTATTTCAGG + Intronic
1136370999 16:29835961-29835983 GAAGGGTTAAATAGTCTTTCTGG + Intronic
1138918191 16:61493948-61493970 AGAGGAGTGAAGAGTATTTCCGG + Intergenic
1138966167 16:62086561-62086583 GGTGGATCAAAGAGCATTTCTGG - Intergenic
1140151104 16:72366909-72366931 GAATGATTAAAATTTATTTCTGG - Intergenic
1140551030 16:75865729-75865751 GAAAGATTAATGGGAATTTCTGG - Intergenic
1140647511 16:77049300-77049322 GAAGGATGAAAAGGAATTTCAGG + Intergenic
1141160328 16:81625361-81625383 GAAGCATTAAATAGTTATTCTGG + Intronic
1141551948 16:84812161-84812183 GAAGGATTTACGAGCATTCCAGG + Intergenic
1142001665 16:87667736-87667758 CAAGGACTAGAGAGTATTTTAGG + Intronic
1144461258 17:15460337-15460359 GAAGGATTTAAGACAATTACAGG - Intronic
1146144798 17:30404678-30404700 AAAGGATTATAGAACATTTCTGG - Intronic
1147052316 17:37804536-37804558 GAATTATTAATGAGTTTTTCAGG + Intergenic
1148318890 17:46732322-46732344 GAAGGAGAAAAGAGAATATCTGG - Intronic
1150357785 17:64502777-64502799 GAAGGATTCAAGAAATTTTCAGG + Intronic
1150428451 17:65096357-65096379 GCTGGATTAAATGGTATTTCTGG - Intergenic
1150470952 17:65437199-65437221 GAATGATAAAAGAGCATTTATGG + Intergenic
1151744186 17:76002699-76002721 GGCGGATTAAAGAGTGTTTGGGG + Intronic
1151990950 17:77573809-77573831 GATGTATTAAAGACTATTTAAGG - Intergenic
1155753264 18:29455951-29455973 AAAGGAATAAAAGGTATTTCAGG - Intergenic
1156060528 18:33069478-33069500 GAAGAATTAAACTATATTTCTGG + Intronic
1157026359 18:43848893-43848915 AAAGGATTAAAAAATATTTGAGG - Intergenic
1158042310 18:53110165-53110187 AAATGATTAAAAAGTAATTCTGG + Intronic
1158247084 18:55444564-55444586 GAGGGAAAAATGAGTATTTCAGG + Intronic
1159281585 18:66292643-66292665 GCTGGATTAAATGGTATTTCCGG + Intergenic
1159982859 18:74807225-74807247 GCAGCATTAAAGAGTATTCTAGG + Intronic
1164119407 19:22252477-22252499 GAGGGGTTATAGAGTATCTCTGG - Intergenic
1164651559 19:29894366-29894388 GAAGGTTTAAAACCTATTTCTGG - Intergenic
1165239544 19:34454512-34454534 GAAGGATTGAAGATTTTATCAGG + Exonic
1167110959 19:47460910-47460932 AAAAGATAAAAGAGTATTTATGG + Intronic
927405673 2:22763542-22763564 GCTGGTTTAAATAGTATTTCTGG + Intergenic
929012915 2:37464031-37464053 GAATGGTTATAGAGTTTTTCTGG + Intergenic
929506931 2:42535553-42535575 GAAGTATTACATGGTATTTCTGG - Intronic
932406326 2:71515198-71515220 TAAAGAATAAAGACTATTTCTGG + Intronic
932444357 2:71766068-71766090 TATTGATTAAACAGTATTTCTGG + Intergenic
933388360 2:81639770-81639792 GCTGGATCAAATAGTATTTCTGG - Intergenic
935106964 2:100053812-100053834 AAAGGATTAAGTAGTATTTGGGG + Intronic
935217637 2:100987300-100987322 GAAAGATTTAAGAGAATTTGAGG - Intronic
936431466 2:112467404-112467426 GAATCATTAAAGACTATTACAGG + Intergenic
936770583 2:115907933-115907955 GGAGGATTATACAATATTTCTGG + Intergenic
937208138 2:120249961-120249983 GAAGGACAGGAGAGTATTTCAGG - Intronic
940066605 2:149637073-149637095 GAATCATTAAAGAGGATTTATGG - Intergenic
940401226 2:153250494-153250516 GATGGATCAAATGGTATTTCTGG - Intergenic
940421031 2:153479060-153479082 GGATGATTAAAGAGTTTGTCGGG + Intergenic
940636501 2:156304327-156304349 GCAGGGTTAAATGGTATTTCTGG - Intergenic
942639381 2:178045406-178045428 CAAGGACTAAACAATATTTCTGG - Intronic
942850831 2:180483480-180483502 GTAGGAGCAAAGAGTATTACAGG - Intergenic
942895604 2:181049757-181049779 GAAGAATTAATAACTATTTCTGG - Intronic
943206400 2:184902656-184902678 AAATTTTTAAAGAGTATTTCTGG + Intronic
945217498 2:207449734-207449756 AAAGAATTAAAGAGAAGTTCAGG + Intergenic
946995975 2:225391929-225391951 ACAGGATGAAACAGTATTTCAGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1171568216 20:26216225-26216247 GTAGGATTAAAAGCTATTTCTGG + Intergenic
1173031500 20:39365331-39365353 GAAGGAATAAATAGGTTTTCTGG + Intergenic
1175313737 20:58030682-58030704 GAAGGATTAAAGAGATTTACAGG + Intergenic
1176911320 21:14568531-14568553 GAAGGAATGAAGAGTACTTGTGG - Intronic
1178104490 21:29302450-29302472 GAATGGTTAAAAAGTAGTTCTGG + Intronic
1179019913 21:37629948-37629970 AAAATATTAAAAAGTATTTCTGG + Intronic
1179067166 21:38036347-38036369 GAAGGATGAAAGAGTGTATTAGG - Intronic
1180298738 22:11018527-11018549 AAAGGAATAAAGAATATTGCTGG + Intergenic
1181485153 22:23225865-23225887 GAAGGCTCAAAGCGTGTTTCAGG - Intronic
950020686 3:9785512-9785534 GAAAGATAAAAGGATATTTCTGG - Intronic
952560929 3:34592613-34592635 GAAGGAGTAAAGAGCATGACTGG - Intergenic
954286460 3:49623063-49623085 GAAGGATTGCAGAGTATCTTGGG + Intronic
954935000 3:54318314-54318336 GAAGGAATAAATGGTTTTTCAGG + Intronic
957164181 3:76649979-76650001 GAAGGAATAAAAAGTCTTTTAGG + Intronic
957503481 3:81089240-81089262 GAAGGTTTGGAGAGTATCTCTGG + Intergenic
959162502 3:102738600-102738622 GAAGGCTGAAAGAGCCTTTCTGG + Intergenic
959407652 3:105979988-105980010 AAATGATTACAGAGTCTTTCTGG + Intergenic
960221793 3:115120650-115120672 GAGGAATTGAAGAGAATTTCAGG + Intronic
961235522 3:125363104-125363126 GATGGTTTAAAGATTATTTTGGG - Intronic
962680409 3:137793645-137793667 ACAGAATTAAAGATTATTTCTGG - Intergenic
965909969 3:173761983-173762005 GAAGGGTTACAGAATGTTTCAGG + Intronic
966647561 3:182263402-182263424 GAAGGAAGGAAGAGTTTTTCAGG + Intergenic
967543797 3:190699752-190699774 ATTGCATTAAAGAGTATTTCTGG + Intergenic
968834984 4:2956929-2956951 GCAGCCTTAAAGAGTATTTTGGG + Intronic
969899985 4:10340186-10340208 GCTGGATTAAATGGTATTTCTGG - Intergenic
970030768 4:11671768-11671790 GAAGGATAAATAATTATTTCTGG + Intergenic
971033902 4:22671734-22671756 GAATGATTAAAGTTTATTTTTGG - Intergenic
971113037 4:23610694-23610716 TAAGGAAGAAACAGTATTTCAGG - Intergenic
973031577 4:45348590-45348612 GCTGGATCAAATAGTATTTCTGG - Intergenic
973671511 4:53223587-53223609 GAAGGATGAAAGGGAATTGCCGG - Intronic
973791055 4:54378552-54378574 GAAGGATTAAAGAGTTCTTTAGG - Intergenic
973954919 4:56053424-56053446 GAAGAATTAAGGCGTTTTTCAGG + Intergenic
974778485 4:66520484-66520506 GAAAGATCAAAGAGTCTGTCTGG + Intergenic
977205326 4:94159167-94159189 TAAGGAATACAGAGTATGTCTGG + Intergenic
979228652 4:118320886-118320908 GAAGGATAAAAGAATATTATAGG + Intronic
980239848 4:130159620-130159642 GCTGGATTAAATGGTATTTCTGG - Intergenic
980860687 4:138496269-138496291 TAAGGATTCAAGAGAATTTATGG - Intergenic
981115903 4:140990863-140990885 GGTGGATCAAAGGGTATTTCTGG + Intronic
981261566 4:142727125-142727147 GAAGGAAGAAAGAGTCCTTCTGG + Intronic
982113592 4:152078293-152078315 GCTGGATTAAATGGTATTTCTGG - Intergenic
982988987 4:162246392-162246414 GCTGGATCAAATAGTATTTCTGG + Intergenic
983574649 4:169248101-169248123 GCTGGATCAAATAGTATTTCTGG - Intronic
983675161 4:170283580-170283602 CTAGGATTAAAGAGTATGTTTGG + Intergenic
985242129 4:187941613-187941635 GAATGTTTGAAGAGTGTTTCAGG - Intergenic
985332859 4:188859477-188859499 GCTGGGTCAAAGAGTATTTCTGG + Intergenic
985433386 4:189903329-189903351 GAAGGAGGAAACAGCATTTCAGG - Intergenic
987781543 5:22442819-22442841 CAAGGTTTAAAGAGTACTTCTGG + Intronic
989471873 5:41828844-41828866 GAAGGATTAAATAATATTTTAGG + Intronic
989576778 5:42995203-42995225 CAGGGATTAAAGAGTTCTTCAGG - Intergenic
990062860 5:51673373-51673395 GCTGGATCAAATAGTATTTCTGG + Intergenic
990762801 5:59149285-59149307 GAAGGCTTAGAGAGTCTTACTGG - Intronic
991707058 5:69368867-69368889 GAAGGCATATAGAGCATTTCGGG - Intronic
993660235 5:90624245-90624267 GAAGCATTACACAGTTTTTCAGG + Intronic
994099054 5:95874845-95874867 AAAAGATTATATAGTATTTCTGG - Intergenic
994226380 5:97255531-97255553 AAAGGATTAAAAAGAAATTCTGG + Intergenic
994342261 5:98644662-98644684 GAATGAATAAAGGATATTTCTGG - Intergenic
994510146 5:100692381-100692403 GAAAGATTAAACAGAATTTGAGG + Intergenic
994575861 5:101578738-101578760 GAAGGCTGAAGTAGTATTTCTGG + Intergenic
995143028 5:108755215-108755237 GCAGAATAAAAGAGCATTTCTGG + Intronic
995176416 5:109183155-109183177 GAAGGCTTGTAGAGTCTTTCAGG - Intronic
995230497 5:109755988-109756010 AAAGTATTAAAGAGAATTCCTGG - Intronic
998605071 5:143625020-143625042 GTAGGATTAAAAAATAGTTCCGG + Intergenic
999873226 5:155773749-155773771 CAAGGGTTGAAGAGTATTTAAGG + Intergenic
1002794294 6:458407-458429 GCTGGATTAAATGGTATTTCTGG + Intergenic
1004046131 6:12025570-12025592 GAAGGCTTAGAAAATATTTCTGG + Intronic
1005772751 6:29092212-29092234 GCTGGGTTAAATAGTATTTCTGG + Intergenic
1005796319 6:29365767-29365789 GCTGGGTTAAATAGTATTTCTGG - Intronic
1006740185 6:36302401-36302423 GAAGGCTGAAAGAGAACTTCGGG - Exonic
1007032966 6:38645511-38645533 GACGGATCAAAAAGTATTTTAGG + Intergenic
1009269466 6:61599954-61599976 GAAAAAATAAAGACTATTTCTGG + Intergenic
1010943427 6:81947112-81947134 GAGGCATTAAAGAATATTTTTGG + Intergenic
1011065269 6:83319479-83319501 GAAGGCCTAAAGAGTTTTTAAGG + Intronic
1011235958 6:85217412-85217434 GCTGGATCAAATAGTATTTCTGG - Intergenic
1011738843 6:90339136-90339158 GAAGTATGAAAGAGTATGTCTGG + Intergenic
1013267358 6:108512721-108512743 GAAGGAAAAAAGAATTTTTCTGG + Intronic
1014056474 6:117021520-117021542 GAAAGATTAAAATATATTTCAGG + Intergenic
1014456739 6:121644111-121644133 GCTGGGTCAAAGAGTATTTCTGG - Intergenic
1017079612 6:150655245-150655267 GCTGGATCAAATAGTATTTCTGG - Intronic
1020464658 7:8463810-8463832 GAGGGATTAAAGATTATCTAAGG + Intronic
1020632819 7:10660682-10660704 GAGGGAGGAAAGAGTATTTAAGG + Intergenic
1020985207 7:15125022-15125044 GAAGGTTAAAACAGTATTTTTGG + Intergenic
1023257130 7:38323101-38323123 AAAGGCTTAAAGAGTGTTGCTGG + Intergenic
1024932498 7:54678488-54678510 GTAGAATTAAAGAGAATTTGGGG + Intergenic
1028535269 7:91884657-91884679 AAAGGACCAAATAGTATTTCAGG + Intergenic
1028626617 7:92884869-92884891 GCAGGGTCAAATAGTATTTCTGG + Intergenic
1029232708 7:99084734-99084756 GAGGGAGTATAGAGGATTTCTGG - Intronic
1029820514 7:103142145-103142167 GAAGGATCAAAGGGATTTTCTGG + Intronic
1030073573 7:105718432-105718454 GCAGGATTAAGGCGTATTTAAGG + Intronic
1030352286 7:108503432-108503454 GAAAGAATTTAGAGTATTTCAGG - Intronic
1030768781 7:113446473-113446495 GAAGGAATATAGAGCATTTTGGG - Intergenic
1031152682 7:118072969-118072991 GATGGATTAAAGAGAACTTGTGG - Intergenic
1031450166 7:121906237-121906259 CAAGGATGAAAGATTATGTCTGG + Intronic
1031696421 7:124861134-124861156 GCAGTGTTAAACAGTATTTCTGG + Intronic
1032679335 7:134166054-134166076 GAAGGCTCAAAGAATATTTGGGG - Intronic
1034881862 7:154768716-154768738 GAAGGAATAATGGGTGTTTCTGG + Intronic
1037505749 8:19527618-19527640 AAAGGATAAAAGAGGCTTTCTGG + Intronic
1037853610 8:22353345-22353367 GAAGGTTTAAAAAATATTTAAGG + Intronic
1038340606 8:26682232-26682254 GCATGAATAAAGAGTATTTCTGG - Intergenic
1039847384 8:41335433-41335455 GAAGCATTAAAGAAAATGTCTGG + Intergenic
1043025419 8:75061411-75061433 GATGGATTAAAAGGTATTTCTGG - Intergenic
1043232433 8:77820105-77820127 GAGGTATGAAAGAGTATGTCTGG - Intergenic
1043420221 8:80090089-80090111 GAAGTTTTAAAAAGTATTTTAGG + Intronic
1043762533 8:84085692-84085714 GGAGGAAGAAAGAGTATTGCTGG - Intergenic
1044222339 8:89683965-89683987 GCTGAATTAAATAGTATTTCTGG - Intergenic
1044555523 8:93558290-93558312 GAAGAAATAAAAAGTATTTGTGG + Intergenic
1046158081 8:110320213-110320235 GCTGGGTTAAAGAGAATTTCAGG + Intergenic
1047543059 8:125789279-125789301 AAAATATTAAAGAGTATGTCAGG - Intergenic
1047774959 8:128062369-128062391 GAAGGGTTAAAGAGTATCCTAGG - Intergenic
1048262505 8:132956884-132956906 GAAGGATTAAAGAACAGTTTAGG + Intronic
1050647384 9:7734978-7735000 TAAGGATTAAGTAGTGTTTCTGG - Intergenic
1051533009 9:18126391-18126413 GAAGGATAAAGGAGGACTTCCGG - Intergenic
1055616108 9:78074581-78074603 GGAGGCTTTATGAGTATTTCAGG - Intergenic
1055872600 9:80901700-80901722 GCTGGATCAAATAGTATTTCTGG - Intergenic
1056334342 9:85551299-85551321 GAAAAACTAAAGAGTATTTAGGG - Intronic
1058843089 9:108929986-108930008 GAAGCATTAAAAAGTATTTCTGG - Intronic
1186702059 X:12101439-12101461 GAGGGATTAAACATTATTCCAGG - Intergenic
1188305377 X:28555546-28555568 GAAGCAAGAAGGAGTATTTCTGG - Intergenic
1188528637 X:31113289-31113311 AAAGGAGTCAAGAGTATTTAAGG + Intronic
1189077747 X:37935339-37935361 GAAAAATTAGAGAGTCTTTCAGG + Intronic
1190550434 X:51574217-51574239 GAAGGAGTGAGGAGTCTTTCTGG - Intergenic
1191743034 X:64455938-64455960 GAGGGAACAAGGAGTATTTCAGG + Intergenic
1193605439 X:83562288-83562310 GCTGGATCAAAAAGTATTTCTGG + Intergenic
1195574062 X:106430061-106430083 AAGGCATGAAAGAGTATTTCTGG - Intergenic
1196190737 X:112791612-112791634 AAAGGCTTAAAGGATATTTCTGG + Intronic
1196237290 X:113297743-113297765 AAAGGATTAAATAATATTTTAGG + Intergenic
1197310080 X:124894052-124894074 GAAGGATAAAACAGGATTCCAGG - Intronic
1198436096 X:136618215-136618237 TAAGGAGTAAAGAGGATGTCGGG + Intergenic
1199612546 X:149631021-149631043 CAAGGATTCAACAGTGTTTCAGG + Intronic
1200806746 Y:7441649-7441671 GCTGGATTAAATGGTATTTCTGG + Intergenic