ID: 1101017878

View in Genome Browser
Species Human (GRCh38)
Location 12:100520450-100520472
Sequence GATTTTGGCAGAAAAGCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101017878_1101017887 24 Left 1101017878 12:100520450-100520472 CCGGTTGCTTTTCTGCCAAAATC 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1101017887 12:100520497-100520519 ACCTCAGGACTGTTGGCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 194
1101017878_1101017883 -4 Left 1101017878 12:100520450-100520472 CCGGTTGCTTTTCTGCCAAAATC 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1101017883 12:100520469-100520491 AATCAAGAAGATGGGGACTCAGG 0: 1
1: 0
2: 0
3: 17
4: 216
1101017878_1101017884 9 Left 1101017878 12:100520450-100520472 CCGGTTGCTTTTCTGCCAAAATC 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1101017884 12:100520482-100520504 GGGACTCAGGAAGCCACCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 222
1101017878_1101017885 17 Left 1101017878 12:100520450-100520472 CCGGTTGCTTTTCTGCCAAAATC 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1101017885 12:100520490-100520512 GGAAGCCACCTCAGGACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101017878 Original CRISPR GATTTTGGCAGAAAAGCAAC CGG (reversed) Intronic
900904445 1:5543174-5543196 GATTTTGCAACAAAAGCAATAGG + Intergenic
901115007 1:6836503-6836525 CATTTGGGGAGAAAAGAAACTGG + Intronic
901576354 1:10204288-10204310 GATTTTGCCAGAAATGAAATTGG + Intergenic
901611281 1:10500425-10500447 GTCTTTGGCAGACAGGCAACCGG - Intronic
902857333 1:19217877-19217899 GATTATGGCAGAGAAGGAAGAGG - Exonic
902875573 1:19338915-19338937 GAAATTGACAGAAAAGCACCTGG + Exonic
903820649 1:26100036-26100058 GATTTGGGCATAAAAGCAACAGG - Intergenic
905287472 1:36891014-36891036 GATGTTGGCAGAAAATCGAAAGG + Exonic
905453921 1:38074634-38074656 GATTTTGCCCCAAAAGCATCTGG + Intergenic
907896401 1:58696895-58696917 GATTTTATCAAAAAACCAACTGG + Intronic
907958894 1:59259948-59259970 GATTGGGGAAGAAAATCAACAGG - Intergenic
908370949 1:63476670-63476692 GATTCAGGGAGAAAAACAACAGG + Intronic
910077377 1:83297362-83297384 ATTTTTAGCAGAAAAGCAATAGG + Intergenic
910130806 1:83902987-83903009 GAATTTGGCAGAATAGAAATAGG - Intronic
910633377 1:89380510-89380532 GAAGGTGTCAGAAAAGCAACTGG + Exonic
913447637 1:118966646-118966668 CATTTTAGCAGGAAAGCAACAGG + Intronic
914954694 1:152150877-152150899 GATTTTGGCAGACAAAGATCAGG + Intergenic
915037830 1:152943537-152943559 GATGTTGGCAGAAAGGCACTGGG - Intergenic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
917189099 1:172394726-172394748 GAGTCTGGCAGAGAAGCCACTGG + Intronic
917480494 1:175407419-175407441 GAACTTGGAAGAAAAGCACCTGG - Intronic
918352431 1:183671015-183671037 GATTATGGCAGAAGAGGAAGGGG + Intronic
918694036 1:187520567-187520589 GATTTAGGCAGGAAAGCAGATGG + Intergenic
919353640 1:196493525-196493547 TATTGTGTCACAAAAGCAACAGG + Intronic
920062113 1:203234092-203234114 GGTCTTAGCAGGAAAGCAACAGG - Intronic
921243614 1:213213332-213213354 GCTTTTGACAGAAGAGCAAAGGG - Intronic
923042434 1:230328867-230328889 GATTTCGAAAGAAAAGCAAAAGG + Intronic
924517720 1:244780313-244780335 GATTTTGTCAGCAATGCAAAGGG - Intergenic
1065037425 10:21654002-21654024 GAGTTTGGAAGAAAACTAACAGG + Intronic
1065803228 10:29371391-29371413 GATTTTGGGAGAAAAAAGACAGG + Intergenic
1066598415 10:37077610-37077632 CTTTTTAGCAGAAAAGGAACGGG - Intergenic
1067755963 10:49005538-49005560 AACTTTGGCAGAAAAACACCCGG + Intergenic
1071704681 10:87984464-87984486 GATCTTAGCAGAAAAGCATCTGG - Intergenic
1074913979 10:117938243-117938265 AATCATGGCAGAAAAGCAAGGGG - Intergenic
1077058389 11:607068-607090 GAGTTTCGCTGAAAAGAAACTGG - Exonic
1079695653 11:23479152-23479174 CATTTTGGAAGAAAATCCACTGG - Intergenic
1079928342 11:26524726-26524748 GTTTTTGGATGAAAAGCAAGGGG - Intronic
1080267386 11:30415787-30415809 GATTTTGGTATAAAAGCAAATGG - Intronic
1085158175 11:74315347-74315369 AACTTTGGCAGAAACACAACAGG + Intergenic
1087422374 11:97945758-97945780 TATCTTTGCAGAAAATCAACTGG + Intergenic
1088438326 11:109840467-109840489 GATTCTGGGAGACAAGCATCAGG + Intergenic
1089634258 11:119802198-119802220 GGGTTTGGCATAAAAGCATCAGG + Intergenic
1090194692 11:124804706-124804728 GGATTAGGCAGAAAACCAACTGG - Intergenic
1090919504 11:131195683-131195705 CTTTTTGGCAGAAAAGATACTGG + Intergenic
1091019840 11:132089084-132089106 AACTTTAGCAGAAAAGCACCTGG - Intronic
1091038583 11:132255839-132255861 GAGCTTGGAAGGAAAGCAACAGG - Intronic
1093853086 12:24065013-24065035 TATTTTGGAATAAAAGCATCTGG - Intergenic
1094063232 12:26337012-26337034 CATTTAGGCAGAAAAGAAAGAGG + Exonic
1095361658 12:41348788-41348810 GATATTGACAGAGAAGCTACTGG + Intronic
1095596486 12:43964882-43964904 GAATTTCGAAGAAAAGGAACAGG + Intronic
1096011138 12:48216426-48216448 TATTTTGCCAGAGAGGCAACTGG - Intergenic
1097927791 12:65149193-65149215 AATTTTTGCACAAAAGCCACTGG + Intergenic
1101017878 12:100520450-100520472 GATTTTGGCAGAAAAGCAACCGG - Intronic
1102858217 12:116313323-116313345 GAGTTTGGCAGAACATAAACTGG - Intergenic
1103492689 12:121335129-121335151 TATTTTGGGAGAAAAGAAAAGGG - Intronic
1104282419 12:127390093-127390115 GATTTCGTTAGACAAGCAACAGG - Intergenic
1105255427 13:18741325-18741347 AATTTAGGCAGAAAATCAAGCGG + Intergenic
1105693933 13:22870078-22870100 GAGTTTGGCAGAGAAGAAAGAGG + Intergenic
1108068552 13:46603998-46604020 AATTCTGGCACAAAAACAACTGG - Intronic
1109226519 13:59702768-59702790 GATTAGGTCAGAGAAGCAACAGG - Intronic
1109274616 13:60290100-60290122 AATTTTAGAAGAAAAGAAACAGG - Intergenic
1109398804 13:61797261-61797283 GATTTTTACAGAAAAGTATCTGG + Intergenic
1109788098 13:67208710-67208732 GAATATGACAGAAAAGCAGCAGG + Intronic
1110142236 13:72144600-72144622 GATTTTGGTGGAAAACCAGCAGG + Intergenic
1111462447 13:88563431-88563453 GATTTTGGTAGAGAATAAACTGG + Intergenic
1111483156 13:88859166-88859188 GATTCTGTCAGAAAAGAAAATGG - Intergenic
1113294702 13:108946279-108946301 GATTTTGGCAAAAAAAAAAGGGG + Intronic
1113677942 13:112221293-112221315 GCATTTTACAGAAAAGCAACAGG + Intergenic
1116277440 14:42853813-42853835 GAATGGGGCAGAAAAGGAACAGG - Intergenic
1118365445 14:65091497-65091519 GATGCTGGCAGAAAAGTAGCAGG - Intronic
1119151399 14:72363058-72363080 CATATTGGCAGAACAGCCACAGG + Intronic
1119521732 14:75291307-75291329 GAGTTTGCTAGATAAGCAACTGG - Intergenic
1120051610 14:79873633-79873655 AATTTAGGTAGAAAAGCAAAAGG - Intergenic
1120150302 14:81025023-81025045 GAGCTTAGCACAAAAGCAACAGG + Intronic
1120568155 14:86084948-86084970 GATTTAGGAAGAAAAGAAAAAGG - Intergenic
1122309592 14:100786074-100786096 AATTTTGCCAAAAAAGCAAGGGG - Intergenic
1122421778 14:101582308-101582330 GATTTTGGCAGAACAGAAAATGG + Intergenic
1122953672 14:105060173-105060195 GATCTTGGCAGAGCAGCAGCTGG - Intronic
1125158276 15:36614340-36614362 CAGTTTGGCAAAAAAGCCACAGG - Intronic
1128028478 15:64460015-64460037 GCTTTGGGGAGAAAAGCAAGTGG + Intergenic
1128941650 15:71792295-71792317 GATTTGGGCAGAGGAGCAACAGG + Intergenic
1129555286 15:76501835-76501857 GATTTGTGCAGGAGAGCAACTGG + Intronic
1130314017 15:82779691-82779713 GATTTTGGCAAAGATGGAACTGG - Intronic
1130674330 15:85938835-85938857 GATGTTGAGAGAAAAGCAACTGG + Intergenic
1131343947 15:91628780-91628802 GCTATTGGCAAAAAAACAACAGG - Intergenic
1132682630 16:1149441-1149463 GATTCTGGCAGACCAGCCACGGG + Intergenic
1134838083 16:17378733-17378755 GACTGAGGCAGAAAAGTAACTGG + Intronic
1136267536 16:29130349-29130371 GAATTTGACAGAAAAGGAAATGG - Intergenic
1138107094 16:54293416-54293438 GATTTGGGCAAAAATACAACTGG + Intergenic
1142070837 16:88090691-88090713 GAATTTGACAGAAAAGGAAACGG - Intronic
1142103648 16:88290351-88290373 GTTTTTGGCAGAAAAGGAGTGGG + Intergenic
1143279438 17:5741285-5741307 GAATATGGCAGAGAATCAACTGG + Intergenic
1143964388 17:10746354-10746376 GATCTTTGCTGGAAAGCAACTGG - Intergenic
1146582807 17:34054190-34054212 GATTATGACAGAGAAGCAATGGG - Intronic
1146914400 17:36669173-36669195 GTTGTTGTCAGAAAAGCAGCAGG - Intergenic
1150138411 17:62708703-62708725 GATTTTGCCAGATAAGGAAGTGG - Intronic
1151237174 17:72729202-72729224 GATTGAGGCAGGAAAGAAACAGG - Intronic
1152165550 17:78702702-78702724 GATTTATCCAGGAAAGCAACAGG + Intronic
1154435588 18:14339279-14339301 AATTTAGGCAGAAAATCAAGGGG - Intergenic
1156127878 18:33929331-33929353 GATATTGACAGAAAAGCTAGAGG - Intronic
1156245208 18:35290942-35290964 CATTCTGAGAGAAAAGCAACTGG + Intergenic
1156387155 18:36615891-36615913 GATCTTGGGAGAGAAGAAACTGG + Intronic
1156702745 18:39843812-39843834 CAATTGGGCAGGAAAGCAACTGG - Intergenic
1157041220 18:44041761-44041783 GATCTGGGAAGAAAAGGAACAGG - Intergenic
1158369336 18:56780859-56780881 TATTTTGGCAAAAATGCCACAGG - Intronic
1163430811 19:17266239-17266261 GAACTTGCCAGAAAAGCAACAGG + Intronic
1164915503 19:32048660-32048682 GATTTCAACAGAAAAGCAAGAGG + Intergenic
925285400 2:2712424-2712446 GATGTTGGCAGAACAGCAGCTGG - Intergenic
925866924 2:8236242-8236264 GATTAAGGAGGAAAAGCAACAGG - Intergenic
927417818 2:22897306-22897328 GAGATTGCCTGAAAAGCAACTGG + Intergenic
929931707 2:46262178-46262200 ATTTTTGGCAGGACAGCAACTGG + Intergenic
930420995 2:51152631-51152653 GTTTTTGACAGGAAAGCAGCTGG + Intergenic
932114263 2:69031799-69031821 GATTTTTGCAGCAAGACAACTGG - Intronic
937101783 2:119276955-119276977 TATTTTGACATAAAAGCAAAGGG + Intergenic
939296961 2:140278905-140278927 GATTTTCACAGAAAGGCAATGGG - Intronic
940825531 2:158407602-158407624 AATTTTGGCAGTACAGCATCCGG + Intronic
947385003 2:229582317-229582339 GATTTTGTAAGAGAAGCAGCTGG + Intronic
947768197 2:232650945-232650967 GATGTTGGCAGAGAAGGAGCTGG + Intronic
948068132 2:235097416-235097438 GCTAATGGCAGAAATGCAACTGG + Intergenic
948190785 2:236056871-236056893 GGATTTGGCAGAAAAGGAACAGG - Intronic
948735093 2:239998410-239998432 GCTTTTGGCAGAAAAACTTCAGG - Intronic
1169831875 20:9834413-9834435 GATTTTGACAGAAACACACCAGG + Intronic
1171298090 20:24036285-24036307 TATTTTGGTAGAGAAGCCACTGG - Intergenic
1171900695 20:30853562-30853584 GACTCTGGCAGATAAGCAGCTGG - Intergenic
1172011669 20:31849358-31849380 GAATATGGCACAAAAGCACCAGG - Intronic
1172224998 20:33299542-33299564 GACTTTGGCATAAAACCGACTGG + Intronic
1173360075 20:42335688-42335710 GAAATTGGCAGAAAAGAAAAGGG + Intronic
1173945716 20:46949280-46949302 GATTTTCCCATAAAAGGAACCGG - Intronic
1174301889 20:49588393-49588415 GCTCTTGCCACAAAAGCAACTGG - Intergenic
1176841444 21:13846354-13846376 AATTTAGGCAGAAAATCAAGGGG + Intergenic
1178145184 21:29731212-29731234 AGTTTTCGCAGAAAAGCACCTGG - Intronic
1179251149 21:39672836-39672858 GATTTCGGAAGCAAAGCAATGGG + Exonic
1180320979 22:11321200-11321222 GACTCTGGCAGATAAGCAGCTGG + Intergenic
1180334064 22:11559545-11559567 GACTCTGGCAGATAAGCAGCTGG - Intergenic
1184829449 22:46974956-46974978 GATTTCTGTAGAAAAGCCACAGG + Intronic
949229683 3:1736046-1736068 GATTTGGACAGAAAGGCAAAAGG + Intergenic
949374215 3:3368977-3368999 GATTTTTGCAGAAGAAAAACTGG - Intergenic
951724003 3:25735225-25735247 GATTTTTGAAGAGAAGAAACTGG - Intronic
952190611 3:31019092-31019114 GGTGATGGCAGAAATGCAACAGG + Intergenic
953823711 3:46232326-46232348 GATTTTGTTGGAAAAGCACCTGG + Intronic
957724922 3:84051584-84051606 TACTTTGAAAGAAAAGCAACAGG - Intergenic
958982517 3:100739464-100739486 GATGTTGCCAGAAATGTAACTGG + Intronic
960398282 3:117164405-117164427 AATTTTTACCGAAAAGCAACTGG + Intergenic
960808710 3:121608526-121608548 GACTCTGGCAGACAAGCAGCTGG + Intronic
960969902 3:123131888-123131910 GATTGTGGAGGAAAAGCAAGAGG + Intronic
962225057 3:133599004-133599026 AATTTTGGCAGAAAAGAAAGTGG + Intronic
967402459 3:189079082-189079104 AATTATGGCAGAAAAGGAAAGGG + Intronic
971776369 4:30971339-30971361 AATTCTGGCAGCAAAGCAATAGG + Intronic
972734011 4:41822540-41822562 GATTTGGGAAGAAATGCACCTGG + Intergenic
973031656 4:45349576-45349598 ATTTTTGGTAGAAAAGCAAAAGG - Intergenic
974911805 4:68132253-68132275 GAATTTAACAGAAAAGTAACAGG + Intergenic
976768593 4:88625218-88625240 AATTTTGGAAGAAAAGCTACTGG + Intronic
977389228 4:96386439-96386461 AATTGTGGCAGAAAACCAACAGG - Intergenic
977427875 4:96891910-96891932 GATTTTGGCAGATTTGAAACAGG - Intergenic
977800251 4:101220369-101220391 GGTTTTGGTAAAAAAGGAACAGG - Intronic
978668277 4:111212665-111212687 ATTTTGAGCAGAAAAGCAACAGG - Intergenic
981039198 4:140207098-140207120 GCTTTTTACAGAAAAGGAACAGG - Intergenic
981392767 4:144211150-144211172 TATTTTGGAAGCAAATCAACAGG - Intergenic
981495534 4:145387590-145387612 TATTTTGGCAGTAAACAAACAGG - Intergenic
982930627 4:161402773-161402795 GATGTTGTCAGAAAAACAAATGG - Intronic
983576414 4:169266033-169266055 GACTTTGGCCTAAAACCAACAGG + Intronic
984876109 4:184369136-184369158 CATATGGGCAGAAAAGCAAGCGG - Intergenic
987757050 5:22110010-22110032 TAATTTGGCAGAAAAGGGACTGG + Intronic
988013098 5:25515867-25515889 GATTTTGGTAGAAAAGCATAAGG + Intergenic
988909162 5:35822455-35822477 GAACATGGCAGAAAAGCTACTGG - Intergenic
990072712 5:51805056-51805078 GATTTTGGAAAAAAAGTAAGAGG + Intergenic
990133538 5:52617569-52617591 GATTTTGTGAGAAAGGAAACTGG - Intergenic
990656091 5:57957212-57957234 GATTGTGGCAGAAAATCCAGGGG - Intergenic
990901742 5:60758437-60758459 AATTTTGGCAGTAAAACCACTGG + Intronic
991959224 5:72026621-72026643 GCTTTTGTCAAAAAATCAACTGG - Intergenic
992299725 5:75365970-75365992 GATAGTGGCAGATAAGCAAGGGG - Intergenic
993641015 5:90405717-90405739 GATTATGACAGAGAAGCCACAGG - Exonic
994201559 5:96982606-96982628 GATTTTGGAAGAGAAGCATAAGG - Intronic
997779936 5:136646596-136646618 GAAATTCTCAGAAAAGCAACTGG - Intergenic
998929828 5:147169023-147169045 GAGTTAGGAAGAAAAGCAAGAGG - Intergenic
1001002294 5:168019053-168019075 GATTTTGGCAGAAGGGAAAGAGG + Intronic
1003643408 6:7894731-7894753 GATTTTGGCAGCCCAGCATCTGG - Intronic
1005355672 6:24981103-24981125 GAGTTTGGATGAAAACCAACAGG + Intronic
1009221831 6:60992536-60992558 GGTTTTGGCAGAAAATGAAAAGG + Intergenic
1009423417 6:63488110-63488132 TATCTTGTCAGAAAAGCAGCTGG - Intergenic
1009429240 6:63548031-63548053 GATGTGGGCAGAAAAGAAACAGG - Intronic
1009508462 6:64517356-64517378 GATTTTGGTAAATAAGCAATAGG + Intronic
1009658528 6:66578231-66578253 TGTTTTCTCAGAAAAGCAACAGG - Intergenic
1009930242 6:70168731-70168753 AATTTTGAAAGAAAAGCATCGGG + Intronic
1010410726 6:75558575-75558597 CATTTTGGCTGAAAAGCAGATGG + Intergenic
1011049072 6:83123984-83124006 GATTTTAGCAGATAGGCAAGGGG - Intronic
1012254921 6:97020478-97020500 CATTTTGTCAGAAAGGCAATGGG + Intronic
1012386211 6:98686105-98686127 GTTTTTGGTAGAGAAGCAAGAGG - Intergenic
1012715897 6:102669350-102669372 GATTCTTGGAGAAAAGGAACTGG - Intergenic
1013766639 6:113581629-113581651 GATCTTTGCTGGAAAGCAACTGG + Intergenic
1016901414 6:149106731-149106753 GAGTCTGGCACAAAACCAACTGG - Intergenic
1018348740 6:162932486-162932508 GAATTTAGCAGTGAAGCAACTGG + Intronic
1018349944 6:162946527-162946549 GAATTTGGCAGTAAAGCCTCAGG - Intronic
1018615053 6:165679328-165679350 GATACTGGCAGAAAAGCAGTAGG + Intronic
1022081367 7:27025049-27025071 CAGTTTGGCAAAAAAGAAACAGG - Intergenic
1022656827 7:32327120-32327142 GATTTTGGCAGTACAGCCAATGG - Intergenic
1024292538 7:47815153-47815175 GGTTCTGGCAGGAAAGGAACAGG + Intronic
1025972368 7:66339390-66339412 GAATTTAGCAGTGAAGCAACAGG - Intronic
1028202697 7:87980780-87980802 AATTTTGACAAAAAAGAAACTGG - Intronic
1028213207 7:88100919-88100941 GGTTTTGGTAGGAAAGCACCTGG + Intronic
1031114883 7:117656718-117656740 GATTGTGGCAGAATAGGATCAGG + Intronic
1031470855 7:122167591-122167613 GTTTCAGGCAGAAAAGCAACAGG - Intergenic
1032143431 7:129355921-129355943 CTTTTTGGCAGAAAAGTACCAGG + Intronic
1034442772 7:151095379-151095401 GGTTCTGGCAGAAAAGGAACAGG - Intronic
1037244057 8:16811343-16811365 GATTCTGTGATAAAAGCAACAGG + Intergenic
1037448715 8:18995342-18995364 GATCTTTGCAAAAAAGCTACTGG - Intronic
1037509179 8:19564211-19564233 GATTTTGTTTGAAAATCAACGGG - Intronic
1037875045 8:22540559-22540581 CAATTAGGCAGCAAAGCAACAGG - Intronic
1038260967 8:25993570-25993592 GAGTGTAGCAGAAATGCAACTGG - Intronic
1040948502 8:52911156-52911178 GATTTTGGCAGTAATGGGACTGG - Intergenic
1041184862 8:55288356-55288378 GATGTTGCCAGAAAAGTAAGGGG + Intronic
1043773761 8:84238635-84238657 GAGCTTGGCAGAGAAGCAAGGGG + Intronic
1044925368 8:97204500-97204522 TATTTGGACAGAAAAGCTACAGG - Intergenic
1047844522 8:128791614-128791636 GATTTTGCTAGGAAAGCAAAAGG + Intergenic
1048171473 8:132110657-132110679 GATTTTGGCAGCAAACAGACTGG - Intronic
1050195765 9:3082205-3082227 TATTTTGGGGGAAAAGTAACAGG - Intergenic
1050338684 9:4614372-4614394 TAAGTTAGCAGAAAAGCAACAGG + Intronic
1052166625 9:25338786-25338808 GAATTTAACAGAAAAGTAACAGG + Intergenic
1052220464 9:26016024-26016046 GTTTTTGGAAGAAAAGCAATAGG - Intergenic
1052791671 9:32880692-32880714 GAGTTTGGCAGAAAAACCATGGG + Intergenic
1052861440 9:33440189-33440211 GACTTGCCCAGAAAAGCAACGGG - Intergenic
1054828743 9:69599953-69599975 GATATTTGCAGAAACGCTACCGG - Intronic
1057873116 9:98732929-98732951 GGTTTAGGCAGAAAAGAAAAAGG - Exonic
1059595468 9:115715457-115715479 GATTTATGCAGAAGAGTAACAGG + Intergenic
1187179910 X:16934433-16934455 AATCTTGGCAGTAAACCAACAGG + Intergenic
1189884468 X:45526694-45526716 GATTTTAGCAGAACAACAAATGG + Intergenic
1190484709 X:50912973-50912995 GATTTAGGCAGAGGAACAACAGG + Intronic
1193822799 X:86186974-86186996 AATTTGGGTAGAAAAGAAACGGG + Intronic
1195739582 X:108050071-108050093 GCTTCTGGCAGGAAAGCAGCTGG + Intronic
1198744890 X:139879768-139879790 GACTTTGGCATAGAGGCAACTGG + Intronic
1199564950 X:149205993-149206015 GATTTTGTCCTAAAAGCAAAGGG - Intergenic
1199574934 X:149304890-149304912 GATTTTGGAAGAAAAACAAGAGG - Intergenic
1200906135 Y:8484767-8484789 AATGTAGGCAGAGAAGCAACTGG + Intergenic