ID: 1101016372

View in Genome Browser
Species Human (GRCh38)
Location 12:100505025-100505047
Sequence GCAAAGTTGTTTGCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101016372_1101016375 11 Left 1101016372 12:100505025-100505047 CCAGGAACAGCAAACAACTTTGC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1101016375 12:100505059-100505081 GCCATTTAGTGAAGAAACCATGG 0: 1
1: 1
2: 1
3: 27
4: 193
1101016372_1101016379 30 Left 1101016372 12:100505025-100505047 CCAGGAACAGCAAACAACTTTGC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1101016379 12:100505078-100505100 ATGGATTAAGAAATAAAGGAAGG 0: 1
1: 1
2: 6
3: 75
4: 840
1101016372_1101016377 26 Left 1101016372 12:100505025-100505047 CCAGGAACAGCAAACAACTTTGC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1101016377 12:100505074-100505096 AACCATGGATTAAGAAATAAAGG 0: 1
1: 0
2: 5
3: 59
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101016372 Original CRISPR GCAAAGTTGTTTGCTGTTCC TGG (reversed) Intronic
901542628 1:9929886-9929908 GCAAAGTCGCTTGCTCTTTCTGG + Exonic
909253974 1:73394203-73394225 GCAAAGATGTTTCCTGGTCGAGG - Intergenic
909458083 1:75872985-75873007 GCATAGTTGTTTTCTGTCCTTGG - Intronic
910173146 1:84399686-84399708 GCAAAGTAGTTTGGTATTGCTGG + Intronic
912935313 1:113998968-113998990 GCAATGTTCTTTTCTGTCCCAGG + Intergenic
913662715 1:121018988-121019010 GTGAAGTAGTTTGCTGCTCCTGG - Intergenic
914014096 1:143802250-143802272 GTGAAGTAGTTTGCTGCTCCTGG - Intergenic
914163725 1:145158946-145158968 GTGAAGTAGTTTGCTGCTCCTGG + Intergenic
914652716 1:149710808-149710830 GTGAAGTAGTTTGCTGCTCCTGG - Intergenic
924479917 1:244420479-244420501 GCAATGCTCTTTTCTGTTCCTGG - Intronic
1066604114 10:37142530-37142552 CCAAAGTTGTTTGGTGGTACAGG + Intronic
1067580208 10:47439944-47439966 GCCAAGCAGTTTGCTGTCCCTGG + Intergenic
1069180304 10:65350818-65350840 GCAAAGTTTATTGCTGCTGCAGG - Intergenic
1071421637 10:85505933-85505955 GCAATGTTGATTGCTGCGCCAGG + Intergenic
1071681797 10:87713248-87713270 GCTAAGCTGTTTGCTGATGCTGG + Exonic
1072297499 10:94025213-94025235 GCAAAGTGGTTTGCAATTTCTGG - Intronic
1072977619 10:100072950-100072972 CCCAAATTGTTGGCTGTTCCTGG + Intronic
1073449113 10:103599138-103599160 GAAAAGTTGTTTCCTGTCCTTGG + Exonic
1073816164 10:107209805-107209827 GCAAATTTGTCTATTGTTCCAGG - Intergenic
1074336231 10:112578928-112578950 GCCAACTTGCTTGCTATTCCTGG + Intronic
1075263715 10:120983745-120983767 GGAAACTTGTTTGCTGTTTGGGG - Intergenic
1076178662 10:128388147-128388169 CCAAAGTTATTTGCTGTTGATGG - Intergenic
1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG + Intergenic
1085920408 11:80948444-80948466 GCTAAGTGGTTTGCTGTGGCTGG + Intergenic
1086192058 11:84091561-84091583 GCAGAGTAGCTTGCTGTTGCAGG - Intronic
1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG + Intergenic
1089190385 11:116649176-116649198 GGAAAGTTGTCTCCTCTTCCTGG - Intergenic
1092718011 12:11411609-11411631 CCAAAGTTGTTTTTTCTTCCTGG + Intronic
1093661253 12:21759865-21759887 ACAAAGTGATTTGCTGTGCCAGG + Intergenic
1095108973 12:38270355-38270377 GCAAAGAAGGATGCTGTTCCAGG - Intergenic
1100034592 12:90235262-90235284 GAAAAGTTTTTTGCTATTGCAGG - Intergenic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1102904931 12:116667227-116667249 TTAAAGTTGTCAGCTGTTCCTGG - Intergenic
1103791122 12:123471940-123471962 GCAAAGTTGTCTCCAGTTTCTGG + Exonic
1107187688 13:37544080-37544102 GTAAATTTGTTAGCAGTTCCTGG + Intergenic
1107426891 13:40303140-40303162 GTAAGGTTGTCTGCTTTTCCTGG - Intergenic
1107579425 13:41766465-41766487 GCAAATTTATCTGCTGTTGCAGG - Intronic
1107979161 13:45717892-45717914 CCAAAGTTGTTTCCTCTTGCAGG + Intergenic
1108933936 13:55864297-55864319 AAAAAGTTGTTTGCTGGGCCAGG + Intergenic
1112350525 13:98629748-98629770 GCAAAGATGATTTCTGTTCCAGG + Intergenic
1114373931 14:22122710-22122732 CCAAACTTCTTTGCTTTTCCTGG + Intergenic
1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG + Exonic
1116084301 14:40216515-40216537 CCAGAGTTGTTTGTTCTTCCAGG + Intergenic
1116126614 14:40796633-40796655 GGAAAATTGTTTGCTGGACCAGG - Intergenic
1116147389 14:41091991-41092013 AGAAACTAGTTTGCTGTTCCCGG + Intergenic
1116707072 14:48315832-48315854 GGGAAGTGGTTTGGTGTTCCAGG - Intergenic
1118461780 14:65993906-65993928 GCAAAGATGTTGGATGATCCAGG - Intronic
1120330318 14:83084629-83084651 GCAAAGTGATTTGATGTTTCGGG - Intergenic
1120590651 14:86370039-86370061 GCAGAGTTGATTGGTTTTCCAGG + Intergenic
1121082424 14:91119150-91119172 GCAGAGTTGTTTGCCTGTCCTGG - Intronic
1121625972 14:95385643-95385665 GCAGAGTTGGTTTCTGTTGCTGG + Intergenic
1124205498 15:27715418-27715440 AAAAAGTTGTTTGCTTTTCCTGG - Intergenic
1124566949 15:30824749-30824771 GCAAAGATGCTTGCAGCTCCCGG - Intergenic
1124871455 15:33547338-33547360 GCAAACTTTTTTCCAGTTCCAGG - Intronic
1127982208 15:64043636-64043658 GCAATGTTGTTTCCTGATCTGGG + Intronic
1128336580 15:66790078-66790100 GCAAAGATGTTTGCCATTCCTGG + Intergenic
1129140488 15:73593566-73593588 ACTAAGTTGCTTGCTGTTCAGGG + Intronic
1134096855 16:11424037-11424059 GCAAAGCTGTTGGGTGTCCCTGG + Intronic
1140697092 16:77546080-77546102 GGAAAGTTGTTTAATCTTCCTGG + Intergenic
1143105356 17:4527230-4527252 ACAATGTTCTTGGCTGTTCCTGG - Intronic
1146593661 17:34151176-34151198 GAATAGTTACTTGCTGTTCCTGG - Intronic
1149297872 17:55276926-55276948 GAAAAGCTGTTTGATGTTCAAGG - Intronic
1158104657 18:53871901-53871923 ACAAAGGCGTTTGCTGATCCAGG - Intergenic
1159401483 18:67942113-67942135 GCAAACTTGTTTGTGGTTTCTGG - Intergenic
1164438103 19:28249888-28249910 GCCAACTTCTTTGCTCTTCCTGG + Intergenic
1167043303 19:47035623-47035645 GCACAGTTGTTTGCTGTATGGGG + Intronic
926517018 2:13859783-13859805 GCAAAGTTGATTGATCTTCTGGG + Intergenic
926816390 2:16802036-16802058 CCAAAGTGGGTTGCTGTTGCTGG + Intergenic
930235206 2:48882641-48882663 CCAAGGTTGTTTGCTATTCTTGG + Intergenic
931541070 2:63329281-63329303 TCATATTTGTCTGCTGTTCCTGG + Intronic
931916756 2:66964412-66964434 GCAAAGTTGCTTTCTGTGACTGG - Intergenic
932071393 2:68624185-68624207 GCAAAGTTGTAAGCTGTGCTAGG - Intronic
933610421 2:84428605-84428627 GCAAATTTGTTTGCCATTCTAGG - Intronic
934900341 2:98154870-98154892 GCAAAGTTGGGTGCTGTGCTGGG + Intronic
935376054 2:102399100-102399122 GAAAAGTTATTTGTTGGTCCTGG - Intergenic
939480475 2:142741656-142741678 GCAGATTTGTTTGCTGATCAAGG + Intergenic
939620355 2:144411654-144411676 GAAAAGTTTTCTGCTCTTCCTGG + Intronic
942596639 2:177597725-177597747 TCAAAATTGTTTGCCTTTCCTGG + Intergenic
942693157 2:178608881-178608903 ACAAAGTTGATTGGTGGTCCCGG + Exonic
943035530 2:182740933-182740955 GCAAAGTTGTCAGCTTTTTCAGG - Intronic
943236678 2:185330272-185330294 GCAAAATTGTTTTTTGTGCCTGG + Intergenic
943353655 2:186824076-186824098 GCAGAGTTTTTTCCTGTTCTGGG - Intergenic
943777874 2:191786893-191786915 ACAAAGTTGTATTTTGTTCCTGG + Intergenic
945333314 2:208563330-208563352 GAAAAGTTGTTTCCTGGGCCGGG - Intronic
946480837 2:220055185-220055207 GGAAAGTTGCTTCCTGTTACAGG + Intergenic
946639266 2:221765975-221765997 GCTATTTTGTTTACTGTTCCCGG + Intergenic
1170198031 20:13711127-13711149 ACAAAGTTGTTTGCAGTTTTTGG - Intergenic
1170239576 20:14148955-14148977 GCACACTTTTCTGCTGTTCCAGG + Intronic
1171134164 20:22682203-22682225 GCAAAGTTGTATGTTGCTCTTGG + Intergenic
1171802810 20:29641922-29641944 GGACAGTTGTTGGCTGTTGCTGG + Intergenic
1172912778 20:38422223-38422245 GCAGAGTCATGTGCTGTTCCTGG - Intergenic
1181770937 22:25125076-25125098 GCAAAGTTAGCTGCTGGTCCAGG + Intronic
1184849060 22:47109176-47109198 TCAAAATTGTTTTCTCTTCCTGG - Intronic
1184918223 22:47587889-47587911 GCAAAGTTCTTCTCTGTACCAGG + Intergenic
949628098 3:5890643-5890665 GCAAACTTGTTTTCTAATCCAGG + Intergenic
949963131 3:9331252-9331274 GGAAAGTGCTTTGCAGTTCCTGG - Intronic
951896427 3:27613823-27613845 CCAAATTTGTTTGCTGTACTTGG + Intergenic
952540189 3:34359240-34359262 GTAAAGTTCTTAGATGTTCCTGG - Intergenic
957708271 3:83818599-83818621 GTAAACTAGTTTGCTCTTCCAGG + Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
966284623 3:178279173-178279195 GCCCAGTTGTCTGCTGATCCAGG + Intergenic
966476523 3:180354595-180354617 GCAAAATGGTTTGCTCTACCAGG - Intergenic
969846367 4:9923199-9923221 GGAAAGTTGTCTCCTATTCCTGG + Intronic
970183611 4:13425684-13425706 GCAAAGTTCTTGGCTTTTCTAGG + Intronic
971319659 4:25595193-25595215 AAAAAGTTGTTTTCTCTTCCTGG + Intergenic
971858276 4:32071686-32071708 ACAAAGCTGTGTGCTGATCCAGG - Intergenic
972418474 4:38865543-38865565 GCAAAGGTGCTTGCTGTCTCTGG + Intergenic
972831278 4:42816361-42816383 GCAAATGTGTTTCCTGTTCTGGG + Intergenic
976115556 4:81722460-81722482 GCAAATTTCTCTGCTGTTCCTGG - Intronic
976779599 4:88744452-88744474 GCAAAGCTGTTTGCTTTCTCAGG - Intronic
978724796 4:111957332-111957354 GCAAAGATGTTCGCTGATGCAGG - Intergenic
980240872 4:130173308-130173330 GCAAAGTTTTTTGCTACCCCTGG + Intergenic
981020797 4:140026026-140026048 CCAAATTTGTTTGTTATTCCAGG + Intronic
983616769 4:169715052-169715074 TTCAAGTTGTTTTCTGTTCCTGG + Intronic
984641528 4:182170085-182170107 GCCAATTTGTTTACTGTTCAAGG - Intronic
987661751 5:20887401-20887423 CAAAAGTTGTATGCAGTTCCAGG + Intergenic
988761833 5:34317909-34317931 CAAAAGTTGTATGCAGTTCCAGG - Intergenic
989678956 5:44006920-44006942 CCAGAGTTGTTTGCTCCTCCTGG + Intergenic
992378663 5:76215867-76215889 ACAAAGGTGTTCGCTGTTTCTGG + Intronic
993234097 5:85280508-85280530 TCAAACATGTTTTCTGTTCCTGG - Intergenic
996019320 5:118574368-118574390 GAAAAGATTCTTGCTGTTCCAGG - Intergenic
996415922 5:123209911-123209933 CCATAGTTGTGTGCTTTTCCTGG - Intergenic
1003009661 6:2414711-2414733 GCACAGTGGCTTTCTGTTCCTGG - Intergenic
1003435962 6:6088311-6088333 GCAAGGGAGTTTGCTGTTTCAGG + Intergenic
1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG + Intergenic
1009205720 6:60798878-60798900 ACACACTTGTTTTCTGTTCCAGG + Intergenic
1009299808 6:62002205-62002227 CCAAAGGTGTTTGATATTCCTGG + Intronic
1009777344 6:68221229-68221251 GCAATGTTGTTTGCTTTGCCAGG + Intergenic
1016159316 6:140858395-140858417 GGAAAGTTGTTTGCCTTTCATGG + Intergenic
1018510345 6:164518137-164518159 GCATAGCTGTTTGTTCTTCCTGG + Intergenic
1018621610 6:165734287-165734309 GCAATGTTCTTCTCTGTTCCTGG - Intronic
1022107424 7:27206376-27206398 GCAAGGTCGTTTTCTGTTTCTGG + Intergenic
1024204512 7:47145497-47145519 AGAAAGTAGTTTGCAGTTCCAGG + Intergenic
1027625204 7:80535992-80536014 GTTATGTTCTTTGCTGTTCCAGG + Intronic
1028613710 7:92740260-92740282 GCAATGCTATTTGCTTTTCCTGG + Intronic
1033552679 7:142462259-142462281 GCAAAATTGTGTCCTGTTCTAGG + Intergenic
1034785240 7:153920273-153920295 GCAAAGTTCTTTCCTGTGTCCGG + Intronic
1035880033 8:3236536-3236558 GCAAAGATGTTTTCTGTTAAAGG + Intronic
1037370356 8:18170719-18170741 ACACAGTTGCTTTCTGTTCCTGG - Intronic
1040702601 8:50085751-50085773 CCAAAGATGTTTACTGTTCCAGG - Intronic
1044004590 8:86925962-86925984 CCCAAGTTGTTTGCTGCTGCTGG + Intronic
1044069926 8:87746189-87746211 AAAAAGTTGTTTGCTCTTCCTGG - Intergenic
1047004039 8:120601180-120601202 GCAAAGAGATTTGCTATTCCTGG + Intronic
1047465980 8:125114685-125114707 GCACAGTTCTTTGCTGTGCAGGG - Intronic
1047622623 8:126623349-126623371 GCAACCTTGTTTCCTGTTTCTGG + Intergenic
1048576571 8:135695101-135695123 GCAAAGTTGATAGGTGTTCTGGG - Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1051594001 9:18805817-18805839 TCAAACCTGTTTGCTGTTCGTGG + Intronic
1053035609 9:34824739-34824761 GACAGGTTGTTTGCTGTTTCTGG + Intergenic
1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG + Exonic
1203610780 Un_KI270749v1:591-613 GGACAGTTGTTGGCTGTTGCTGG + Intergenic
1188188591 X:27146327-27146349 CCAAAGTTGTTTGCTTTTTTTGG + Intergenic
1189651618 X:43195982-43196004 GCAATGTTGTTTCATGTTTCAGG + Intergenic
1189854632 X:45211286-45211308 TCAAAATTGTTTGTTTTTCCTGG - Intergenic
1193162313 X:78241402-78241424 GCACAGCTTTTTGATGTTCCAGG + Intergenic
1194812653 X:98404960-98404982 CCAAAGTTGTTTTCTGTTGCTGG + Intergenic
1202089542 Y:21175546-21175568 GCAAAGTGGGTTGCTGCTGCTGG + Intergenic