ID: 1101021402

View in Genome Browser
Species Human (GRCh38)
Location 12:100557969-100557991
Sequence CACCACGATTCTCCATCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101021400_1101021402 27 Left 1101021400 12:100557919-100557941 CCATAAGTCACATCACAGGTTTT 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1101021402 12:100557969-100557991 CACCACGATTCTCCATCCAATGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101021402 Original CRISPR CACCACGATTCTCCATCCAA TGG Intronic
901226795 1:7617811-7617833 GACCCCGATTCTCCATTCACTGG - Intronic
901507092 1:9691659-9691681 CTCCCCGACTCTCCAGCCAAAGG + Intronic
903845488 1:26277600-26277622 CACCTTTCTTCTCCATCCAATGG + Exonic
905660120 1:39715505-39715527 AGACACAATTCTCCATCCAAAGG - Intronic
916102627 1:161406126-161406148 CACCACGGTTCCCTATCCCAGGG - Intergenic
916522957 1:165581643-165581665 CACCATGGTTCCCCATCCCAGGG - Intergenic
917549672 1:176012173-176012195 CACCACTGTTCTCCAACCTATGG - Intronic
919548080 1:198949060-198949082 CACCGCGGTTCCCCATCCCAGGG - Intergenic
922614021 1:226950350-226950372 AACCTCCATTCTCCATCCATTGG - Intronic
1079058562 11:17228317-17228339 CACCGCGGTTCCCCATCCCAGGG - Intronic
1079273756 11:19013813-19013835 CACCACAGGTATCCATCCAAAGG - Intergenic
1079698996 11:23520363-23520385 CACCACACTTCCCCATCCCAGGG - Intergenic
1079941828 11:26690152-26690174 CACCACCACTCCCCATCCCATGG - Intronic
1084213430 11:67634265-67634287 CACCCCGACTCGCCAGCCAAGGG - Exonic
1085471973 11:76764244-76764266 CACCATGATTCAGCAACCAAGGG + Intergenic
1098301467 12:69058637-69058659 CACCAGCAGTATCCATCCAATGG + Intergenic
1098733464 12:74066887-74066909 CACCACAAAACCCCATCCAAAGG + Intergenic
1100005399 12:89889510-89889532 CACCTCCATTCTCCTTCCAGCGG - Intergenic
1101021402 12:100557969-100557991 CACCACGATTCTCCATCCAATGG + Intronic
1103107828 12:118246131-118246153 CACCGCGGTTCCCCATCCCAGGG - Intronic
1104549788 12:129745926-129745948 CTCCAGGATTCTCCTTCCGAAGG - Intronic
1107440989 13:40426936-40426958 CACCACCATGCTCCATCAAAGGG + Intergenic
1108263094 13:48678023-48678045 CACCACATTTCTCCATACCAAGG + Intronic
1113582817 13:111440731-111440753 CCCCACTTTACTCCATCCAAAGG + Intergenic
1118098396 14:62566046-62566068 CACCTCTATATTCCATCCAATGG - Intergenic
1118347972 14:64953513-64953535 TCCCACGCTTCTTCATCCAAGGG + Intronic
1122167490 14:99839570-99839592 CACCACCATTATCCAACCTAAGG + Intronic
1122912294 14:104836806-104836828 CACCACGGTTCCCCATCCCAGGG + Intergenic
1132482908 16:175509-175531 CACCTCCATTCTCCAACCACAGG + Intergenic
1132838049 16:1964556-1964578 CACCGCGGTTCCCCATCCCAGGG + Exonic
1141366633 16:83449652-83449674 CACCATGATTATTCATCCCATGG - Intronic
1144814232 17:18022148-18022170 CACCTGGAATCTCCATCAAAAGG + Intronic
1147245311 17:39116418-39116440 CACAAGGATTCTGCAGCCAATGG + Intronic
1149283309 17:55132231-55132253 CACCACTATACTCCATCCTGGGG - Intronic
1151575200 17:74949661-74949683 CACCACGATCCGCAAGCCAAGGG + Exonic
1157697386 18:49733628-49733650 GATCACCATTCTCCATCCATGGG - Intergenic
1159992910 18:74930882-74930904 AACTACCATTCTCCAGCCAAAGG - Intronic
1160578724 18:79871655-79871677 CACCACCAGTCTCCACCCAGGGG + Intronic
1161167174 19:2794564-2794586 CACCTCCTTTCTCCATCCCAGGG + Intronic
1166878621 19:45913615-45913637 CCCCACGGCTCTCCATCCACAGG + Exonic
932008827 2:67955007-67955029 CTCCACAATTGTCCATCCAATGG + Intergenic
938224185 2:129601750-129601772 CCCCACAATACTCCATCCAAAGG - Intergenic
947311460 2:228808484-228808506 CACCACAAATCCCCATCCAAAGG - Intergenic
1169252687 20:4072428-4072450 CTCCAGGTTTCTCCATCCTATGG - Intronic
1173769035 20:45641301-45641323 CACCGCGGTTCCCCATCCCAGGG + Intergenic
1176008570 20:62880010-62880032 CACCAAGATTCACAAACCAAAGG - Exonic
1180217717 21:46336414-46336436 CACCACCATACTCCAGCCCAGGG - Intronic
1181235735 22:21446790-21446812 CACCTCGCTTCTCCTTCCATGGG - Exonic
952943589 3:38460916-38460938 CTCCTCCATTCTCCAGCCAAGGG - Intronic
954113283 3:48447857-48447879 TAGCACGACTCTCCATCCAGTGG + Intronic
962587336 3:136855394-136855416 CTCCAGGTTTCTCCATCTAATGG - Exonic
965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG + Intronic
967064109 3:185899178-185899200 CACCATGATTCTTCAGCAAAGGG - Intergenic
976269667 4:83218297-83218319 CTCCACGATTCTCAGTCCACTGG + Intergenic
980771927 4:137384923-137384945 CACCACTACACTCCAGCCAAGGG - Intergenic
981317027 4:143350048-143350070 CACCGCGGTTCCCCATCCCAGGG + Intronic
983028678 4:162770922-162770944 CACCACCAGTCTTCATCCAAGGG - Intergenic
983872740 4:172841024-172841046 CTCCACCATTCTCCTTCCATAGG + Intronic
984936021 4:184890000-184890022 CTCCACTTTTCTCCATCCCAAGG + Intergenic
985992969 5:3578402-3578424 CACCAGGAGTTTCCATCCCAGGG + Intergenic
987105788 5:14637639-14637661 CAGCAAGATTCTCCCTCCCATGG + Intergenic
987615798 5:20272850-20272872 CACTATTATTCTCCATCAAAGGG + Intronic
990647254 5:57858460-57858482 CAGGACGAGTCTCCATCCCAAGG + Intergenic
995184576 5:109258587-109258609 CACCACGATTCTGATTTCAACGG + Intergenic
996928393 5:128856626-128856648 TACCACTATTCTCCATTCCAAGG + Intronic
1003928232 6:10897449-10897471 CACCACTATTCTCCAGCCTGGGG - Intronic
1004640161 6:17507293-17507315 CACCACAGCTATCCATCCAAGGG - Exonic
1006392495 6:33766664-33766686 CACCATGGTGCTCCATCCCAGGG + Intergenic
1007643588 6:43363490-43363512 CACCACGGTTTCCCATCCCAGGG - Intronic
1007669491 6:43539634-43539656 CACCGCGGTTCCCCATCCCAGGG + Intronic
1011187606 6:84696321-84696343 CAACACGATTTTGCCTCCAATGG - Intronic
1012517562 6:100080301-100080323 CAATACCATTCTCCCTCCAAAGG - Intergenic
1015397089 6:132746942-132746964 CATCATGATGCTCCCTCCAAGGG + Intronic
1017577343 6:155819443-155819465 CAGAAGGATTCTGCATCCAAGGG - Intergenic
1017586017 6:155923846-155923868 CAGCACAATTCTCTACCCAATGG - Intergenic
1018729509 6:166637936-166637958 AACCACGATTCCTCATCCAGGGG - Intronic
1021503702 7:21357414-21357436 CAGCACCATTCTCTGTCCAAAGG - Intergenic
1029423676 7:100484146-100484168 CATCCCCCTTCTCCATCCAAGGG - Intronic
1047310603 8:123688540-123688562 CCCCAGGAATCTCCCTCCAAGGG + Intronic
1049321634 8:141999889-141999911 CACCATGACACTCCACCCAAGGG + Intergenic
1050630212 9:7550191-7550213 CCCCACAAAACTCCATCCAAGGG + Intergenic
1057149308 9:92782310-92782332 GACCTGGATTCTCCATTCAAAGG - Intergenic
1058023699 9:100117564-100117586 CACCGCGGTTCCCCATCCCAGGG + Intronic
1059795041 9:117685279-117685301 CACATGAATTCTCCATCCAATGG + Intergenic
1189429743 X:40935794-40935816 CACCGCGGTTCCCCATCCCAGGG + Intergenic
1195943054 X:110180849-110180871 CACTTCCCTTCTCCATCCAAGGG + Intronic