ID: 1100990690

View in Genome Browser
Species Human (GRCh38)
Location 12:100248306-100248328
Sequence TTGCCCAGACAATTTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100990683_1100990690 23 Left 1100990683 12:100248260-100248282 CCCATTTCGTAGTTGAGGAAACT 0: 1
1: 3
2: 132
3: 1108
4: 4631
Right 1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 136
1100990684_1100990690 22 Left 1100990684 12:100248261-100248283 CCATTTCGTAGTTGAGGAAACTG 0: 1
1: 6
2: 165
3: 1299
4: 5436
Right 1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100990690 Original CRISPR TTGCCCAGACAATTTGGTGC TGG Intronic
903947243 1:26971631-26971653 TTGGTCAGACAAGGTGGTGCAGG + Intergenic
903952450 1:27004285-27004307 TTGCCCAGACTCTTTGATCCAGG - Intergenic
906852403 1:49265668-49265690 TTGCCCAGACAATGTGTTTAGGG + Intronic
910391647 1:86751511-86751533 TTCACCAGACAATCTGGTGAGGG - Intergenic
914755154 1:150558156-150558178 TTGCCCAGGCAAGGAGGTGCTGG + Intronic
916384187 1:164249351-164249373 TTGCCCAGAAAATTTAGGGAGGG - Intergenic
922671098 1:227509249-227509271 TTGCCCTGAAATTTTGGAGCAGG - Intergenic
924899505 1:248382082-248382104 GTGGCCACACAATTTGGTGGTGG + Intergenic
1063864632 10:10350750-10350772 TGGCCCAGTCAAGTTGATGCAGG + Intergenic
1065662833 10:28023719-28023741 TTGCCCAGGCACTTCTGTGCAGG - Intergenic
1066698555 10:38100989-38101011 TTGAACAGACATTTTGTTGCAGG - Intronic
1070413690 10:76169136-76169158 TTGGCAGGAAAATTTGGTGCAGG + Intronic
1071183208 10:83010662-83010684 TTGCCCAGACAGTGTTGTGATGG - Intergenic
1074767485 10:116710298-116710320 TTGCCCAGAAAATCTGGTGTTGG + Intronic
1076986413 11:239558-239580 TTGCCCAGACACTTCTGTCCTGG + Intronic
1081839022 11:46182460-46182482 TTGCTCAGAAAGTTTGGTGATGG - Intergenic
1083097908 11:60270976-60270998 TTGCCCATTCAATATGGTGTTGG + Intergenic
1086128804 11:83379313-83379335 ATGCCCAGTCAAGTTGGTACAGG + Intergenic
1087236124 11:95720326-95720348 CTGCCCAGACAATTCTGGGCAGG - Intergenic
1090574157 11:128082435-128082457 TTGCCCATTAAATTTGATGCTGG + Intergenic
1091899354 12:4132707-4132729 AGGCACAGACAATTTGGTGATGG - Intergenic
1093492008 12:19715758-19715780 TTGCCCATTCAATTTGATGTTGG + Intronic
1095796282 12:46222369-46222391 TTGCCCAGAATATTTGGGGAGGG - Intronic
1096853356 12:54458151-54458173 TTGCCCAGACACATTGCTTCTGG - Intronic
1097640641 12:62177293-62177315 CTGCCTAGACAAGTTGGTGGTGG - Intronic
1098317894 12:69211335-69211357 TTGCCCAGAGGATTTCCTGCAGG - Intergenic
1098591233 12:72215582-72215604 TTGCCATGACAATTTGGTAAGGG - Intronic
1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG + Intronic
1103284540 12:119789320-119789342 TTGGCCAGACCATTTGGTACTGG + Intronic
1104357862 12:128104170-128104192 TTGCCCAGAGTATTTGCTGAGGG + Intergenic
1106210280 13:27636444-27636466 TTACCCAAACATTTTGGTTCAGG + Intronic
1108890836 13:55257141-55257163 TTGTCCCGACAATTTCATGCTGG + Intergenic
1113669589 13:112166503-112166525 TTGCCCAGAGAAATTGTTCCAGG - Intergenic
1116303130 14:43212145-43212167 TTGCCCTGTCACTCTGGTGCTGG + Intergenic
1117537090 14:56712859-56712881 TTGCCATGAAAATTTGCTGCAGG - Intronic
1121219994 14:92278008-92278030 TTCCCCAGACACTTTGGGGGCGG - Intergenic
1122909222 14:104818825-104818847 TTGCCCAGACACTGTGGTCGGGG - Intergenic
1123507507 15:20959200-20959222 TTTGCAAGACCATTTGGTGCAGG + Intergenic
1123507555 15:20959722-20959744 TTTTCAAGACCATTTGGTGCAGG - Intergenic
1123564732 15:21532943-21532965 TTTGCAAGACCATTTGGTGCAGG + Intergenic
1123564781 15:21533470-21533492 TTTTCAAGACCATTTGGTGCAGG - Intergenic
1123600988 15:21970234-21970256 TTTGCAAGACCATTTGGTGCAGG + Intergenic
1123601036 15:21970758-21970780 TTTTCAAGACCATTTGGTGCAGG - Intergenic
1125249193 15:37679717-37679739 TTGGCCAGACAATCTGCTGGTGG - Intergenic
1128363952 15:66983556-66983578 TTGCCCTGAGAATATGATGCAGG + Intergenic
1132198764 15:99933288-99933310 TGGCCTTGGCAATTTGGTGCAGG - Intergenic
1202973096 15_KI270727v1_random:260054-260076 TTTGCAAGACCATTTGGTGCAGG + Intergenic
1202973144 15_KI270727v1_random:260577-260599 TTTTCAAGACCATTTGGTGCAGG - Intergenic
1132727235 16:1344216-1344238 TTGCCCAGACACCTGGGTGGGGG - Exonic
1140566490 16:76048993-76049015 TTGCCCATACAAATTGGGGGAGG + Intergenic
1148637381 17:49159081-49159103 TGTCCCAGACAGTGTGGTGCAGG + Exonic
1149581220 17:57751745-57751767 TTGCCCAGAAAATGTGCTGCAGG - Intergenic
1150325603 17:64254355-64254377 TTGCCCAGATTAGTTTGTGCTGG + Intronic
1150525071 17:65914524-65914546 TGGACCAGCCAATTTGGTGATGG - Intronic
1150930692 17:69581533-69581555 TTGCCCAGGCATTTTGATTCTGG + Intergenic
1152985363 18:315983-316005 TTACCCAGAGCACTTGGTGCAGG + Intergenic
1153094227 18:1382897-1382919 GAGCCCAGAGAGTTTGGTGCAGG + Intergenic
1154242830 18:12668116-12668138 TTAGCCAGACATGTTGGTGCAGG + Intronic
1154444630 18:14425043-14425065 TTGCCCATTCAATATGGTGTTGG + Intergenic
1158521579 18:58175631-58175653 TTGCACAAGCTATTTGGTGCAGG - Intronic
1164845640 19:31430343-31430365 ATGCCCAGACAAGTTGCTGCTGG - Intergenic
1167077348 19:47257556-47257578 TTGCACAGAAAATCTGGGGCGGG + Intronic
1167398540 19:49248464-49248486 TTGCCCAGAAAATTCTTTGCTGG - Intergenic
926314018 2:11696550-11696572 TTGGCCAGAGAATTGGGTCCCGG + Intronic
930812299 2:55555323-55555345 GTGCCAAGACAATTTGATGGGGG - Intronic
930934483 2:56931043-56931065 GAGCTCAGGCAATTTGGTGCTGG + Intergenic
933117860 2:78497534-78497556 GGGCCCAGACAGTTTAGTGCAGG + Intergenic
936081935 2:109438232-109438254 TTGCCCACCCAAGTGGGTGCAGG + Intronic
940154847 2:150644899-150644921 TTCCCGAAATAATTTGGTGCTGG + Intergenic
943519780 2:188934169-188934191 TTGCACAGAAAATATGGTGCTGG + Intergenic
947251316 2:228107821-228107843 TTGTCCAGAAAATTAGTTGCTGG - Intronic
947651780 2:231792526-231792548 TTGCTCAGACATTTGGATGCTGG + Intronic
1170946061 20:20891850-20891872 TTGCCCAGAGATGTTGCTGCAGG - Intergenic
1171278905 20:23880331-23880353 TTGCCCAGACTGCTTGGTGCAGG - Intergenic
1171320948 20:24243740-24243762 ATGCCCAGAGAATGTGGGGCTGG + Intergenic
1177022641 21:15882493-15882515 TTGCCCATTCAATGTGATGCTGG + Intergenic
1177122168 21:17151303-17151325 TTGCCCAGTCAGTATGGTGCTGG + Intergenic
1177442779 21:21149091-21149113 ATATCCAGACAATTTAGTGCTGG - Intronic
1179380369 21:40893415-40893437 CAGTCCAGACAATTTGGTTCTGG - Intergenic
1181835081 22:25598928-25598950 ATGCCAAGACAATTTAGTGGGGG + Intronic
1184572453 22:45334692-45334714 GTGCCCAGACATTTTGAAGCTGG + Intronic
950849017 3:16044182-16044204 GAGCCCAGAGAATTTGGTGTGGG - Intergenic
952516068 3:34105768-34105790 TTACCCAGAAAAATTGGAGCTGG + Intergenic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
958605737 3:96356094-96356116 GAGCCCAGAGAATTTGGTGTGGG + Intergenic
961417444 3:126770435-126770457 TTGCCCATACAATATGATACTGG + Intronic
962860126 3:139391755-139391777 TTACCCATAGAATTTGGTGTTGG + Intergenic
963352601 3:144170308-144170330 CTGCACAGAAAACTTGGTGCTGG - Intergenic
964458227 3:156892365-156892387 TTGCCCCGAGAATTTCGTCCAGG - Intronic
965664539 3:171078889-171078911 TTGCACAGCCAATATGATGCTGG - Intronic
966626577 3:182023362-182023384 TTGCTCAGACCATTTGTTGCAGG - Intergenic
968617965 4:1589450-1589472 TTGCCCATAAAATGAGGTGCAGG + Intergenic
969836995 4:9850323-9850345 TTGCCCAGAGGGTTTGGTGTGGG + Intronic
973708643 4:53604001-53604023 TTGCCTAGAATATTTGGTGATGG + Intronic
978596114 4:110379253-110379275 GAGCCCAGAGGATTTGGTGCGGG + Intronic
979143210 4:117204837-117204859 TTGCCCATTCAATTTGATGTTGG - Intergenic
979621116 4:122800221-122800243 TTGCCTAAATAATTTGGTCCTGG + Intergenic
979854487 4:125614259-125614281 TTTCCAAGACAATTTAGTGAAGG - Intergenic
982429455 4:155305836-155305858 TTGCCCAGAATATGTGGGGCAGG + Intergenic
983939269 4:173523912-173523934 GTGCCCAGGCAATTGGGAGCGGG + Intergenic
988091082 5:26542201-26542223 ATGCCCAGGCAGTTTGCTGCAGG - Intergenic
988870497 5:35384634-35384656 GAGCCCAGAGCATTTGGTGCGGG + Intergenic
993855020 5:93063667-93063689 TTCCCCAGAGAAACTGGTGCTGG - Intergenic
998810566 5:145962234-145962256 TTGCTCAGGCCATGTGGTGCAGG - Intronic
1000915359 5:167074890-167074912 TTGCACAGCCAATTTGAAGCTGG - Intergenic
1003803679 6:9701227-9701249 TAGCTCAGTAAATTTGGTGCAGG + Intronic
1003900616 6:10651857-10651879 TTTCCATGACAATTTGATGCAGG - Intergenic
1004979204 6:21003741-21003763 TGGACAAGACAATTTTGTGCTGG - Intronic
1006277011 6:33012742-33012764 TTGACCAAATAATTTGGTGAAGG - Intergenic
1008205233 6:48647855-48647877 TTGCCCATTCAATATGATGCTGG - Intergenic
1008736536 6:54551216-54551238 TTGCCCATTCAATTTGATGTTGG - Intergenic
1013280718 6:108634415-108634437 TTTCCCAGTGAATTTGGAGCAGG - Intronic
1013998565 6:116338884-116338906 TTGCCCAGACATTTTTGCCCAGG + Intronic
1014509778 6:122306990-122307012 TTGTACAGAAAATATGGTGCTGG - Intergenic
1015358554 6:132308905-132308927 TTGCCCATTCAATATGGTACTGG - Intronic
1016175657 6:141075170-141075192 CTGTGCAGACAACTTGGTGCAGG - Intergenic
1017773491 6:157661637-157661659 TGGCCCTGACACTTTGGGGCTGG + Intronic
1017882333 6:158570673-158570695 TTGCCCAGAGGAGTTGGTGTAGG - Intronic
1017882493 6:158571725-158571747 TTGCCCAGAGGAGTTGGTGTAGG + Intronic
1018364515 6:163104495-163104517 TTGCACAGACCATTTGATGAGGG + Intronic
1022153676 7:27637283-27637305 GAGCCCAGACAGTTTGGTTCCGG + Intronic
1022553945 7:31272633-31272655 TTGGCCAGAGGATTTGGTTCAGG - Intergenic
1022902008 7:34820391-34820413 GTGCCCAGAAAACTTGGTACAGG - Intronic
1023582750 7:41699976-41699998 TTGCCGAGTCAGGTTGGTGCTGG - Exonic
1027627564 7:80564329-80564351 GTGCCCAGAGGGTTTGGTGCAGG - Intronic
1028398601 7:90400188-90400210 TTGCCCAGACAATGTCCTGGAGG - Intronic
1029401263 7:100348155-100348177 TTCCCCAGACCATTTGCTGCTGG - Intronic
1031684374 7:124714990-124715012 TTGCCCATTCAATATGATGCTGG - Intergenic
1032988725 7:137366881-137366903 TTTCCCAGCCTATTTGGTGTCGG + Intergenic
1035238991 7:157517775-157517797 TTGCCCAGAAGCTTTGGGGCAGG + Intergenic
1036968913 8:13332288-13332310 TAGCTCAGATAATTTGGAGCTGG - Intronic
1042937913 8:74079085-74079107 ATGCCCAGCCACTTTGGTGAGGG - Intergenic
1043929115 8:86069869-86069891 AAGCCCAGACAATTAGGCGCAGG - Intronic
1045545417 8:103123952-103123974 TTGCCCCCACAATTTATTGCTGG + Intergenic
1045736197 8:105298376-105298398 TTTCCCAGTCAATTTAATGCTGG + Intronic
1050148909 9:2599577-2599599 TTTCCCATACAATTTGCTTCTGG + Intergenic
1057476094 9:95403800-95403822 TTGCCCAAACAGTATGGTACTGG + Intergenic
1060435730 9:123591254-123591276 CTGCCCACACAGATTGGTGCGGG + Intronic
1186815010 X:13227683-13227705 TTGACCAGCAAATTTGGGGCTGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1193779240 X:85682905-85682927 TTGTGCAGAGATTTTGGTGCAGG - Intergenic
1193985548 X:88237097-88237119 GAGCCCAGAGGATTTGGTGCAGG - Intergenic
1194923534 X:99796231-99796253 CTGCCCAGCCATTTGGGTGCAGG - Intergenic
1195093367 X:101484991-101485013 TTCCACAGCCCATTTGGTGCAGG + Intronic
1195541565 X:106068464-106068486 GAGCCCAGATAGTTTGGTGCAGG - Intergenic
1198885216 X:141327721-141327743 TTGCCCATTCAATATGATGCTGG - Intergenic