ID: 1100993152

View in Genome Browser
Species Human (GRCh38)
Location 12:100272053-100272075
Sequence TTCTATTGAAAGCCAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100993149_1100993152 22 Left 1100993149 12:100272008-100272030 CCAGGTGCACGTAAAATCTAGTA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1100993152 12:100272053-100272075 TTCTATTGAAAGCCAGGTGATGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100993152 Original CRISPR TTCTATTGAAAGCCAGGTGA TGG Intronic
900512029 1:3065311-3065333 CTCTATTGAATTCCAGGTCAAGG - Intergenic
900901105 1:5516654-5516676 TTCTAATGGGAGCCAGGTGGAGG - Intergenic
901078904 1:6572627-6572649 TGCAAGTGAAAGCCAGGTGGGGG - Intronic
902524816 1:17049596-17049618 TTCTGTTTAAAGCCCGGTTAGGG - Intronic
902882813 1:19384010-19384032 TTCCATTTAAAGCCAGGAAAGGG + Intronic
904142291 1:28363165-28363187 TTATCTTGAAAACTAGGTGATGG + Intergenic
913227477 1:116712880-116712902 CTGTAGGGAAAGCCAGGTGATGG + Intergenic
916033166 1:160896261-160896283 TTTTTTTGAAAGTCAGCTGAAGG + Intergenic
916274015 1:162974302-162974324 AGCTATTGACAGCCAGGTGCTGG - Intergenic
917108777 1:171523200-171523222 CTCTAATGAAAGGCAGGTCATGG - Exonic
922524710 1:226291695-226291717 TGTTAGGGAAAGCCAGGTGAAGG - Intronic
923995708 1:239491866-239491888 TTGTTTTGAAAGCCACGTGCAGG + Intronic
1067900969 10:50241180-50241202 TTCTATGGCAATCAAGGTGATGG - Intronic
1073313294 10:102559694-102559716 TTCTAATGAAACCCAGAGGATGG - Intronic
1073422770 10:103437858-103437880 TTCTGTTGAAAACCTGCTGAGGG - Intronic
1074954606 10:118376267-118376289 TTCTACTTAAAGGTAGGTGAGGG - Intergenic
1075290776 10:121228717-121228739 ATCTCTTGAAATCTAGGTGAAGG + Intergenic
1076692325 10:132230210-132230232 TTATTTTGAAAGCCAGTTGAGGG + Intronic
1077727331 11:4687854-4687876 TTCTATTCTAAGTCAGGAGAAGG + Intronic
1078350081 11:10585934-10585956 TTCTATTGAAAGAAAGGTGGGGG - Intronic
1078350089 11:10585969-10585991 TTCTATTGAAAGAAAGGTGGGGG - Intronic
1078489010 11:11752039-11752061 ATCTATTGAAAGCCACATTAAGG - Intergenic
1079535695 11:21512540-21512562 TACTACTGAGAGCCAGGAGAGGG + Intronic
1079736593 11:24004782-24004804 TTTTATTCAAGGCCAGGTGTTGG - Intergenic
1084960414 11:72713353-72713375 TTTTTTTGAAAGCCAGGGGGAGG - Intronic
1085498354 11:76993695-76993717 TTCCATGGACAGCCAGGGGATGG + Intronic
1088927420 11:114316365-114316387 TACTTTTGACAGCCAGATGATGG - Intergenic
1092517915 12:9235149-9235171 TCCCTGTGAAAGCCAGGTGAGGG + Intergenic
1097142715 12:56916070-56916092 TTCTCTTGAGAGACAGGTGATGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098272692 12:68784248-68784270 TTCTGTTGCAATCCAGATGATGG - Intronic
1098716611 12:73834617-73834639 TTGCATTGAAAGACAGGTGGTGG + Intergenic
1099939539 12:89169282-89169304 TTCAATTGCAATCCTGGTGATGG + Intergenic
1100010555 12:89947764-89947786 TTTTATTGAAATTCAGTTGAGGG + Intergenic
1100993152 12:100272053-100272075 TTCTATTGAAAGCCAGGTGATGG + Intronic
1101994185 12:109512868-109512890 TTCTATTGGAAGCAAGGTCAGGG - Intronic
1103438762 12:120947502-120947524 TACTATTTAAATCCAGGAGAGGG + Intergenic
1105068248 12:133218078-133218100 TCCTAATAATAGCCAGGTGAAGG + Intergenic
1107117259 13:36760625-36760647 TTTTATTCAAAGGCATGTGAGGG + Intergenic
1107917867 13:45170850-45170872 TTGTAATGAAAGCCCAGTGAAGG + Intronic
1108131317 13:47303764-47303786 TTCTTGTGCAAGCCATGTGATGG + Intergenic
1108163554 13:47668051-47668073 TTCTATTGGAAGCCACCTGTGGG - Intergenic
1108570501 13:51744867-51744889 TTCAGTTAAAAGCTAGGTGAGGG - Intronic
1109321792 13:60818942-60818964 GTCTCTTTATAGCCAGGTGAGGG + Intergenic
1112664339 13:101552538-101552560 TTCTCTTGAAAGCCAATAGAAGG - Intronic
1114987679 14:28250956-28250978 ATCTTCTGAAATCCAGGTGAAGG + Intergenic
1116934013 14:50718863-50718885 TTATATTGAATGCTAGGTTAAGG + Intergenic
1117523560 14:56575118-56575140 TTCTGTTGAAACCAAGGAGATGG - Intronic
1121530464 14:94649208-94649230 GTCTAGTGAGAGCCAGGTGCAGG - Intergenic
1122154044 14:99739623-99739645 ATCTATAGAATGCCACGTGACGG + Intronic
1124798145 15:32802983-32803005 TGCTGGTGAAAGCAAGGTGAAGG - Intronic
1126410925 15:48372212-48372234 TTCTATTCAGAGCCAGGGAATGG + Intergenic
1126806640 15:52356686-52356708 TACTGTTGAAGGCAAGGTGATGG - Intronic
1127380710 15:58428480-58428502 TTCTAGTGATGGCAAGGTGAGGG + Intronic
1132077349 15:98833114-98833136 TTCTATTGAAGTTCAGGAGAGGG - Intronic
1132535180 16:475518-475540 GTCTCTGGAAAGGCAGGTGATGG + Intronic
1133519719 16:6545292-6545314 TTTTATTGAAGGCCAGGAGGGGG - Intronic
1135869993 16:26140836-26140858 TTCTCTTGAAATGAAGGTGAGGG + Intergenic
1137686621 16:50391114-50391136 CTCTAATGAAAGCCAGATAAAGG + Intergenic
1139442539 16:66975765-66975787 ATGTATTGAAATCCAGGTGTTGG - Intergenic
1141408730 16:83817282-83817304 TTGAATTGAATGCCAGGTAACGG - Exonic
1141880356 16:86854441-86854463 CTCTGTTGAAAGCCAGGCCAGGG - Intergenic
1148346960 17:46909803-46909825 TTCTGTTGAAAGGAAGGTGCTGG - Intergenic
1158432728 18:57404342-57404364 TGCCATGGAAAGCCAGGTAAAGG + Intergenic
1159695268 18:71549207-71549229 TTCTACTGAAAGCCAGCAGATGG - Intergenic
1160311957 18:77801469-77801491 TTCTAATCAAAGCCACTTGAGGG - Intergenic
1163766969 19:19169061-19169083 TTTTTTTTAAAGCCAGGTGCAGG + Intronic
1164709134 19:30342994-30343016 TTCCACTAAAGGCCAGGTGATGG + Intronic
1164801724 19:31082308-31082330 TTCTCTTGAAAGGCAGTTGGAGG - Intergenic
1164818050 19:31221810-31221832 TATTATTGAAAGTAAGGTGAAGG - Intergenic
1166303079 19:41922968-41922990 TCCCACTGACAGCCAGGTGAAGG + Intronic
1166822601 19:45589725-45589747 TTCTATGTAAAGCCAGTTGAGGG - Intronic
925326881 2:3029468-3029490 TTCCATTGACACCAAGGTGAGGG - Intergenic
927040891 2:19229141-19229163 TTCTCTGCAAAGCCAGGTGACGG - Intergenic
927432877 2:23041776-23041798 GTCTTTGGAATGCCAGGTGAAGG - Intergenic
928308572 2:30191480-30191502 TTCTATTGAGTGCCAGGTGTAGG + Intergenic
929804763 2:45135332-45135354 TTCTTTTGAGAGTAAGGTGAGGG - Intergenic
930494157 2:52117503-52117525 TTCTTTTGAAAGCCTGTTGCAGG + Intergenic
931445189 2:62321269-62321291 TTCTGTTGAAGGGAAGGTGATGG - Intergenic
932317679 2:70796671-70796693 TTCTGTGGAAAGCAAGGAGATGG - Intergenic
935165184 2:100563494-100563516 CTCCACTGAGAGCCAGGTGAGGG + Intronic
936433758 2:112485496-112485518 TGGTATGGAAAGCCAGGTTACGG + Intronic
936901024 2:117481998-117482020 ATACATTGAAAGCCAGATGATGG - Intergenic
942227481 2:173830042-173830064 TGGTCTTGAAAGGCAGGTGAGGG - Intergenic
942865313 2:180666490-180666512 CTCAATTAAAAGGCAGGTGAAGG + Intergenic
943656658 2:190516315-190516337 TTATATTGTATGCCAGTTGATGG - Exonic
943828885 2:192432380-192432402 ATCTATTGAAAGTGAGATGAAGG + Intergenic
944038403 2:195325850-195325872 CTCTTTTGGAAGCCAGGAGAGGG - Intergenic
944243517 2:197508572-197508594 TTACATTGAAAGCAATGTGATGG - Intronic
944399625 2:199310419-199310441 CTCAATTGAAAGGCAGGTCATGG + Intronic
945582077 2:211608183-211608205 TACTGTTCAAAGCCAGTTGATGG - Intronic
946017123 2:216612924-216612946 TTCCATGGAAAGACAGTTGAAGG + Intergenic
946216679 2:218189200-218189222 TTCTGTTGAAAATCAAGTGATGG - Intergenic
1168808127 20:684838-684860 TTCTAGAGAAAGCCAGGAGGTGG + Intergenic
1170662070 20:18351793-18351815 TGCCATTGAATGCCAGCTGATGG + Intergenic
1171954086 20:31446388-31446410 TTCATTTCAAAGCCAGGTGCTGG - Intronic
1172958392 20:38778735-38778757 TTCTATTGATAACCAGGGCACGG - Intergenic
1174233651 20:49069217-49069239 TTTTATTGGAAGCCATATGAGGG + Intronic
1175449874 20:59054778-59054800 TGCTCTGGAAGGCCAGGTGAGGG + Intergenic
1176134078 20:63512301-63512323 TTGTATTGATAGACGGGTGAGGG - Intergenic
1176134090 20:63512375-63512397 TGATATTGATAGACAGGTGAGGG - Intergenic
1176134095 20:63512412-63512434 TGATATTGATAGACAGGTGAGGG - Intergenic
1176134100 20:63512449-63512471 TGATATTGATAGACAGGTGAGGG - Intergenic
1176134105 20:63512486-63512508 TGATATTGATAGACAGGTGAGGG - Intergenic
1176134111 20:63512523-63512545 TTATATTGATTGACAGGTGAGGG - Intergenic
1184542036 22:45132520-45132542 TTGTATTCAAAGCCAGGTTCAGG - Intergenic
1185233723 22:49699225-49699247 TTATTTTAAAAGCCAGGTAACGG + Intergenic
950593354 3:13955475-13955497 TTCTCTCTCAAGCCAGGTGAGGG + Intronic
950712605 3:14823440-14823462 TTCTCTCTCAAGCCAGGTGAGGG + Intronic
953254072 3:41272405-41272427 CTTTATTGAAAGCGGGGTGAGGG - Intronic
960372870 3:116862578-116862600 TTCCATTGGCAGCCAGGGGAAGG - Intronic
961498410 3:127311868-127311890 TTTAAGTGAAAGGCAGGTGATGG - Intergenic
962986822 3:140543863-140543885 GCTTATTGAATGCCAGGTGATGG + Intronic
963546263 3:146662308-146662330 TTCTAAAAAAATCCAGGTGAAGG + Intergenic
965863235 3:173172194-173172216 TGCTATTGAATGCCACTTGAAGG + Intergenic
966368967 3:179225879-179225901 TTCATTTGAAAACCATGTGATGG + Intronic
967074318 3:185988601-185988623 TCCTTCTGAAAGCCAGGTGGGGG + Intergenic
969076836 4:4586166-4586188 TTCTGTTGAAAGCAAGGCAATGG - Intergenic
974817199 4:67020695-67020717 TTCTGGTGAAAGACAGATGAGGG - Intergenic
976188220 4:82464242-82464264 TGCTATTAAAAGCCATGGGATGG + Intergenic
976792135 4:88890198-88890220 ATCTATTGTATGCCAGGTGCTGG - Intronic
977689330 4:99887783-99887805 TTACATTGGAAGCCATGTGAAGG - Intronic
979657260 4:123209739-123209761 TCCTGTTGATAGCCAGGTGCAGG - Intronic
980176542 4:129352795-129352817 TTCTTTAGAAAGCCTGGTCAGGG + Intergenic
980641819 4:135589889-135589911 AGCTGTTGAAAACCAGGTGAAGG - Intergenic
981988807 4:150890837-150890859 TTCTATTGAAAGTCTGGGCAAGG - Intronic
982099477 4:151953961-151953983 TCCTATGGAAGGCCAGGGGAGGG + Intergenic
983015777 4:162609792-162609814 TTCTATTAATAGCAAGGAGAAGG + Intergenic
983301500 4:165931987-165932009 TTTGCTGGAAAGCCAGGTGATGG + Intronic
983493527 4:168417070-168417092 TGTTGTAGAAAGCCAGGTGATGG - Intronic
983942658 4:173552153-173552175 TTCTCTTGAATGTCAGGTTAAGG + Intergenic
984154903 4:176184271-176184293 TTCTATTGAAAACAAGTTGTGGG - Intergenic
984291301 4:177798149-177798171 TTCCCTTGAATGCTAGGTGAGGG - Intronic
987379761 5:17274692-17274714 TTCTAATCATAGCCAGTTGAGGG - Intronic
989601885 5:43207996-43208018 TTTTTTTGAAAGTCAGCTGAAGG + Intronic
990412110 5:55551692-55551714 TTCTTTTGAAAGGCAGAGGAGGG + Intergenic
990722590 5:58713713-58713735 TTATGTTTAAAGTCAGGTGAGGG - Intronic
992364701 5:76079950-76079972 TTTTTTTGAAAGCCAGCTGAAGG + Intergenic
993644026 5:90440793-90440815 TTCCATTTAAAGTCAGTTGAAGG + Intergenic
993959552 5:94280165-94280187 TTCTACTGAATTCCAGGTGAGGG + Intronic
995160579 5:108975902-108975924 TGCTATAGGAAGCCAGGTTAAGG + Intronic
997228425 5:132226865-132226887 TTGTAGTGGAAGCAAGGTGATGG - Exonic
999874450 5:155787032-155787054 TGCTATTAAAAGCCCGGTAATGG + Intergenic
1000549496 5:162642562-162642584 TTATCTTGAAAGCCACATGAAGG - Intergenic
1003349895 6:5306364-5306386 TTCTTTTAACAGCCATGTGATGG + Intronic
1003766177 6:9239564-9239586 TTCTATTGACAGACAGGTCTGGG - Intergenic
1009969129 6:70608028-70608050 TTTTTTTGAAAGTCAGATGAAGG - Intergenic
1010406559 6:75512585-75512607 TTCTATTTAGTGCCAGGTAATGG + Intergenic
1010432284 6:75791998-75792020 TTCAGTTGACAGCCAGTTGATGG + Intronic
1011864448 6:91806023-91806045 TTGTACTCAAAGCCAGATGATGG + Intergenic
1016822864 6:148362558-148362580 TTTTTTTGAAAGTGAGGTGAGGG + Intronic
1017032701 6:150238206-150238228 TTGTCTTGAAAGCTAGGTCAAGG + Intronic
1018127228 6:160693159-160693181 TTCTGTTGGAAGCCAGTTGCAGG + Intergenic
1021025204 7:15658270-15658292 TTCTCATTAAAGCCTGGTGAGGG + Intronic
1022489636 7:30806736-30806758 TTTTATTGAAGGCTAGGGGAAGG + Intronic
1022954751 7:35370833-35370855 TCCTAATGACAGCCAGCTGAGGG + Intergenic
1023194632 7:37621669-37621691 GTGTCCTGAAAGCCAGGTGAAGG - Intergenic
1023253361 7:38289242-38289264 TGCTATTGAAAGCCCAATGAGGG - Intergenic
1027003445 7:74671418-74671440 TTTTTTAAAAAGCCAGGTGAAGG - Intronic
1027611199 7:80363113-80363135 CTCTATTGAAAGTGAGGTGGTGG - Intergenic
1028109744 7:86925605-86925627 TTATATTCAAAGCCAAGTGCAGG + Exonic
1028574151 7:92327771-92327793 TTCTTTTCAAAGCCATATGAAGG + Exonic
1028776801 7:94686559-94686581 TTCTATTGGTAGCCAAGTCAGGG - Intergenic
1033609483 7:142952371-142952393 TTCTATGGAAAGCCAAGACATGG + Intronic
1035171077 7:157017845-157017867 TTCCATTGAAAGGCTGGAGAAGG + Intergenic
1035295225 7:157863519-157863541 TTCTTTTGAAAACCAGTTGGTGG - Intronic
1037171967 8:15903941-15903963 TTCTATTGAGAGGAAGGTGAAGG + Intergenic
1041708717 8:60873941-60873963 TTCTTTTGAAAGCCATGCCAGGG + Intergenic
1042206344 8:66333474-66333496 TTCTATGGAAATGCAGGGGAGGG + Intergenic
1043286507 8:78538374-78538396 TTTTCTTGAAAGTCAGGTGCAGG + Intronic
1044938439 8:97315716-97315738 TTGTATTGAAAGCCAGCCGCAGG - Intergenic
1046846293 8:118920406-118920428 TTTTAGAGGAAGCCAGGTGAAGG + Intergenic
1047378216 8:124325601-124325623 TTCTATTGAAATCCAGTTTCAGG - Intronic
1047614209 8:126549790-126549812 TTATATTGCCAGCCAGGTTATGG - Intergenic
1050586112 9:7113222-7113244 TTCTATTGATAGAAAGGTGAGGG - Intergenic
1053882655 9:42611494-42611516 ATCTTCTGAAATCCAGGTGAAGG + Intergenic
1053890014 9:42682808-42682830 ATCTTCTGAAATCCAGGTGAAGG - Intergenic
1054221682 9:62418962-62418984 ATCTTCTGAAATCCAGGTGAAGG + Intergenic
1054229032 9:62490211-62490233 ATCTTCTGAAATCCAGGTGAAGG - Intergenic
1187704360 X:21994535-21994557 TTTTTTTGAAAGTCAGCTGAAGG + Exonic
1190127283 X:47717798-47717820 TTTTTTTGAAAGTCAGTTGAAGG - Intergenic
1193747829 X:85303962-85303984 ACCTATTGAATGCCAGGTCATGG + Intronic
1194172836 X:90609213-90609235 TTCTAGTACAAGCCAGGGGAAGG + Intergenic
1196026966 X:111051374-111051396 TTCCAGTGAAAGCCAGGGAAAGG - Intronic
1197180342 X:123528895-123528917 TATTATTGAAAGCCATATGAAGG - Intergenic
1197342384 X:125288806-125288828 ATCTTTTGAAATCTAGGTGAAGG - Intergenic
1199225882 X:145372888-145372910 TTTTATTTGAAGCCAGCTGAAGG - Intergenic
1199509223 X:148601562-148601584 TTATACTGAATGCCAAGTGAGGG - Intronic
1200218091 X:154377533-154377555 TTCTAAACAAAGCCAGCTGAGGG - Intergenic
1201366219 Y:13209230-13209252 TTCCAATGAAGCCCAGGTGATGG + Intergenic