ID: 1101014388

View in Genome Browser
Species Human (GRCh38)
Location 12:100484495-100484517
Sequence GTAACCTAAGTCTTCATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101014388 Original CRISPR GTAACCTAAGTCTTCATTTA AGG (reversed) Intronic
902674107 1:17996514-17996536 GAAGCCTTTGTCTTCATTTAGGG - Intergenic
907351457 1:53835235-53835257 TGAAACTAAGTTTTCATTTATGG + Intronic
909103958 1:71385055-71385077 GTAAGCTGTGTCTTCATTAAGGG - Intergenic
916919328 1:169446489-169446511 GTAATCTAAGATTTCATTTTAGG - Intronic
916960803 1:169886613-169886635 GTAATCTAAGTGTTTAGTTAGGG - Intronic
918411974 1:184268801-184268823 GTATCCTGATTTTTCATTTATGG + Intergenic
918606627 1:186435173-186435195 GTAATCTCAGTTTTCAATTATGG - Intergenic
918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG + Intergenic
918959628 1:191256767-191256789 GAAACCCAAGTGTCCATTTAAGG + Intergenic
919577839 1:199334006-199334028 TTAACCTAATTTTTCATTTTTGG - Intergenic
921659323 1:217780420-217780442 GTAAACTCAGTCTTCCTTTTGGG - Intronic
922527280 1:226314571-226314593 GCAACCTAAGTATTTATTGATGG + Intergenic
1068038332 10:51789608-51789630 GTCTCCTAACTCTTCATTTTAGG - Intronic
1068886256 10:62100110-62100132 CTAAGATAAGTCTACATTTATGG + Intergenic
1072375237 10:94808833-94808855 GCAACCTAAGTGTTCATCAATGG - Intronic
1072935035 10:99704123-99704145 GTAACATAAGTCTTAAAATATGG - Intronic
1074172090 10:110951636-110951658 TCAACCTATGTCTTCATTGATGG + Intronic
1079506035 11:21153372-21153394 GTAAACTAAGATTTCTTTTATGG + Intronic
1081542534 11:44046354-44046376 ATGGCCAAAGTCTTCATTTATGG + Intergenic
1081566812 11:44265415-44265437 GTGACCTCAGGCTTCATTAAGGG + Intronic
1081770451 11:45647354-45647376 GCAACCCAAGTGTTCATCTAGGG + Intergenic
1083069684 11:59964459-59964481 GTTACCTAGGTCTACATTTCTGG + Intergenic
1083510740 11:63207940-63207962 GTAACTTAAGTCTTTGTTCAGGG + Intronic
1085717089 11:78881842-78881864 GTCTCCTAAGTCTTCCTTTTAGG + Intronic
1088089931 11:106025660-106025682 ATAACCTAAGTGTCCATCTATGG - Intergenic
1089753209 11:120666612-120666634 GTTACCTAAGACTTCAGATATGG - Intronic
1090809911 11:130228671-130228693 GTAACCTCAACATTCATTTATGG + Exonic
1091527678 12:1320490-1320512 GTAACTTAAATGTTCATTAATGG - Intronic
1095394780 12:41749509-41749531 ATAACCTAAGTGTTCATCAATGG - Intergenic
1096231041 12:49897121-49897143 GTACCCTAGGTCTCCATTTCTGG + Intronic
1098738719 12:74142624-74142646 GAAATCTAAGTCCTCATTCATGG + Intergenic
1099036617 12:77595149-77595171 ATAACCCAAGTGTTCATTGATGG + Intergenic
1099370313 12:81820789-81820811 GCAACCTAAGTGTTCATCAACGG + Intergenic
1099609719 12:84852244-84852266 GCAACCTAAGTGCTCATTAATGG - Intergenic
1099800409 12:87450503-87450525 ACAACCTAAGTGTTCATTGATGG + Intergenic
1100022970 12:90091943-90091965 GTAACCTAAGTCTAAAATGAAGG + Intergenic
1100824381 12:98461242-98461264 GTACCCTAAATCTGAATTTAGGG + Intergenic
1101014388 12:100484495-100484517 GTAACCTAAGTCTTCATTTAAGG - Intronic
1102659795 12:114516040-114516062 TCAACCTAAGTATTCATTGATGG + Intergenic
1104510223 12:129370625-129370647 TCAACCTAAGTGTTCATTAATGG + Intronic
1106198596 13:27515995-27516017 GTAACCCAAGTGTCCATTGATGG + Intergenic
1106225341 13:27781978-27782000 GCAACCTAAGGCCTCATTAATGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108909793 13:55533084-55533106 ATAACCTATTTCTTCATTTTAGG + Intergenic
1109418307 13:62073976-62073998 GTAACCTAAGTGTCCATTAGTGG - Intergenic
1109607172 13:64711711-64711733 GTAATCTAAGTGTTCATCAATGG - Intergenic
1109927472 13:69163267-69163289 GTAACCTAAGTGTCCATCAACGG - Intergenic
1110393550 13:75003709-75003731 GTAACCTAAGTATCCATAAAGGG - Intergenic
1110644258 13:77863426-77863448 GTAATTTAAGTATTCATGTATGG - Intergenic
1111758127 13:92424996-92425018 GTAACAAAAGGCTTCATTTTAGG - Intronic
1114229360 14:20766527-20766549 GTAACCAAAGGTTTCACTTATGG - Intergenic
1116586101 14:46706740-46706762 TTAATCTAAGTCTTCATTCTTGG + Intergenic
1118001814 14:61529957-61529979 GTACACTTTGTCTTCATTTAGGG - Intronic
1118114996 14:62765416-62765438 GTTTCCTAAGTTTTCATCTAGGG - Intronic
1120124174 14:80720596-80720618 GTAACGTAAGTCTTGGTATATGG + Intronic
1121185721 14:91966593-91966615 GAAACCTAAGGCTTTATTTGGGG + Exonic
1126438031 15:48655972-48655994 GTAACATAAGTCATCACTGAAGG + Intergenic
1128643452 15:69357625-69357647 GCAACCGAAGTGTTCATTAAAGG - Intronic
1131328425 15:91471071-91471093 GCAACCCAAGTGTTCATTGATGG + Intergenic
1131576776 15:93600262-93600284 GTCACCTAAGGACTCATTTAAGG + Intergenic
1135353577 16:21750899-21750921 TTAAACTAAGCCTTGATTTAAGG - Intronic
1135452065 16:22567026-22567048 TTAAACTAAGCCTTGATTTAAGG - Intergenic
1138631979 16:58303669-58303691 GCAACCTAAGTGTTCATCAATGG + Intronic
1139523592 16:67499476-67499498 GTAACCTCAGTCTTCAGTTGGGG - Intergenic
1140710054 16:77669302-77669324 GTATCATAAGTGTTCACTTATGG - Intergenic
1143232245 17:5366742-5366764 GTAGCTTATGTCTTCATTAATGG + Intronic
1145119370 17:20243366-20243388 GAAATGTAAGACTTCATTTATGG + Intronic
1150533305 17:66008894-66008916 TTGACCTAAGTGTTCATCTATGG - Intronic
1153132150 18:1866532-1866554 GTAACTTAAGTGTCCATTGATGG + Intergenic
1153319822 18:3761479-3761501 GCAACCCAAGTGTTCATCTATGG - Intronic
1153810229 18:8746136-8746158 GCAACCTAAGTGTTTATTGATGG - Intronic
1154462278 18:14604566-14604588 GTATCCAAAGGCTGCATTTAGGG + Intergenic
1157089469 18:44619303-44619325 GCAACCTAAGTCTCCATTAATGG + Intergenic
1157371539 18:47117364-47117386 CTAACCTATTTCTTCATTAACGG - Intronic
1158892262 18:61883768-61883790 GCAACCTGAGTCTTCCTTAAAGG - Intronic
1159171135 18:64768198-64768220 GAAACCTAAGTATTCAATTGAGG - Intergenic
1164010317 19:21197629-21197651 GTAACTTAACTCTTTGTTTAGGG - Intergenic
928861917 2:35868698-35868720 ACAACCTAAGTGTTCATTGATGG + Intergenic
928978186 2:37110898-37110920 GCAACCTAAGTGTCCATTGATGG + Intronic
929332349 2:40698073-40698095 ATACCTTAAGTCTTCATTCAAGG - Intergenic
930215658 2:48693804-48693826 GTAGCCTAAGTCTCCTTTAAGGG + Intronic
933142387 2:78808828-78808850 GTAACCTCTGTCTTCCTTTTTGG - Intergenic
934540952 2:95174588-95174610 CTAAGCTAAGTTTTCATTTGTGG - Intronic
935093447 2:99919176-99919198 GGCACCTAATTCTTCTTTTATGG + Intronic
935179747 2:100678869-100678891 GGAACATAAATCTTCAGTTAGGG - Intergenic
936738826 2:115479147-115479169 GCAACCTAAGTGTCCATTGATGG + Intronic
938839705 2:135148359-135148381 GTGACCTAAGTCTACATAAATGG - Intronic
939353853 2:141075638-141075660 GTAACCTGATTCTGCACTTAAGG + Intronic
940263970 2:151817162-151817184 TTATCCTAATTCTCCATTTAGGG + Intronic
940715657 2:157220463-157220485 GATACCTAAGTCTTGCTTTAAGG - Intergenic
942882514 2:180878648-180878670 GCAACCTAAGTGTCCATTAATGG + Intergenic
943128412 2:183826140-183826162 GTAACCTAAGTGTTCATCTGAGG + Intergenic
943610001 2:190021027-190021049 GTAACTCAAGTGTTCATTGATGG - Intronic
943717322 2:191166565-191166587 GGAATCTAACACTTCATTTAAGG + Intergenic
945005848 2:205405130-205405152 GTAACCCAACTCATCTTTTATGG - Intronic
946135161 2:217640022-217640044 GTAACCCAAGTATCCATCTACGG + Intronic
1174084613 20:47997992-47998014 GAAACCTAATGCTTCCTTTAAGG + Intergenic
1175547832 20:59790524-59790546 CTAACCTAAGTGTCCATTCATGG + Intronic
1176812282 21:13554119-13554141 GTATCCAAAGGCTGCATTTAGGG - Intergenic
1176916371 21:14630521-14630543 TTAACATAAGTCTCTATTTACGG + Intronic
1177715167 21:24831097-24831119 ACAACCTAAGTGTTCATTGATGG - Intergenic
1177971533 21:27796291-27796313 CTAACCTAAGGCAGCATTTAAGG + Intergenic
1178054025 21:28779204-28779226 GTAAACTAAGTGTTCATCAATGG + Intergenic
1182819074 22:33198746-33198768 TTAACCTAAGTGTCCATCTACGG - Intronic
949093363 3:56265-56287 GTAACTGAAGTCTGCATTTTTGG - Intergenic
949144931 3:687810-687832 TTAACATAAGTTTGCATTTAAGG + Intergenic
949553443 3:5131739-5131761 GTAACCAAAATATTCATATAAGG - Intronic
949700895 3:6756575-6756597 GCAATCTAAGTGTTCATTAAAGG + Intergenic
951584225 3:24198741-24198763 GCTATCTAAGTCTTCATTTTGGG - Intronic
952538723 3:34343424-34343446 GTGACATAAGGCTTCATTCACGG + Intergenic
952783344 3:37126439-37126461 CTAATCCAAGTCTTGATTTATGG - Intronic
953023534 3:39131198-39131220 GTAACCTAGGTCCTTTTTTAAGG - Intronic
953206680 3:40837392-40837414 GCAACCTAAGTGTTCACTGATGG + Intergenic
957033617 3:75272343-75272365 GTAACTGAAGTCTGCATTTTTGG - Intergenic
957932771 3:86903532-86903554 GTTACCCCAGTCTTCATTTTGGG - Intergenic
957993887 3:87663212-87663234 ATAACCTAAGTGTTCATAAAGGG + Intergenic
958010780 3:87876348-87876370 GTAACCTAAATGTCCATTGATGG + Intergenic
958910787 3:99992066-99992088 TTAACCTAAGTGTCCATTAATGG - Intronic
959876911 3:111393861-111393883 GATACCTAAGTGTTCATTAATGG + Intronic
963598101 3:147354388-147354410 TTAACCTAATTCTTCATTTAAGG + Intergenic
963985999 3:151595363-151595385 GCAACCTAAGTGTCCATTGATGG + Intergenic
965651719 3:170940507-170940529 TTAACATATGTCTTCTTTTATGG - Intergenic
966425011 3:179771616-179771638 GTAACCTAACACTGCTTTTAAGG - Intronic
967019903 3:185513669-185513691 GCAACCCAAGTGTTCATTGATGG + Intronic
971184587 4:24361394-24361416 GAAAACAAAGTCTTCATTTCAGG - Intergenic
972769940 4:42188303-42188325 GTAACCTAAGTATCCATCAACGG + Intergenic
974419335 4:61651995-61652017 TTAATCTAATTCTTCATTTTTGG - Intronic
974712194 4:65612569-65612591 TTAACCTAAGTGTTCATCAAAGG - Intronic
975480638 4:74876287-74876309 GTTACCTAAGTCTTCTCTTCAGG - Intergenic
979143712 4:117213068-117213090 GCAACCCAAGTGTTCATTGATGG - Intergenic
980342838 4:131572822-131572844 GTAGCCTAAGTTTTTGTTTATGG - Intergenic
980475106 4:133304187-133304209 ATAAACTAAGTGTTCATTGATGG - Intergenic
982930132 4:161394184-161394206 GTTACCTAAATATTCATTTCAGG - Intronic
983426598 4:167591883-167591905 ATAACCTAAGTTTTCATCAATGG + Intergenic
985077264 4:186228127-186228149 TTAACATAAATCTTAATTTAAGG - Intronic
988784836 5:34557006-34557028 GCAAACTAAATCTTCCTTTATGG + Intergenic
988885506 5:35553112-35553134 CTAACATAAGTCTCTATTTATGG - Intergenic
991374061 5:65947654-65947676 GTGACATATTTCTTCATTTAGGG - Intronic
991594198 5:68285934-68285956 TTAACCAAAATCTTCATCTAAGG - Intronic
991916579 5:71611463-71611485 ATAACCTAACTGTTCATTCATGG + Intronic
994646136 5:102471103-102471125 CCAACCTAGGTCTTCATTAATGG - Intronic
996367517 5:122718894-122718916 GTAACAAAAGTCTTTTTTTAAGG + Intergenic
998165626 5:139841413-139841435 GTAAGCCAAGTGTTCATTGATGG - Intronic
998584041 5:143406984-143407006 GTATCCTAAGTCTTTAGGTATGG + Intronic
999022428 5:148182730-148182752 AGAACCTAAGTGTTCATTGATGG - Intergenic
1000149886 5:158489554-158489576 GTTACCTAAGTTTTATTTTAGGG + Intergenic
1000436396 5:161216042-161216064 ATAAGCTAAGTATTCATTTTAGG + Intergenic
1001804151 5:174569131-174569153 GTAGCCTCATTCTTCATGTAAGG + Intergenic
1001833977 5:174814966-174814988 GTAACCTAAAGGTTCATTAATGG - Intergenic
1003342613 6:5236505-5236527 GAAACCAAAGTTTTCATTTTTGG + Intronic
1004997137 6:21204532-21204554 GGACCCTAAGTCAACATTTATGG + Intronic
1005348708 6:24913688-24913710 GTCACCAAAGTCTTCATTCTTGG + Intronic
1006968516 6:38015036-38015058 GTAACCTTATACTTTATTTAAGG + Intronic
1008181325 6:48333436-48333458 GCAACCTCAGTGTTCATTAACGG - Intergenic
1008230654 6:48982487-48982509 GTCACCTCAGTCTTCTTTGATGG - Intergenic
1008999107 6:57692547-57692569 TCAACCTAAGTGTTCATTAACGG + Intergenic
1009187595 6:60591932-60591954 TCAACCTAAGTGTTCATTAATGG + Intergenic
1010511473 6:76725786-76725808 GTAACCTAAATGTCCATTGATGG - Intergenic
1011277988 6:85647997-85648019 TTAACCCAAGTGTTCATTGATGG + Intergenic
1013058800 6:106611896-106611918 GTTAACTAAGTCTTCATAAATGG - Intronic
1014763537 6:125385751-125385773 TTAACCTAAGTGTTCATTATTGG - Intergenic
1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG + Intronic
1016716365 6:147236347-147236369 ATAATCTGAGTCTTCATATATGG - Intronic
1017089689 6:150748282-150748304 GTAACCTAAGTGTGCATCAATGG - Intronic
1019568774 7:1698183-1698205 GGAACCTCAGCCTTCATTTCAGG + Intronic
1021355186 7:19645307-19645329 GTAACCTAATACTTAAATTATGG + Intergenic
1022266408 7:28759567-28759589 GAAAACTAAGCCCTCATTTAAGG - Intronic
1022658476 7:32343673-32343695 GTAACATAGTTCCTCATTTATGG + Intergenic
1023137583 7:37068173-37068195 GTTACCACAGCCTTCATTTAGGG - Intronic
1024494193 7:50024400-50024422 ATAACCTAAGTGTTCAATCATGG + Intronic
1026075115 7:67159096-67159118 GTAATCGAAGCCTTCATTTTAGG - Intronic
1026287862 7:68979285-68979307 GTAACCTAAGTGTCCATCAATGG + Intergenic
1027850767 7:83448914-83448936 GTAACATAATTCTTGATATAAGG - Intronic
1030062060 7:105630148-105630170 ACAACCTAAGTGTTCATTGAGGG - Intronic
1031318990 7:120297452-120297474 TCAACCTAAGTGTTCATTGATGG - Intronic
1031845593 7:126802458-126802480 CTAACCTAAGTGTTCATCAATGG + Intronic
1032631493 7:133658030-133658052 GTAATCTAACTCTACCTTTAGGG + Intronic
1033933029 7:146547704-146547726 ACAACCTAAGTGTTCATTAATGG - Intronic
1034012256 7:147542398-147542420 GAAATCCAAGACTTCATTTACGG + Intronic
1034029743 7:147747494-147747516 GTAACCTAAGTGTCCATCAATGG - Intronic
1034406562 7:150907530-150907552 GTAACCAAAGTCCTCATGTCTGG - Intergenic
1034687721 7:152987993-152988015 ACAACCTAAGTGTTCATTGATGG + Intergenic
1034961095 7:155364923-155364945 GGCTCCTAAGTCTTCATTCATGG + Intronic
1035817746 8:2559428-2559450 GAATGCTATGTCTTCATTTATGG - Intergenic
1039140266 8:34379496-34379518 ATAACCTAAGTGTTCATCAATGG + Intergenic
1040562347 8:48534902-48534924 ATAACCCAAGTGTTCATTGATGG + Intergenic
1040959430 8:53015475-53015497 GTAACCTATGTGTGCATTCAGGG - Intergenic
1041479399 8:58301120-58301142 GTGCCCTAAGTATTCATTTGAGG + Intergenic
1042078535 8:65023167-65023189 GAAACCTAAGTGTTTATTGATGG + Intergenic
1042963915 8:74330643-74330665 ATAACCTAATCCTTCATTTCTGG - Intronic
1043783963 8:84373314-84373336 GTTACCTAGGTCATCATTGAGGG + Intronic
1043824521 8:84909636-84909658 GTCACGTAAGTCTTCATATTTGG - Intronic
1044864585 8:96557983-96558005 CTAACCCATGTCTACATTTAGGG + Intronic
1044875120 8:96657708-96657730 TTCACTAAAGTCTTCATTTAAGG - Intronic
1047082899 8:121483377-121483399 TCAACCTAAGTGTTCATTAATGG + Intergenic
1048326726 8:133445359-133445381 TTAACCTAAGTGTCCATTGATGG - Intergenic
1052188679 9:25630272-25630294 GTATACTAAGACTTGATTTAAGG - Intergenic
1053587320 9:39472772-39472794 GTAACCCAAGTGTCCATTAATGG - Intergenic
1054578982 9:66892466-66892488 GTAACCCAAGTGTCCATTAATGG + Intronic
1059141836 9:111860574-111860596 ACAACCTAAGTGTTCATTGATGG - Intergenic
1059662588 9:116416664-116416686 AAAACCTAAATCTACATTTAAGG - Intergenic
1187840936 X:23486824-23486846 GAACCCTAAGTTTTCATTTTGGG + Intergenic
1189734952 X:44060404-44060426 GCAACCCAAGTGTTCATTAACGG - Intergenic
1190618138 X:52259452-52259474 TTAGCCTAAATCCTCATTTATGG + Intergenic
1190691182 X:52914765-52914787 ACAACCTAAGTGTTCATTGATGG - Intergenic
1190693402 X:52931472-52931494 GTTACCTAAATCCTCATTTATGG + Intronic
1190694801 X:52941027-52941049 ACAACCTAAGTGTTCATTGATGG + Intronic
1193567254 X:83092974-83092996 GTTACTGAAGTCTTCATTTCTGG + Intergenic
1194184210 X:90752591-90752613 GAAAACAAAGGCTTCATTTATGG + Intergenic
1194456651 X:94112589-94112611 TCAACCTAAGTGTTCATTAAAGG - Intergenic
1194871018 X:99131189-99131211 ATCACCTAAGTTTTCATTGATGG + Intergenic
1195028934 X:100907605-100907627 GTAACTTAAATTTTCATCTATGG - Intergenic
1195544963 X:106103934-106103956 GTGACCCAAATCTTCATTTCTGG - Intergenic
1196603449 X:117627909-117627931 ACAACCTAAGTCCTCTTTTAGGG - Intergenic
1197021067 X:121689709-121689731 ATAACCTAAATGTTCATTGATGG - Intergenic
1197168321 X:123403807-123403829 GAAACCTAATTCTTCATTGTGGG + Intronic
1198696639 X:139347093-139347115 TTATCCTCAGTCTTCAGTTAAGG + Intergenic
1200530800 Y:4334514-4334536 GAAAACAAAGGCTTCATTTATGG + Intergenic
1202051579 Y:20786674-20786696 GCAACCTAAGTGTTCATTGCGGG - Intergenic
1202243891 Y:22796570-22796592 GTAACCTAAATCTAAATTTTTGG - Intergenic
1202396878 Y:24430320-24430342 GTAACCTAAATCTAAATTTTTGG - Intergenic
1202473905 Y:25239772-25239794 GTAACCTAAATCTAAATTTTTGG + Intergenic