ID: 1100994524

View in Genome Browser
Species Human (GRCh38)
Location 12:100289153-100289175
Sequence CGAGGCACAGGACAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100994524_1100994529 1 Left 1100994524 12:100289153-100289175 CCTCCTGGCTGTCCTGTGCCTCG 0: 1
1: 0
2: 0
3: 46
4: 304
Right 1100994529 12:100289177-100289199 AATGATCAGGAGTTAAGATTAGG 0: 1
1: 0
2: 1
3: 18
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100994524 Original CRISPR CGAGGCACAGGACAGCCAGG AGG (reversed) Intronic
900409234 1:2505313-2505335 GGGGACACAGGGCAGCCAGGGGG - Exonic
900740632 1:4328790-4328812 CTAGGCACAGGTGAGGCAGGCGG - Intergenic
900966601 1:5962960-5962982 CGAGGCACAGGGCATGCACGTGG + Intronic
901057429 1:6455165-6455187 CGAGGTACAGGATCGCCAGGCGG + Intronic
901988704 1:13095213-13095235 TGAGCCACAGGACGGGCAGGGGG + Intergenic
901993109 1:13131554-13131576 TGAGCCACAGGACGGGCAGGGGG - Intergenic
902471066 1:16647788-16647810 CGAGGCACAGCCCCGCCAAGAGG + Intergenic
902476931 1:16693314-16693336 TGAGGCACAGGATTGCCAGGCGG - Intergenic
902487738 1:16759660-16759682 CGAGGCACAGCCCCGCCAAGAGG - Intronic
902656726 1:17874194-17874216 GGAGGCCCAGGAAAGCCCGGTGG - Intergenic
902835788 1:19045976-19045998 CGAGGGCCAGGGCAGCCTGGTGG + Intergenic
903478456 1:23636330-23636352 CGGGGCAGGGGACAGCCAAGGGG + Intronic
904701649 1:32361758-32361780 CGAGTCCCAGGACAGCCCGGAGG - Exonic
915216494 1:154343991-154344013 CCTGGCCCAGGACAGCCGGGAGG + Exonic
915903589 1:159862812-159862834 AGTGGCACAGGACAGCCAGCGGG + Intronic
917737309 1:177932761-177932783 AGAGGCCCAGGCCAGCCTGGTGG + Exonic
917972885 1:180219907-180219929 AGAGGCACTGGTGAGCCAGGAGG - Intergenic
919513161 1:198491325-198491347 CTAGGCCCAGGACAGACAGAGGG + Intergenic
919779534 1:201213183-201213205 CGAGGCAAGGGACAGAGAGGAGG + Exonic
920030694 1:203035758-203035780 GGAGCCCCAGGACAGCCACGTGG - Intronic
920218226 1:204376893-204376915 CGAGCCAAAAGACAGCCAGCAGG + Intronic
920689146 1:208132348-208132370 GCAGCCACAGGGCAGCCAGGGGG + Intronic
921583592 1:216923771-216923793 TGTGACACTGGACAGCCAGGTGG - Intronic
922596979 1:226821627-226821649 GGAGGGAGAGGAAAGCCAGGAGG + Intergenic
923018761 1:230146967-230146989 CGTGGCAGGGGACAGACAGGAGG + Intronic
923789777 1:237102186-237102208 TGAGGAACAGGACAGACAGGTGG + Intronic
1062987269 10:1780325-1780347 GGAGGCTCCGAACAGCCAGGTGG + Intergenic
1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG + Intergenic
1063073606 10:2691738-2691760 CCAGCCAAAGTACAGCCAGGTGG + Intergenic
1063662433 10:8043698-8043720 GGAGGCACAGGGCAGGAAGGTGG + Intergenic
1063779766 10:9308321-9308343 GAAGGCACAGAACTGCCAGGAGG + Intergenic
1067390744 10:45860892-45860914 GAAGGGACAGGAAAGCCAGGAGG - Intergenic
1067500728 10:46802957-46802979 GAAGGGACAGGAAAGCCAGGAGG + Intergenic
1067540069 10:47144648-47144670 GGAGGCAGAGAACAGTCAGGGGG + Intergenic
1067593856 10:47536943-47536965 GAAGGGACAGGAAAGCCAGGAGG - Intronic
1067640967 10:48045056-48045078 GAAGGGACAGGAAAGCCAGGAGG - Intergenic
1067688043 10:48479556-48479578 TGGGGCTCAGGACAGGCAGGGGG + Intronic
1067872535 10:49975211-49975233 GAAGGGACAGGAAAGCCAGGAGG + Intergenic
1069893167 10:71664503-71664525 GCTGGCACAGGACAGGCAGGTGG + Intronic
1070137931 10:73711110-73711132 GAAGGGACAGGAAAGCCAGGAGG - Intergenic
1070849226 10:79550087-79550109 AGGGGCACATGACAGGCAGGCGG + Intergenic
1070883951 10:79873867-79873889 CCAGGCAAAAGGCAGCCAGGAGG + Intergenic
1070924627 10:80211003-80211025 AGGGGCACATGACAGGCAGGCGG - Intergenic
1071017826 10:81019361-81019383 CAAGGCACAGGACAGCCCCTAGG + Intergenic
1071650505 10:87390167-87390189 CCAGGCAAAAGGCAGCCAGGAGG + Intergenic
1072169745 10:92848251-92848273 CCAGGCACAAGACGCCCAGGAGG + Intronic
1072268700 10:93754891-93754913 GGAGGCCCAGGGAAGCCAGGAGG - Intergenic
1072418600 10:95270310-95270332 TGTGGCACAGGACTGGCAGGTGG - Intronic
1073062487 10:100740982-100741004 AGTGGCACGGGCCAGCCAGGTGG - Intronic
1074346303 10:112689487-112689509 GGAGGTGCTGGACAGCCAGGGGG + Intronic
1075728086 10:124620831-124620853 GTGGGCACAGGACAGGCAGGCGG + Exonic
1076318786 10:129563782-129563804 CGAGGCACGGGAGAACCAGAAGG - Intronic
1077159103 11:1104576-1104598 CAAGGGACAGGCCAGCCAGGGGG - Intergenic
1077208068 11:1353540-1353562 CGACCCACAGGACAGCCTGGGGG + Intergenic
1077232438 11:1463894-1463916 TGAGGCACAGGACAGTCTGTGGG + Intergenic
1077301924 11:1851479-1851501 CCAGGAAGAGGACAGGCAGGTGG - Intergenic
1077308022 11:1876531-1876553 CTGGGCTCAGGACAGCCGGGTGG + Intronic
1077308538 11:1878448-1878470 TGAGGAGCAGGACAGGCAGGCGG + Intronic
1079077271 11:17391797-17391819 TGAGTCACAGGTCAGCCAGGTGG - Intergenic
1079659528 11:23021229-23021251 TGAGGCACAGGGAAGTCAGGTGG - Intergenic
1079967358 11:26994967-26994989 CCAGGAACAGGACAGCCGGCAGG + Exonic
1081492894 11:43581073-43581095 AGAGGGATAGGACAGGCAGGCGG + Intronic
1081524150 11:43912919-43912941 CAAGGCCCAGGAGAGCCAGTAGG - Intronic
1082995939 11:59255548-59255570 CAGGGCACAGGACAGCCAGTGGG + Intergenic
1083261591 11:61525984-61526006 GGGGGCACAGGCCAGCCTGGAGG + Intronic
1084266481 11:68007969-68007991 CAAGGCCCAGGCCAGCCAGGGGG - Intergenic
1084496830 11:69510072-69510094 CCAGGCTCTGGACACCCAGGGGG + Intergenic
1084518474 11:69648920-69648942 CTAGGCAGGGGACAGGCAGGTGG - Intronic
1084958238 11:72702858-72702880 CCAGGCACTGCACAGCCTGGTGG + Intronic
1085399702 11:76228418-76228440 CCAGGCACTGGGCAGGCAGGGGG + Intergenic
1088904463 11:114143726-114143748 CTAAGCACAGGGCACCCAGGCGG + Intronic
1090055014 11:123415485-123415507 CAATGCACAGCAGAGCCAGGGGG + Intergenic
1091240549 11:134049366-134049388 CGAGGCACACGACAGGCAGTCGG + Intergenic
1091327674 11:134703430-134703452 ACAGGCACAGGGCTGCCAGGAGG - Intergenic
1091550922 12:1534298-1534320 CAAAGGACAGGACATCCAGGTGG - Intronic
1091699362 12:2650064-2650086 CAAGGCAGGGGACAGACAGGTGG - Intronic
1091702663 12:2674260-2674282 TGTGGCTCAGGCCAGCCAGGGGG - Intronic
1091743208 12:2974621-2974643 GGAGCCACAGGACATCCTGGAGG - Intronic
1091833656 12:3568880-3568902 AGAGGAGCAGGACAGCCAGCCGG - Intronic
1091903619 12:4165095-4165117 AGACGCATTGGACAGCCAGGAGG + Intergenic
1092291106 12:7159912-7159934 TGAGGCACAGGAAGGGCAGGTGG - Intergenic
1095925686 12:47576584-47576606 GGAGGCACAGTGCTGCCAGGAGG + Intergenic
1096229954 12:49891203-49891225 CCACCCACAGGGCAGCCAGGAGG + Intronic
1097830774 12:64222260-64222282 CGAGGCCGAGGAGAGCCACGTGG - Exonic
1100994524 12:100289153-100289175 CGAGGCACAGGACAGCCAGGAGG - Intronic
1101540306 12:105659115-105659137 CCAGGCACAGGCCAGGCAGCAGG - Intergenic
1102865168 12:116368519-116368541 AGAGGCACAGCAGAGGCAGGAGG - Intergenic
1104286612 12:127430296-127430318 CTTGGCACTGGACACCCAGGAGG + Intergenic
1104916726 12:132269368-132269390 CGAGGAGCGGGACCGCCAGGCGG + Intronic
1105007991 12:132734940-132734962 CCAGGCACACGAAAGCCTGGAGG + Intronic
1110262682 13:73502970-73502992 GGAGGGACAGGAGAGGCAGGAGG + Intergenic
1110541640 13:76713024-76713046 GGAGGCCCAGGAAAGCCAGTAGG + Intergenic
1111183288 13:84696137-84696159 AAAGACACAGGACAGCCAGCTGG + Intergenic
1113651830 13:112038982-112039004 CCTGGCACAGGCCAGCCTGGAGG - Intergenic
1116950176 14:50872177-50872199 GGACGCGCAGGACTGCCAGGCGG + Exonic
1118330874 14:64815126-64815148 CCAGGTACAGAACAGCCCGGAGG + Intronic
1119942738 14:78658290-78658312 CGAGGCTCAGAACAGTCATGCGG - Intronic
1122237791 14:100342363-100342385 CCAGGCAGAGGGCAGCCAGCGGG - Intronic
1122519528 14:102333764-102333786 GGGTTCACAGGACAGCCAGGTGG - Intronic
1122651305 14:103228623-103228645 AGGGGCAAAGGACAGACAGGAGG + Intergenic
1122651862 14:103230767-103230789 TGGGGCTCAGGCCAGCCAGGTGG - Intergenic
1122860709 14:104581198-104581220 GGAGGCAGAACACAGCCAGGCGG - Intronic
1122922106 14:104884501-104884523 CGAGGCGCAGGACACGGAGGTGG + Exonic
1123223610 14:106879375-106879397 GGACGCTCAGGACAACCAGGGGG - Intergenic
1124252337 15:28115080-28115102 CGAGGCACAACACAGCCATGGGG + Intronic
1125714555 15:41811989-41812011 CGTGGCAGAGCACAGCCAGGTGG + Exonic
1129222219 15:74137551-74137573 TGAGGAACAGGAGAGACAGGGGG + Intronic
1129275464 15:74442560-74442582 GGTGCCATAGGACAGCCAGGTGG - Intergenic
1129323529 15:74787736-74787758 CCATGATCAGGACAGCCAGGGGG - Intronic
1129910032 15:79219512-79219534 GGAGGGACAGGAATGCCAGGCGG - Intergenic
1130328511 15:82901224-82901246 TGAGGACCTGGACAGCCAGGAGG + Intronic
1131147433 15:90023275-90023297 TGAGCCACTGGACAGCCTGGTGG + Intronic
1131195139 15:90349395-90349417 GGAGGTAGAGGAGAGCCAGGTGG + Intergenic
1131554895 15:93388894-93388916 CAGGGCACAGGACAGTCATGTGG - Intergenic
1132038532 15:98505724-98505746 CCCGGCCCAGGACAGCCATGCGG + Intronic
1132477650 16:149327-149349 CGAGGAACAGACCAGCAAGGAGG + Intergenic
1132533266 16:464195-464217 GGAGGAAGAGGACAGTCAGGAGG + Intronic
1132699481 16:1216222-1216244 GGAGGCAGAAGACAGGCAGGGGG - Intronic
1133233873 16:4378793-4378815 GGGGGCACACGACAGCAAGGGGG + Intronic
1135672707 16:24388862-24388884 CTAGGCCCAGGGCAGCCTGGAGG - Intergenic
1136135145 16:28251761-28251783 CAAGGCATAGGACAGCCTGGGGG + Intergenic
1136549117 16:30972918-30972940 AGAGGCACAGGGCAGCCAGCCGG + Intronic
1136573523 16:31110222-31110244 CGAGGCCCAGTACTGCCAGCTGG + Exonic
1138829659 16:60360149-60360171 AGAGGCACTGGAGAGCCTGGCGG - Intergenic
1139436621 16:66940329-66940351 AGAAGCCCAGGACACCCAGGCGG - Exonic
1142196304 16:88740796-88740818 CGTGGGCCAGGACACCCAGGTGG + Intronic
1142398697 16:89847980-89848002 CGTGGCACAGGACAGACAGAGGG - Intronic
1142483387 17:231912-231934 GGAGGCCCACGACAGGCAGGTGG + Intronic
1142659950 17:1421630-1421652 CGTGGCACAGGGAAGCCAGCTGG - Exonic
1142973839 17:3631270-3631292 AGAGGCACAGAGGAGCCAGGTGG + Intronic
1143539666 17:7561663-7561685 CGCGCCACAGGAGAGCCAGGAGG - Intergenic
1144772042 17:17765318-17765340 CGAGGTACAGTCCAGGCAGGAGG + Intronic
1145771922 17:27499398-27499420 CAAGGCACCGGACAACCAGAGGG + Intronic
1145980324 17:29007253-29007275 TGAGTCACAGGACAGCAAGGGGG + Intronic
1146902175 17:36595810-36595832 CCAGGCACAGGACTGACAAGTGG - Intronic
1146947057 17:36880672-36880694 TGAGTCACAGGACTGTCAGGGGG - Intergenic
1147995505 17:44358158-44358180 AGAGGGAAAGGACATCCAGGAGG + Intronic
1148486551 17:47994810-47994832 TGAGGCCCAGGGCAACCAGGTGG + Intergenic
1150143622 17:62750368-62750390 AGAGGGAGAGGACAGTCAGGAGG + Intronic
1150653521 17:67024909-67024931 CGATGCACAGGCCACCCAGCAGG - Exonic
1150819838 17:68426296-68426318 CTAGGCACAGTACCTCCAGGGGG - Intronic
1151219891 17:72604601-72604623 CCAGGGACATGTCAGCCAGGTGG - Intergenic
1151345590 17:73499431-73499453 GGAGGCCCAGGAGAGCCAGGTGG - Intronic
1151562510 17:74878198-74878220 GGAGGCACCGGCCAGGCAGGGGG - Exonic
1151757302 17:76082152-76082174 CCAGGGACAGGAGAGCCAGCAGG - Intronic
1151946376 17:77322065-77322087 CGAGGCCCCTGCCAGCCAGGCGG - Intronic
1152736496 17:81999912-81999934 ACAGTCCCAGGACAGCCAGGGGG - Intronic
1154502565 18:15003997-15004019 CGGCGCAGAGGTCAGCCAGGAGG - Intergenic
1157216160 18:45785452-45785474 CGAGTCTCAGCACAGTCAGGAGG + Intergenic
1159019099 18:63128268-63128290 ACAGGCACAGAACATCCAGGTGG + Exonic
1159801451 18:72905602-72905624 CCAGCCAGAGAACAGCCAGGAGG - Intergenic
1160225696 18:77009208-77009230 CAAAGAAGAGGACAGCCAGGAGG - Intronic
1160559820 18:79749279-79749301 CGGGGCAGACGAGAGCCAGGCGG - Intronic
1160707535 19:536472-536494 CGAGGCCCAGGACCGCCAGCTGG - Intronic
1161104863 19:2438292-2438314 GGAGACACAGGACAGCGAGCTGG + Intronic
1161303876 19:3556572-3556594 GGAGGCACAGCACAGTCAGACGG + Intronic
1161519411 19:4715430-4715452 GGAGGGAGGGGACAGCCAGGTGG - Intronic
1162174914 19:8823483-8823505 TGAGGCAGAGCACAGGCAGGAGG - Intronic
1162324180 19:9989134-9989156 CGAGGTCCAGGATAGCCCGGAGG + Exonic
1163243008 19:16076009-16076031 CGAGGAACGGGTCAGCCTGGGGG - Intronic
1163598550 19:18234225-18234247 GGAAGCTCAGGACAGGCAGGAGG + Intronic
1164521630 19:28984120-28984142 CTAGGCCCAGGACTCCCAGGGGG + Intergenic
1164763819 19:30747794-30747816 CCAAGCACAGCAGAGCCAGGGGG - Intergenic
1164879101 19:31715676-31715698 GGGGACACAGGGCAGCCAGGAGG + Intergenic
1165902248 19:39174335-39174357 CGGGGCACAGGGAACCCAGGAGG - Intronic
1166693193 19:44836649-44836671 GGAAGCACTGGACAGCCAGGAGG + Intergenic
1166741758 19:45118715-45118737 TGAGGGACAGGACAGCCAGATGG - Intronic
1167268216 19:48493753-48493775 CGAGCCAGAGGACAGCGAGCTGG - Exonic
1167760293 19:51442605-51442627 CGAGGCACAGGAAGGGCAGCGGG - Intergenic
1168257642 19:55175390-55175412 TGAGGCACAGCACAACCAGAAGG + Intronic
1168707496 19:58478233-58478255 CCAGGCAGAGGGCAGCCATGGGG - Intronic
1202703461 1_KI270713v1_random:4579-4601 CGAGGCACAGCCCCGCCAAGAGG + Intergenic
1202710947 1_KI270714v1_random:19140-19162 TGAGGCACAGGATTGCCAGGCGG - Intergenic
925710908 2:6739443-6739465 CAAGGCACAGCACAGCCACATGG + Intergenic
925756766 2:7140447-7140469 GGAGGCACAAGAGAGCAAGGAGG - Intergenic
925909803 2:8566219-8566241 GGAGGGAGAGGACAGGCAGGGGG - Intergenic
927697473 2:25247839-25247861 TGGGGGGCAGGACAGCCAGGAGG + Intronic
928387453 2:30882648-30882670 AGAGTCACAGGACTGGCAGGTGG + Intergenic
928429307 2:31204732-31204754 GGATGCAGATGACAGCCAGGTGG - Intronic
930022057 2:47007597-47007619 GGAGGCACTGGCAAGCCAGGAGG - Intronic
930034159 2:47075198-47075220 CCTGGCACAGGAAAGCCAGGAGG - Exonic
930747698 2:54901787-54901809 CCAGGGATAGGACAGCCAGGTGG - Intronic
932416079 2:71574652-71574674 CCAGGCACAGGCCAGCCAGACGG - Intronic
934136215 2:88998755-88998777 CAAGGCACAGGAAAGCCATGTGG + Intergenic
934139781 2:89035298-89035320 CAAGGCACAGGAAAGCTATGTGG + Intergenic
937079191 2:119128210-119128232 CGAGGCACAGGATGGGCAGGAGG - Intergenic
944306271 2:198183491-198183513 CCAGGCACAGCACAGCCGTGTGG + Intronic
947634435 2:231672975-231672997 AGAGGCACAGGAGAAACAGGAGG + Intergenic
948179463 2:235968257-235968279 GGAGGCACAGTAGAGCAAGGGGG + Intronic
948297852 2:236876134-236876156 CGAGGAAGAGGTCAGCCATGGGG + Intergenic
948621768 2:239239824-239239846 CGCGGAACAGGGCAGCCATGTGG + Intronic
948635202 2:239330189-239330211 AGAGCCACAGGAGAGCCAGAGGG + Intronic
1169119163 20:3084917-3084939 CGCGGCCCATGACAGCCTGGCGG - Intergenic
1169462402 20:5807072-5807094 CCAGGCAAAGGCCACCCAGGAGG - Intronic
1170574578 20:17652728-17652750 CGAGGCACAAGGCAGCCAGTGGG + Intronic
1172502598 20:35437675-35437697 GGAGGCACCGGGCAGACAGGAGG - Exonic
1173861600 20:46287489-46287511 CGAGGGCGAGGGCAGCCAGGTGG + Intronic
1173867966 20:46324481-46324503 ACAGGCACAGGACAGGCAGAGGG + Intergenic
1174188408 20:48723041-48723063 CGAGGCCCAGGATAGGCAGTTGG - Intronic
1174219672 20:48943954-48943976 CAAGGCACAGGACTGCAAAGTGG + Intronic
1174273476 20:49386370-49386392 GGAGGCACAGCACAGCCTGTAGG - Intronic
1174313083 20:49674595-49674617 GGAGGCACAGGAGACCGAGGTGG + Intronic
1174336610 20:49866118-49866140 CAGGGCTCAGGACAGGCAGGTGG - Intronic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1176002044 20:62836573-62836595 CCAGGCACGGGACCCCCAGGCGG - Intronic
1176164424 20:63665259-63665281 AGAGTCACAGGGCAGCCACGTGG - Intronic
1176303912 21:5113681-5113703 CTAGGCACAGGAGAGGAAGGGGG + Intergenic
1179540867 21:42082626-42082648 CGAGGCTGAGGGCAGCCATGAGG - Intronic
1179853118 21:44148269-44148291 CTAGGCACAGGAGAGGAAGGGGG - Intergenic
1181270690 22:21657083-21657105 AGAGGAAAAGGACAGCGAGGTGG + Intronic
1181590376 22:23880991-23881013 CGAGGCAGAGGACGGCGATGAGG - Intronic
1182489757 22:30663655-30663677 CGAGGCACAGGGCAGCTGAGCGG + Exonic
1182600677 22:31461238-31461260 GGAGGCACTGTAGAGCCAGGTGG - Intronic
1183524786 22:38316861-38316883 CGAGGCCCCGGCCGGCCAGGCGG - Intronic
1183546486 22:38456778-38456800 CGAGGCACCCCAAAGCCAGGTGG + Intergenic
1183546493 22:38456823-38456845 CGAGGCTCAGGAGAGCCAGAGGG - Intergenic
1183979111 22:41529442-41529464 CGGGGCACACGGCAGCCAAGAGG + Intronic
1184148348 22:42624448-42624470 GGAGCCGCAGGCCAGCCAGGAGG - Intronic
1184396945 22:44247870-44247892 GGTGGCACAAGAAAGCCAGGTGG - Exonic
1184396948 22:44247888-44247910 GGAAGCACAAGAAAGCCAGGTGG - Exonic
1184594413 22:45505135-45505157 ACAGACACAGGACAGACAGGCGG - Intronic
1184876424 22:47278813-47278835 TGAGACTCAGGACAGCCAAGGGG - Intergenic
1184918108 22:47587111-47587133 GGAGCCCCAGGACAGCCAGCAGG - Intergenic
1185044605 22:48522801-48522823 CAAGGGACAGGCCAGCCTGGGGG - Intronic
1185254307 22:49823855-49823877 CGAGGAACTGGACAACGAGGTGG - Exonic
1185275628 22:49949215-49949237 CCAGGCCCAGGACAGCCTGCAGG - Intergenic
950421573 3:12902729-12902751 GGCGACACAGGACAGCCAGCTGG + Intronic
950494822 3:13327438-13327460 CTAGGCACAGGAGAGAAAGGAGG + Intronic
953451097 3:43007020-43007042 AGAGGCACAGCACTGCCAAGTGG + Intronic
954147017 3:48639533-48639555 CCAGGCTCAGCACAGCCAGAGGG - Intronic
954147781 3:48642752-48642774 CCAGGACCAGGACAGCCAGCGGG - Exonic
954298369 3:49686455-49686477 CGAGGCACAGCCCCGCCAAGAGG - Exonic
954708891 3:52495334-52495356 GCAGGCACAGCACAGGCAGGCGG - Exonic
959509076 3:107189405-107189427 CCAGGCAGAGAACAGCCATGGGG - Intergenic
959527175 3:107390167-107390189 GGAGCCACAGGATACCCAGGGGG - Intergenic
960031659 3:113060319-113060341 AGAGGCTCAGGACATCCAGGTGG - Intergenic
960121398 3:113951292-113951314 CGAGGCAGAGGACTGCCACAGGG - Intronic
961476695 3:127151132-127151154 GGAGGCTGGGGACAGCCAGGAGG + Intergenic
961509400 3:127391798-127391820 CGAGGCAGAGAGCAGCCTGGGGG + Intergenic
962739153 3:138349996-138350018 CGAAGCCCAGGACAGCCACGTGG - Intronic
964402745 3:156316205-156316227 CAAGGCACAGAGAAGCCAGGTGG + Intronic
966985930 3:185180417-185180439 AGAGACAGAGGACAGGCAGGAGG - Intergenic
967862710 3:194164061-194164083 CAAGGCACTAGACAGCCATGAGG - Intergenic
968074041 3:195806282-195806304 TGAGGCTGAGGACAGCCAGGTGG - Intronic
968076436 3:195818122-195818144 CGGGGCACAGGAGGGCCTGGAGG + Intergenic
968515966 4:1015776-1015798 TGAGCCCCAGGACAGCCTGGTGG + Intronic
968729929 4:2264851-2264873 CGTGGCTCAGGTCAGCCAGTTGG + Intergenic
968867392 4:3222150-3222172 CGAGACACATGAGAGGCAGGTGG - Intronic
968927172 4:3555671-3555693 CCAGGCACAGGACCTCAAGGTGG - Intergenic
969122188 4:4918857-4918879 TGAGGCACCAGGCAGCCAGGAGG + Intergenic
969636414 4:8371991-8372013 GGAGGCCAAGGTCAGCCAGGTGG - Intronic
971364966 4:25970375-25970397 CGAGGCCCAGGGCTGCCAAGTGG + Intergenic
972690250 4:41390144-41390166 AGAGGCACAGGACAGCAAGATGG - Intronic
977805626 4:101293931-101293953 CCTGGCAGAAGACAGCCAGGAGG + Intronic
978410009 4:108416133-108416155 CCAGGGACAGGAGAGCCAGCAGG - Intergenic
983512920 4:168628412-168628434 AGAGAGACAGGACAGCCAGATGG - Intronic
985034152 4:185821224-185821246 CCAGGGACAGGACTTCCAGGTGG + Intronic
985885536 5:2674899-2674921 CCAGGCACAGGACACTCAGGTGG - Intergenic
987228566 5:15868996-15869018 CCAGGCACAGGTTAGCTAGGGGG + Intronic
988682021 5:33492929-33492951 AGAGTCACAGGACAGAGAGGTGG - Intergenic
991565259 5:67998212-67998234 CTAGACACAAGACACCCAGGAGG - Intergenic
992796057 5:80255975-80255997 CGAGGCGCGAGGCAGCCAGGAGG - Exonic
994094115 5:95833257-95833279 TTAGGCAGAGGACAGGCAGGTGG - Intergenic
995528163 5:113067234-113067256 ACAGGCACAGGAAAGCGAGGTGG + Intronic
995862925 5:116660968-116660990 CCAGGGACAGGACAGGCAGCGGG - Intergenic
996029396 5:118687947-118687969 CATGGAACAGGAAAGCCAGGTGG - Intergenic
997302188 5:132814038-132814060 AGAGCCACAGGACACCCCGGGGG + Exonic
997426411 5:133805694-133805716 CAGGGCACAGGACATCCTGGAGG - Intergenic
999837783 5:155392894-155392916 GAAGGCAGAGGACAGGCAGGGGG + Intergenic
1001227987 5:169962203-169962225 GGAGGCAGAGGACAGTTAGGAGG + Intronic
1001832164 5:174797984-174798006 GGAAGCAAATGACAGCCAGGTGG + Intergenic
1002400012 5:178986462-178986484 CGATGCCCAGCACGGCCAGGAGG + Exonic
1002894314 6:1367462-1367484 CCACCCACAGGACAGCCTGGAGG - Intergenic
1005928464 6:30464048-30464070 CGAGGCCCAGGCGAGCCTGGAGG + Intergenic
1006043751 6:31275749-31275771 TGAGGAAAAGGACAGGCAGGGGG + Intronic
1007413027 6:41675666-41675688 AGAGGCACAGGAATTCCAGGCGG - Intergenic
1012444464 6:99293921-99293943 CAATGCACAGGAAAGACAGGAGG + Intronic
1013022915 6:106237477-106237499 CCAGACAAAGGACAGCCAGCCGG - Intronic
1013631345 6:111989120-111989142 GGAGCGGCAGGACAGCCAGGAGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018702296 6:166436703-166436725 TGAGGCACAGGGCAGCGAGGAGG + Intronic
1018856311 6:167677862-167677884 TGGGGCCCAGGACAGACAGGGGG - Intergenic
1019630783 7:2048585-2048607 CCTGGCACAGGGCAGGCAGGTGG + Intronic
1021690027 7:23222568-23222590 AGAGGCAAGGGACAGCCAGGGGG + Intergenic
1022974958 7:35548386-35548408 CGAGGCACAGGGCAGTCACTGGG - Intergenic
1024526775 7:50355869-50355891 GGAGGGGCAGGACAGCCGGGAGG - Intronic
1024579891 7:50793146-50793168 CGGGGCCCGGGACGGCCAGGCGG - Intronic
1026848657 7:73711617-73711639 TGAGGCAGAGCACTGCCAGGAGG + Intronic
1027318998 7:77000739-77000761 CGGGGGACAGGACAGCCACCTGG - Intergenic
1027387715 7:77675119-77675141 CGAGGTGGAGGACTGCCAGGAGG + Intergenic
1029622501 7:101698874-101698896 CTAGGCCCAGGGCAGCCAGGGGG - Intergenic
1030235335 7:107253771-107253793 ATAGTCACAGAACAGCCAGGAGG - Intronic
1030270184 7:107661613-107661635 CGAGCCAGAGGACAGCGAGGAGG - Intronic
1031124843 7:117762028-117762050 GGAGGTACAGGAGATCCAGGAGG - Intronic
1033039477 7:137905089-137905111 TGAGGCACAGGCCTACCAGGAGG - Intronic
1034418011 7:150975229-150975251 CGAGGCTGAGGCCAGCCTGGCGG + Intronic
1035386000 7:158473402-158473424 CCACGCCCAGGACAGCCGGGAGG + Intronic
1037585418 8:20272535-20272557 AGAAGCACAGGGCAGCTAGGGGG - Intronic
1037690892 8:21180601-21180623 TTAGTCACAGGAAAGCCAGGAGG - Intergenic
1037835649 8:22213437-22213459 GGAGGCTTAGGACAGCCTGGAGG + Intergenic
1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG + Intronic
1040413885 8:47180905-47180927 GGAGACACTGGGCAGCCAGGAGG + Intergenic
1041082369 8:54225801-54225823 GGAGGAAGAGGACAGGCAGGTGG + Intergenic
1041926411 8:63241920-63241942 CCTGGGACAGGACAGTCAGGAGG + Intergenic
1042022344 8:64380725-64380747 GGAGGCACTGGAGGGCCAGGAGG + Intergenic
1042484534 8:69336138-69336160 TGAGTCACAGGACTGCCGGGAGG - Intergenic
1047346912 8:124037779-124037801 GGAGGGACAGGAAAGGCAGGGGG - Intronic
1048857705 8:138698248-138698270 CCTTGCACAGGACAGCCAGCCGG + Intronic
1048874052 8:138822770-138822792 GGAGCCACAGGGAAGCCAGGAGG - Intronic
1048878078 8:138852247-138852269 GGAGGCAAAGGCCAGCCAGGAGG + Intronic
1048893045 8:138964895-138964917 GGAGGCTGAGGACAGCCAGGTGG - Intergenic
1049010489 8:139884131-139884153 AGAGGCACAGGACAGAGAAGAGG - Intronic
1049299587 8:141862496-141862518 GGAGGCAAAGGCCAGACAGGAGG - Intergenic
1049311492 8:141936080-141936102 CAGGGCACAGGAGACCCAGGAGG - Intergenic
1049640284 8:143712200-143712222 CGGGGCACAGGGCAGCTTGGGGG - Intronic
1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG + Intergenic
1054462882 9:65475089-65475111 CCAGGCACAGGACCTCAAGGTGG + Intergenic
1056078148 9:83062555-83062577 GGAGACACACGACAGCGAGGAGG - Exonic
1057182039 9:93035526-93035548 CACGGCCCAGGACAGCCCGGGGG + Exonic
1057497808 9:95574493-95574515 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497818 9:95574533-95574555 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497828 9:95574573-95574595 GGACGCAGAGGACAGCCTGGGGG - Intergenic
1057497848 9:95574654-95574676 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497858 9:95574694-95574716 GGACGCAGAGGACAGCCTGGGGG - Intergenic
1057497878 9:95574774-95574796 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497888 9:95574814-95574836 GGACGCAGAGGACAGCCTGGGGG - Intergenic
1057497898 9:95574854-95574876 GGACGCAGAGGACAGCCTGGGGG - Intergenic
1057497917 9:95574935-95574957 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057685814 9:97233291-97233313 TGATGCTCAGGACAGCCAGTGGG - Intergenic
1059121492 9:111642963-111642985 CAAGGCTCAGGACAGACAGGAGG + Intronic
1059557334 9:115294465-115294487 CAAGGGACAGGACAGCATGGTGG + Intronic
1060343988 9:122800854-122800876 AGAGGCTCACCACAGCCAGGTGG - Exonic
1060553995 9:124499058-124499080 CCAGCCCCAGAACAGCCAGGGGG + Intronic
1060607930 9:124934329-124934351 CAAGGCACCAAACAGCCAGGAGG + Intronic
1060779113 9:126398742-126398764 CCTGGCCCAGGCCAGCCAGGAGG + Intronic
1061264740 9:129498282-129498304 CGAGGCAGAGGACAGCATGGGGG + Intergenic
1061388612 9:130304881-130304903 CCAGGGACAGGTCAGCCAGCTGG - Intronic
1061805872 9:133137597-133137619 AGAGGCAGAGGCAAGCCAGGCGG + Intronic
1061963492 9:133999935-133999957 CGAGGCCCAGACCAGCTAGGAGG + Intergenic
1062087375 9:134655802-134655824 CGTGCCATAGGACAGCCTGGTGG - Intronic
1062290336 9:135791583-135791605 CAGGGCAGGGGACAGCCAGGAGG - Intronic
1062321819 9:135993952-135993974 CCAGGCACTGCAGAGCCAGGCGG + Intergenic
1062497719 9:136839503-136839525 CGGGGCAGAGGTCAGCCAGGTGG + Intronic
1062529552 9:136993898-136993920 CCTGGCCCAGGACAGGCAGGTGG - Exonic
1186608368 X:11114236-11114258 CAAGGCACAGGAAAACCACGTGG - Intronic
1186966534 X:14792385-14792407 GGAGGGACAGCTCAGCCAGGTGG - Intergenic
1187278436 X:17837082-17837104 CCAGGCACAGGACAAGCAAGAGG - Intronic
1187378808 X:18781438-18781460 AGAGGCTCAGAAGAGCCAGGAGG + Intronic
1192437748 X:71153346-71153368 CTGGGCCCAGGACAGGCAGGAGG - Intronic
1200063197 X:153492705-153492727 GGAGACACAGGGGAGCCAGGCGG - Intronic
1200100997 X:153689013-153689035 CCAGGCACATGACTGCGAGGGGG - Intronic