ID: 1100994221

View in Genome Browser
Species Human (GRCh38)
Location 12:100284926-100284948
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100994215_1100994221 7 Left 1100994215 12:100284896-100284918 CCATGGTGGCTCACGCCTGTAGT 0: 12
1: 397
2: 1724
3: 3228
4: 3892
Right 1100994221 12:100284926-100284948 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1100994217_1100994221 -8 Left 1100994217 12:100284911-100284933 CCTGTAGTCTCAGCACTTTGGAA 0: 15
1: 1170
2: 31954
3: 326753
4: 263595
Right 1100994221 12:100284926-100284948 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1100994214_1100994221 11 Left 1100994214 12:100284892-100284914 CCAGCCATGGTGGCTCACGCCTG 0: 109
1: 8358
2: 46631
3: 122773
4: 182014
Right 1100994221 12:100284926-100284948 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100994221 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr