ID: 1101009715

View in Genome Browser
Species Human (GRCh38)
Location 12:100436985-100437007
Sequence TAATGGGGATAGAAAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101009715_1101009723 20 Left 1101009715 12:100436985-100437007 CCTGTGACTTTCTATCCCCATTA No data
Right 1101009723 12:100437028-100437050 ACTGGATAAATGTACCAGCCTGG No data
1101009715_1101009724 26 Left 1101009715 12:100436985-100437007 CCTGTGACTTTCTATCCCCATTA No data
Right 1101009724 12:100437034-100437056 TAAATGTACCAGCCTGGCTGAGG No data
1101009715_1101009720 2 Left 1101009715 12:100436985-100437007 CCTGTGACTTTCTATCCCCATTA No data
Right 1101009720 12:100437010-100437032 ATGAGCCATTTCCACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101009715 Original CRISPR TAATGGGGATAGAAAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr