ID: 1101022248

View in Genome Browser
Species Human (GRCh38)
Location 12:100565144-100565166
Sequence CAGGAGCAACAGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1470
Summary {0: 1, 1: 0, 2: 15, 3: 135, 4: 1319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101022239_1101022248 15 Left 1101022239 12:100565106-100565128 CCAGGTAGGAGGGAAGGGGTTCA 0: 1
1: 0
2: 2
3: 30
4: 450
Right 1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG 0: 1
1: 0
2: 15
3: 135
4: 1319
1101022232_1101022248 30 Left 1101022232 12:100565091-100565113 CCAAATTCAGTGGGTCCAGGTAG 0: 1
1: 0
2: 0
3: 16
4: 94
Right 1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG 0: 1
1: 0
2: 15
3: 135
4: 1319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101022248 Original CRISPR CAGGAGCAACAGAAGGAAGG TGG Intergenic
900149108 1:1170566-1170588 CCTGAGCAAAAGAAGGAGGGAGG - Intergenic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900863039 1:5246348-5246370 AAGGAACAAGGGAAGGAAGGAGG - Intergenic
901176474 1:7303051-7303073 CAGCAGCACCAAGAGGAAGGCGG - Intronic
901185288 1:7368955-7368977 CAGAAGCAGAAGGAGGAAGGTGG - Intronic
901531734 1:9858004-9858026 CCTGAGCAACAGGAGGATGGAGG - Intronic
901565725 1:10113196-10113218 CAGGAGCAACAGAGAGGAGGAGG + Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902359769 1:15936002-15936024 CAGGAGCAGGGGCAGGAAGGGGG - Exonic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
902939688 1:19791760-19791782 CAGGAGTCACTGACGGAAGGAGG + Intronic
902996037 1:20225897-20225919 CAGGAGGAAGAGAAAGAAGGGGG + Intergenic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903470426 1:23583046-23583068 CCGGAGTGACAGAAGTAAGGTGG - Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903647274 1:24902908-24902930 CAGCAGCAACAGAACAGAGGAGG + Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903670320 1:25031454-25031476 CTGGAGCAATACAAGGATGGAGG + Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904591155 1:31616308-31616330 CTGGAGCAGCATAAGGGAGGGGG - Intergenic
904681489 1:32232530-32232552 CATGAGCCAAAGAAAGAAGGCGG + Intergenic
904718135 1:32484738-32484760 CAGGGGGAAGAGAAAGAAGGGGG - Intronic
904728285 1:32567197-32567219 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
904824374 1:33265140-33265162 CAGGAGAAATAGAAGTAGGGAGG + Intronic
905002112 1:34680669-34680691 CAGGAGGAATAGAAAGATGGGGG + Intergenic
905043171 1:34976851-34976873 CGCGAGCACCAGCAGGAAGGCGG + Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905993714 1:42362790-42362812 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906333592 1:44908769-44908791 CAGGAGTGGCAGAAGAAAGGGGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906794772 1:48688142-48688164 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907448022 1:54521808-54521830 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907793383 1:57690443-57690465 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
907824220 1:57999916-57999938 AAGAAGGAAAAGAAGGAAGGAGG + Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
907936743 1:59048510-59048532 CAGGAGCAAGAGAGGGAGTGGGG - Intergenic
908256669 1:62308897-62308919 CAGGAGAATCAGAAGTCAGGGGG - Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908531704 1:65040341-65040363 CTCGAGCCACAGAAGGCAGGTGG - Intergenic
908809422 1:67964650-67964672 CAGGAGGAAGAGAGAGAAGGTGG - Intergenic
909133310 1:71766871-71766893 CAAGAGCAAGAGAGAGAAGGGGG - Intronic
909289293 1:73861755-73861777 CAGGAGGAACAGAGAAAAGGGGG + Intergenic
909377791 1:74960038-74960060 CAGAAGCAAAAGAAAGAGGGAGG - Intergenic
909475114 1:76073631-76073653 CAGGAGTAACCACAGGAAGGAGG - Intergenic
909528703 1:76657594-76657616 CAGGAGCAACAGAGAGAGAGGGG - Intergenic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
909702564 1:78543601-78543623 CAGGAGGAAGAAAAAGAAGGGGG + Intergenic
909779071 1:79520107-79520129 GAAGAGGAAGAGAAGGAAGGAGG + Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910444033 1:87282519-87282541 CAGGAGCAACATAAGGAAGCTGG + Intergenic
910481201 1:87660298-87660320 CAGGAGCAAGAGAGAGAATGAGG + Intergenic
910891393 1:92024104-92024126 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
911015080 1:93323430-93323452 TACAAGCACCAGAAGGAAGGAGG - Intergenic
911197071 1:95005356-95005378 CAGGAGCAAGGTAATGAAGGAGG + Intronic
911636118 1:100238141-100238163 AAGGAGGGAAAGAAGGAAGGAGG - Intronic
912418411 1:109527444-109527466 CAGGAGTGACAGAAGCAAAGGGG - Intergenic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913216028 1:116621127-116621149 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
913366417 1:118044774-118044796 CGGGAGGAAGAGAATGAAGGGGG - Intronic
913380201 1:118202254-118202276 CAGGAGCAAGAGCATGAAGGGGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
916243607 1:162664031-162664053 CAGGAGTGAGAAAAGGAAGGGGG + Intronic
916556836 1:165900620-165900642 CCAGATCTACAGAAGGAAGGGGG + Intronic
916829114 1:168473342-168473364 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
916944999 1:169717613-169717635 CAGGAGCAAGAGAGGGATGTGGG + Intronic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
917365874 1:174231750-174231772 CAGGAGCAAGAGCGAGAAGGGGG + Intronic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
917747152 1:178021363-178021385 CAGGAGCCACAGCAGGGATGTGG - Intergenic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918157600 1:181864453-181864475 CAGGAGCAAGAGAAGTGGGGAGG + Intergenic
918209099 1:182335056-182335078 AAGGAGGGAAAGAAGGAAGGAGG + Intergenic
918378879 1:183935256-183935278 GAGGAGCAACATAAAGCAGGTGG - Intronic
918454021 1:184688506-184688528 CAGGAACCACAGAAGGAAGGTGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918691156 1:187480878-187480900 CAGGAACTACAGAAGGCAGAAGG - Intergenic
918846387 1:189620235-189620257 AAGGAGAAAGAGAAGAAAGGTGG + Intergenic
919232529 1:194792438-194792460 CAGGAGAGAAAGAAAGAAGGAGG + Intergenic
919344853 1:196362279-196362301 CAGGAGGAAAGCAAGGAAGGAGG - Intronic
919356111 1:196523960-196523982 CAGGTGCAAGAGAAAAAAGGAGG - Intronic
919661724 1:200254233-200254255 CCAGAGCCACAGAGGGAAGGGGG + Intergenic
919674322 1:200366408-200366430 TAGGAGCAACAGGGGGAATGGGG + Intergenic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920162604 1:204010805-204010827 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
920188270 1:204175979-204176001 GAGGAGGAGGAGAAGGAAGGAGG - Intergenic
920641920 1:207760788-207760810 CAGGAGCAGGAGGAGCAAGGTGG + Intronic
920922225 1:210307521-210307543 GAGTAGAAACAGAAGGGAGGAGG - Intergenic
921187490 1:212683060-212683082 GAGGAGGAAGAGAAGGAAAGAGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922013363 1:221615555-221615577 CAAGAGCAAGAGCATGAAGGGGG - Intergenic
922129354 1:222761620-222761642 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922171516 1:223159571-223159593 CAGCACCAACAGCAGGAAAGAGG - Intergenic
922656324 1:227387391-227387413 CGGGAGGAAGAGAGGGAAGGAGG + Intergenic
922660552 1:227426386-227426408 CAGGAGCAAGAGAGAGAGGGCGG + Intergenic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922852206 1:228742542-228742564 TAGGAGAAAATGAAGGAAGGAGG + Intronic
922944007 1:229494794-229494816 CCTGAGCAACAGAAAGAGGGTGG + Intronic
922965226 1:229684816-229684838 CATGACCAACAGAAGAAAGTAGG - Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
923743393 1:236677044-236677066 CTGGAGCTCCAGAAGAAAGGTGG + Intergenic
924217098 1:241833943-241833965 GAGGAGGGAAAGAAGGAAGGAGG - Intergenic
924313975 1:242776576-242776598 CAGGAGCAAGAGAAAGGAGAGGG + Intergenic
924481171 1:244435634-244435656 GAGGAGGAAGAGAAGGATGGAGG - Intronic
924680364 1:246224882-246224904 CAGAAGCAGAAAAAGGAAGGTGG + Intronic
924793227 1:247272292-247272314 CAGCAGCAAGAGAAAGATGGGGG + Intergenic
924836377 1:247651823-247651845 CAGGAGCAACAGAGAGAGAGCGG - Intergenic
924856142 1:247876897-247876919 GAGGAGAAACAGAATTAAGGAGG - Exonic
1063156319 10:3382291-3382313 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063917045 10:10893735-10893757 CAGGAGCAAGAGACGGACGAGGG + Intergenic
1063974305 10:11403104-11403126 GAGGAACATCAGAGGGAAGGGGG - Intergenic
1064348203 10:14552205-14552227 TGGGAACCACAGAAGGAAGGAGG + Intronic
1064526406 10:16260727-16260749 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1064837804 10:19554328-19554350 CAGGAGCAAGAGGTGGAGGGAGG + Intronic
1064999737 10:21327665-21327687 CAGAAGCAACAGGAGGAAAGAGG - Intergenic
1065247111 10:23769384-23769406 CAGGAGCAATTGAGGGGAGGGGG + Intronic
1065287466 10:24200081-24200103 CAGGAGGTAGAGAAGGAAGCAGG - Intronic
1065343992 10:24731206-24731228 GAGGAGCCACAGAAGAAAGCTGG - Intergenic
1065349610 10:24783652-24783674 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065835417 10:29653303-29653325 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1065867433 10:29926219-29926241 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1065958725 10:30716185-30716207 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066167706 10:32805974-32805996 CAGGAGCAAGAGAAAGAAGGGGG + Intronic
1066652910 10:37676355-37676377 CAAGAGAAACAGCAGGAATGAGG - Intergenic
1066674261 10:37872044-37872066 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1066728918 10:38419130-38419152 AAGGAGGAACGGAGGGAAGGAGG - Intergenic
1067084838 10:43232310-43232332 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1067099003 10:43321277-43321299 CAGGAGCAAGACAGGGAATGGGG - Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067774946 10:49156685-49156707 GGGCAGCAACAGCAGGAAGGCGG + Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068443389 10:57088955-57088977 CACGAGCAAGAGAAGAAGGGAGG + Intergenic
1068658949 10:59603676-59603698 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1068895498 10:62195479-62195501 AAGGAGAGACAGAAGGAAAGTGG + Exonic
1069038499 10:63670308-63670330 CAGGAGCCAAAGAGGGAGGGAGG - Intergenic
1069116796 10:64517098-64517120 CAGGAGCAACATAAAGATGCTGG + Intergenic
1069312066 10:67050559-67050581 CTCGAGCTACAGAGGGAAGGTGG - Intronic
1069336782 10:67360706-67360728 CAGGAGCAAGAGCAGAGAGGGGG + Intronic
1069566065 10:69464335-69464357 CACAACCCACAGAAGGAAGGTGG - Intronic
1069758180 10:70786619-70786641 GGGGAGCAAGAAAAGGAAGGTGG + Intergenic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070694033 10:78548577-78548599 AGGGAACAAAAGAAGGAAGGAGG + Intergenic
1070801784 10:79248173-79248195 CAAGAGCTATAGAAGGAAGAGGG + Intronic
1070980360 10:80640816-80640838 CAGCAGCAACAGAACAAAGCTGG - Intronic
1071119588 10:82261967-82261989 CAGGAGTAAGAGAAAGAAGGGGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071444820 10:85735992-85736014 AGGGAGCAAGGGAAGGAAGGAGG + Intronic
1071444866 10:85736169-85736191 CAGGAAGAAAGGAAGGAAGGAGG + Intronic
1071570653 10:86694947-86694969 GAGGAGAAAGAGAAGGTAGGTGG - Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1073009216 10:100346939-100346961 AAGGAGAAACAGAGGGGAGGGGG + Intergenic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073625490 10:105091553-105091575 AAGGAGGAAGGGAAGGAAGGAGG - Intronic
1074169614 10:110919598-110919620 GAGGAGGAAGAGGAGGAAGGAGG + Exonic
1074214233 10:111368795-111368817 CAGGAGCAAGAGAGTGAATGGGG + Intergenic
1074525792 10:114261978-114262000 CAGGAGCAAGAGAGAGGAGGAGG + Intronic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075393733 10:122112570-122112592 CAGGAGCCTCAGAAAGAAGCTGG - Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075742511 10:124704507-124704529 GAGTAGCCAGAGAAGGAAGGAGG + Intronic
1075974734 10:126685592-126685614 AGGGAGCAAGAGAAGGAGGGAGG - Intergenic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076001165 10:126914121-126914143 CAGGGGCTACAGAAGCAATGGGG - Intronic
1076031709 10:127164486-127164508 GAGGAGCAACAAAAACAAGGAGG - Intronic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1077003903 11:341659-341681 CAGGAGGAAGAGACAGAAGGGGG - Intergenic
1077392602 11:2307025-2307047 GAGGAGGAAGAGGAGGAAGGAGG + Intronic
1077483839 11:2829957-2829979 GAGGAGGATGAGAAGGAAGGAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078393530 11:10957059-10957081 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1078430948 11:11288057-11288079 CAGGTGGATCAGAAGGAAAGAGG - Intronic
1078461711 11:11519740-11519762 CAGGAGCAACCAGGGGAAGGAGG + Intronic
1078646745 11:13147820-13147842 CAGGAGCAAGAGAGAGAAGGAGG + Intergenic
1078771365 11:14355429-14355451 TATGAGCAACAGAAAGGAGGAGG + Intronic
1079151000 11:17899004-17899026 CAGGAGCAGGAGAGAGAAGGAGG - Intronic
1079178758 11:18169652-18169674 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1079239891 11:18714810-18714832 CTGGAGCAACACATGGGAGGGGG + Intronic
1079270076 11:18976265-18976287 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1079296958 11:19242148-19242170 TAGGAGGAAGAGGAGGAAGGCGG + Intergenic
1079739462 11:24038432-24038454 CAGGAGCAAGAGAGAGAGGGTGG + Intergenic
1079810947 11:24999356-24999378 GAGGAGGAAGAGGAGGAAGGAGG + Intronic
1080079093 11:28193390-28193412 CAGGAGGAAGAGAGAGAAGGTGG + Intronic
1080640251 11:34154491-34154513 CAGGAGTATCAGAAGGTAGTGGG - Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081095262 11:38924939-38924961 AGGGAGCAAGAGAAGGAAGAAGG - Intergenic
1081132945 11:39402845-39402867 AAGGAGGGAAAGAAGGAAGGAGG - Intergenic
1081441345 11:43084952-43084974 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1082642949 11:55686626-55686648 CACCAGCAACAGAAAAAAGGTGG + Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082966719 11:58973360-58973382 CAACAGCAACAGAAGAAAGCTGG + Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084566999 11:69935562-69935584 CACGTGCAAAAGAAGGAAGCTGG + Intergenic
1084989902 11:72913041-72913063 CAGGAGGAAAAGAGAGAAGGGGG + Intronic
1085158343 11:74317520-74317542 AAAGAGAAAGAGAAGGAAGGAGG - Intergenic
1085201418 11:74704482-74704504 AAGGAGAAACATAAGAAAGGTGG - Exonic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086794749 11:91085581-91085603 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1087806522 11:102561378-102561400 GAGAAGGAAAAGAAGGAAGGAGG - Intergenic
1088073745 11:105821529-105821551 CAGGAGCAAGAGAGAGAGGGCGG + Intronic
1088262731 11:107959641-107959663 CAGGAGAAATAGAAAGAAAGAGG + Intronic
1088438433 11:109841392-109841414 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1088851599 11:113707538-113707560 CAAGAGCAAGAGAGAGAAGGGGG + Intergenic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089256192 11:117195543-117195565 GAAGAGAATCAGAAGGAAGGAGG + Intronic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089391477 11:118104857-118104879 AAGGAGGAAGAGGAGGAAGGAGG - Intronic
1089569049 11:119390361-119390383 CAAGAACAGCAGAAAGAAGGAGG - Intergenic
1089620230 11:119717864-119717886 TGGAAGCAACAGGAGGAAGGAGG - Intronic
1089688860 11:120173589-120173611 CAGGAGCCACATCAGGACGGTGG + Intronic
1090428428 11:126626561-126626583 CAGGAGAAACATGAGTAAGGGGG + Intronic
1090472527 11:126992957-126992979 GAGGAGGCACAGAAGGATGGTGG - Intronic
1090638749 11:128712213-128712235 CAGGAGCAAGAGAGAGAAGGAGG - Intronic
1090805650 11:130200442-130200464 CAGGAGCAAGAGAGAGCAGGAGG + Intronic
1090960303 11:131550510-131550532 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1091215057 11:133895974-133895996 CTGGAGCAAAAGCAGAAAGGGGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091382326 12:69964-69986 CAGGAGCAATACCAGGGAGGGGG - Intronic
1091468338 12:705036-705058 AAGGAACGAAAGAAGGAAGGAGG - Intergenic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092674151 12:10897695-10897717 CAGGAGGAAGAGAAAGATGGGGG + Intronic
1092776374 12:11948143-11948165 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1093425036 12:19019163-19019185 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094234386 12:28146871-28146893 AAGGAGGAAAAGAAGAAAGGAGG - Intronic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094399244 12:30043722-30043744 CATGACCAACAGAAGGATGGTGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095954518 12:47798553-47798575 CAAGAGCAAGCGAAGTAAGGAGG - Exonic
1096680631 12:53252942-53252964 CAGTTGAAACCGAAGGAAGGAGG - Exonic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097223370 12:57462882-57462904 GAGGGGCACGAGAAGGAAGGGGG + Intronic
1097259360 12:57707452-57707474 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
1097323331 12:58248762-58248784 CAGGAGGAAGAGACTGAAGGGGG + Intergenic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1097475312 12:60047913-60047935 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1097928280 12:65155905-65155927 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1097956544 12:65492526-65492548 GAGGGGCAACAGAAGAAAAGGGG - Intergenic
1098030609 12:66249657-66249679 CATGAGCCAAAGAAGGCAGGTGG - Exonic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098610597 12:72452786-72452808 CAGGAGCAAGAGAGTGAAGGGGG - Intronic
1098616795 12:72536343-72536365 AAGGAGCCAGAGAAGGTAGGGGG + Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099724903 12:86412974-86412996 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1099854782 12:88150231-88150253 CAGGAGCAAGAGGAGTACGGTGG + Intronic
1099871719 12:88358013-88358035 AAGGAGGAAGAGAAGGAAAGGGG - Intergenic
1100149691 12:91721452-91721474 CCAGAGTAACAGAAGGAAAGAGG + Intergenic
1100153776 12:91773107-91773129 CAGGAGCAAGAGAGTTAAGGGGG + Intergenic
1100909841 12:99346793-99346815 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1100910092 12:99350167-99350189 CAGGAGGAAGAGAAAGAAGGGGG - Intronic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101429307 12:104613571-104613593 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101561643 12:105862834-105862856 CACGAGCCACAGAATGCAGGCGG - Intergenic
1101629830 12:106482496-106482518 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
1101757326 12:107631087-107631109 TAGGAGAGAGAGAAGGAAGGAGG - Intronic
1102039901 12:109794128-109794150 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102913610 12:116737320-116737342 GAGGAGGAAGGGAAGGAAGGAGG + Intronic
1102913679 12:116737582-116737604 AAGGAGGAAGATAAGGAAGGAGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103453867 12:121049522-121049544 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104139077 12:125969287-125969309 AAGGAGGAAAGGAAGGAAGGAGG - Intergenic
1104434389 12:128744003-128744025 CAGGAGCAAGACAGAGAAGGGGG + Intergenic
1104448184 12:128849595-128849617 AAGGAACAAAGGAAGGAAGGAGG - Intergenic
1104644020 12:130484460-130484482 CAGGAGGAAAATAAGGCAGGTGG - Intronic
1104655375 12:130570533-130570555 CAGGAGCAACAGAAGGTGACAGG + Intronic
1104689589 12:130815348-130815370 CAGGAACTACAGGAGGATGGAGG - Intronic
1104774162 12:131382438-131382460 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104774298 12:131382887-131382909 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105909123 13:24844413-24844435 CAGGCCCCAAAGAAGGAAGGAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106458953 13:29951578-29951600 CAGGAGGAAGAGAGCGAAGGGGG + Intergenic
1106541718 13:30696575-30696597 AAAGAGCAAGAGCAGGAAGGAGG + Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106881771 13:34139348-34139370 AAGGGGCAACAGAAGTAAAGGGG - Intergenic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1107433698 13:40362921-40362943 AAGGAGCTAGAGCAGGAAGGTGG - Intergenic
1107782912 13:43924189-43924211 CAGGACCAAAATAGGGAAGGAGG - Intergenic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1109110355 13:58310337-58310359 CAAGAGAAACAGAAAAAAGGAGG - Intergenic
1109204320 13:59465056-59465078 ACTGAGCAACAGCAGGAAGGAGG + Intergenic
1110098261 13:71559959-71559981 CACCAGCAAGAGAGGGAAGGAGG + Intronic
1110346435 13:74453141-74453163 CAGGAGAAACAGAAGCCAAGGGG + Intergenic
1110352347 13:74523369-74523391 CAGTAACAACAGCAGGAAAGGGG - Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110870218 13:80443536-80443558 GAGGAGAAAAAGAAGAAAGGAGG - Intergenic
1110892910 13:80712783-80712805 CAGGAGGAAGAGAGTGAAGGTGG + Intergenic
1111250895 13:85599926-85599948 CAGGAGCAAGAGAAAGAGAGAGG - Intergenic
1111483864 13:88869189-88869211 CAGGAGGAAGAGAATGAAGGGGG - Intergenic
1111494941 13:89035313-89035335 CAGGAGCAAGAGAAAGAGGGAGG - Intergenic
1111515907 13:89330608-89330630 CAGCAGCAAGAGAGAGAAGGAGG + Intergenic
1111571408 13:90091787-90091809 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1111590457 13:90341161-90341183 CAGGAGCAAGAGCAAGAAAGAGG + Intergenic
1111728567 13:92043407-92043429 GAGGAGCAAGGGAAGAAAGGGGG + Intronic
1111887595 13:94042158-94042180 TAGGAGGAAGAGAGGGAAGGGGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112080020 13:95959299-95959321 CAGGAGCAATTGGAGGCAGGTGG - Intronic
1112096367 13:96136430-96136452 CAGGACCAAGAGAGAGAAGGGGG + Intronic
1112252102 13:97791942-97791964 CAGGAGCAAGAGAGGGTAAGAGG + Intergenic
1112382957 13:98910631-98910653 CCGGGGCAACAGGATGAAGGAGG + Intronic
1112484941 13:99811414-99811436 CAGGAGCCAGGGAAGGATGGGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112834615 13:103498938-103498960 GAAGAGGAAGAGAAGGAAGGCGG - Intergenic
1112910692 13:104479904-104479926 CAGGAGCAAGAGAGTGAAGGGGG + Intergenic
1113046403 13:106159827-106159849 CAGGCGCAACAGCAGGCAGTTGG + Intergenic
1113134553 13:107075130-107075152 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1113149781 13:107250876-107250898 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1113339633 13:109409483-109409505 CAGGAGAAAAAGAAGGTTGGTGG + Intergenic
1113346809 13:109486190-109486212 CAGGAGGAATAGAAAGCAGGGGG - Intergenic
1113606143 13:111608386-111608408 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1113679754 13:112234964-112234986 TGGGAGCAAGAGAGGGAAGGGGG - Intergenic
1114148544 14:20008065-20008087 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1114786347 14:25604215-25604237 CATGAGAAACAGAAGGAATTTGG + Intergenic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1116007149 14:39306413-39306435 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1116010622 14:39347410-39347432 GAGGAGGAAAAGAAGGAAGGAGG + Intronic
1116211702 14:41954613-41954635 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1116662864 14:47734447-47734469 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1117268192 14:54113092-54113114 CAGGAGGAAGAGAGGAAAGGGGG - Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117699617 14:58399761-58399783 CAGGAGCATCATAAGGAAACAGG - Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118518329 14:66551769-66551791 CAGGAGGAAGAGAAAGAAGGAGG + Intronic
1118676303 14:68188329-68188351 GAGGAGGGACAGAAGGGAGGAGG - Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1120464078 14:84833693-84833715 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1120551264 14:85875965-85875987 CAGAGGCAACAAAAGGAAAGTGG - Intergenic
1120577987 14:86207768-86207790 CAGGAGAAAGAGAGCGAAGGGGG + Intergenic
1120825836 14:88954350-88954372 CAGGAGCAAGATAGAGAAGGGGG + Intergenic
1120902520 14:89588160-89588182 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121106769 14:91285353-91285375 CAGGTGCAAGAGACGGGAGGGGG + Intronic
1121117965 14:91356886-91356908 GGGGAGCACCAGCAGGAAGGTGG + Intronic
1121211455 14:92210691-92210713 CAGGAGCTGAAGAAGGGAGGTGG + Intergenic
1121233759 14:92377536-92377558 CAGCAGGAACAGGAGGCAGGAGG + Intronic
1121612832 14:95293213-95293235 AGGGAGGAAAAGAAGGAAGGAGG - Intronic
1121827494 14:97022452-97022474 CAGGAGCAACAGGAAGACGTAGG - Intergenic
1121828413 14:97029262-97029284 AAGGAGGGAAAGAAGGAAGGAGG - Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1122009675 14:98735781-98735803 AAGGAACATCAGAAGGAAGGAGG + Intergenic
1122167667 14:99841430-99841452 CAGGAACGTCAGAAGGCAGGTGG + Intronic
1122258688 14:100499737-100499759 CAGGAGCTCTGGAAGGAAGGAGG - Intronic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124146422 15:27130247-27130269 CAGAAGCAAAAGAATGAAGTTGG - Intronic
1124445111 15:29723388-29723410 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1125263635 15:37854706-37854728 CAGGAGCAACAGAGAGAGTGGGG - Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126179792 15:45773958-45773980 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1126443628 15:48718403-48718425 CACGGGCAGGAGAAGGAAGGTGG + Intronic
1127009541 15:54607734-54607756 CAGGAGAGACAAAGGGAAGGGGG + Intronic
1127249019 15:57210128-57210150 CAGGAGCAACATAATAAAGCAGG + Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127507519 15:59610766-59610788 AAGGAGGAAAGGAAGGAAGGAGG - Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128575817 15:68774278-68774300 AAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1128741704 15:70088355-70088377 AAGGAGAAACTTAAGGAAGGGGG - Intronic
1129155229 15:73713530-73713552 CTAGAGCAAGAGGAGGAAGGAGG - Exonic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129314334 15:74732084-74732106 GGCGAGCAACAGAAGGCAGGGGG - Intergenic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1129715519 15:77846342-77846364 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1130525691 15:84704441-84704463 CTTGAGTAACACAAGGAAGGAGG - Intronic
1130883228 15:88072781-88072803 GAGGAGCAAGAGAGGGAAAGCGG + Intronic
1130924673 15:88375957-88375979 AATGAGGAAGAGAAGGAAGGAGG - Intergenic
1131382218 15:91973468-91973490 CAGATGCAACAGCAGGAAGAAGG + Intronic
1131439747 15:92450578-92450600 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1131622036 15:94078573-94078595 CAGGAGCAAGAGAACGTGGGGGG - Intergenic
1131680360 15:94715480-94715502 CTGGAGCAAAATAATGAAGGGGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131880119 15:96853375-96853397 CAGGACCCTCAGAAGGAAAGTGG + Intergenic
1131950920 15:97681012-97681034 CAGGAGTAATAGAAGTAAGTGGG + Intergenic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132254786 15:100366253-100366275 CACCAGCAACAGAACAAAGGTGG + Intergenic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1132349597 15:101131351-101131373 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133436484 16:5784472-5784494 CAGGAGCAGCAGAGAGACGGGGG + Intergenic
1133537953 16:6720270-6720292 CAGGAGAAAAAGAGTGAAGGGGG - Intronic
1133631937 16:7629983-7630005 GAGGAAGAACAGAAGTAAGGCGG - Intronic
1133646908 16:7773266-7773288 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1133787219 16:8982903-8982925 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134321411 16:13167672-13167694 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1134338049 16:13319580-13319602 AGGGAGCAACAAAAGGGAGGAGG - Intergenic
1135055594 16:19229401-19229423 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1135751552 16:25062492-25062514 CAGGAGCCACAGAAAGCAAGGGG - Intergenic
1135784897 16:25340041-25340063 GAGGAGCAAGAGAGGGAGGGGGG - Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136178198 16:28533054-28533076 CAGGAGCAACACCAGGCAGTCGG - Intronic
1137486707 16:48897262-48897284 CAGGAGAAACAGGAGGTAAGTGG + Intergenic
1137798652 16:51242711-51242733 CAGGAGGAAAACAAGGAAAGGGG - Intergenic
1137884532 16:52088384-52088406 TAGAAGCCACAGAAAGAAGGAGG + Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138541598 16:57691039-57691061 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
1138657325 16:58499017-58499039 CAGGAGCCACAGAGAGAAGGGGG - Intronic
1138706824 16:58923600-58923622 CAGCAGGATCAGAAGAAAGGGGG + Intergenic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139165766 16:64563367-64563389 AAGGAGGAAGAGGAGGAAGGAGG + Intergenic
1139316338 16:66072769-66072791 CAGAAGCAACAGAAGGTAAGAGG + Intergenic
1139946335 16:70644928-70644950 AAGGAGGAAGAGGAGGAAGGAGG + Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140798633 16:78464348-78464370 AAGGAGGAAGAGAGGGAAGGAGG + Intronic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1140917321 16:79505973-79505995 AAGGAGCAAAAGAAGGGAAGGGG + Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141188686 16:81807832-81807854 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1141856217 16:86683082-86683104 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1141856223 16:86683106-86683128 GAGAAGGAAAAGAAGGAAGGAGG + Intergenic
1141919971 16:87129112-87129134 CAGGAGCTACAGAAGGCAAGAGG - Intronic
1142170456 16:88619396-88619418 CAGCTGCTTCAGAAGGAAGGTGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1142785763 17:2221343-2221365 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1142904599 17:3033593-3033615 CAGGAGGAACCTGAGGAAGGAGG - Exonic
1143046796 17:4087515-4087537 TAGGTGCAGCAGAAGGAAAGTGG - Exonic
1143074166 17:4325911-4325933 CATAAGCAAAAGAATGAAGGTGG + Intronic
1143391384 17:6561157-6561179 GAGGAGGAAGAGGAGGAAGGGGG - Intergenic
1143701111 17:8660886-8660908 AAGGAGGAAAGGAAGGAAGGAGG - Intergenic
1143767903 17:9149689-9149711 TATCAGCAAAAGAAGGAAGGGGG - Intronic
1143980073 17:10861346-10861368 CAAGAGCACCAGAAGAAAAGGGG - Intergenic
1144058521 17:11561416-11561438 CTGGAGCAAGACAGGGAAGGTGG - Exonic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144358410 17:14468167-14468189 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1144396866 17:14852823-14852845 CAGGAGCAAGTGGAGGAGGGGGG + Intergenic
1144550902 17:16240167-16240189 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1144580467 17:16456176-16456198 GAGGAGGAAGAGGAGGAAGGAGG + Intronic
1144813242 17:18015519-18015541 CAGGAACAAGAGAAGGCAGAAGG + Intronic
1145165693 17:20612047-20612069 CAGGAGCAATAGAAAGCAAGCGG + Intergenic
1145819903 17:27824253-27824275 CAAGAGGAAGGGAAGGAAGGAGG + Intronic
1145840530 17:27990433-27990455 CAGGAGCAAGAGAGGGAGAGTGG - Intergenic
1146040022 17:29443323-29443345 CAAGAGCAACAAAAAGAAGATGG - Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146828562 17:36046613-36046635 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1146928088 17:36758662-36758684 CATGAGCAAGAGAAAGAGGGTGG + Intergenic
1147475837 17:40710751-40710773 CAGGAGCAAGAGAGAGATGGGGG + Intergenic
1147490630 17:40863048-40863070 CAGCAGAAATAGAAGGAATGGGG - Intronic
1147686118 17:42287873-42287895 CCGGAGTAAAAGAAGGAGGGAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147770340 17:42863721-42863743 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1148261024 17:46183623-46183645 AAGGAGGGAAAGAAGGAAGGAGG + Intronic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148347382 17:46912484-46912506 CAGGAGCAAGGCAGGGAAGGAGG - Intergenic
1148847718 17:50538950-50538972 CAGGAGCACGAGAAGGTAGTGGG + Exonic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1150286237 17:63955829-63955851 CAGCACCAAGAGAGGGAAGGGGG - Intronic
1150461630 17:65358616-65358638 CAGGAGGAAGAGAATGAAGGAGG + Intergenic
1150687639 17:67333372-67333394 CATAAGCAAGTGAAGGAAGGAGG + Intergenic
1151001920 17:70386705-70386727 CTGGAGCAAGAGCAGAAAGGAGG + Intergenic
1151136788 17:71954249-71954271 CCGGAGGAAGAGAAAGAAGGGGG + Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151326532 17:73383331-73383353 CTGGAGCAAAGGAAGGAAAGAGG - Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1151692809 17:75697281-75697303 CAGCAACAACAAAAGCAAGGAGG - Intronic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152435391 17:80273300-80273322 CAGGAGCTGAAGGAGGAAGGGGG + Exonic
1152449687 17:80369472-80369494 CACGAGAAACAGAAGACAGGTGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152783032 17:82234818-82234840 CAGGAGGAACCCAAGGAAAGGGG + Exonic
1152900071 17:82936013-82936035 AAGCAACAACAGAAGCAAGGAGG - Intronic
1153167030 18:2273825-2273847 CAGGAGCAAGAGGGAGAAGGAGG + Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153607149 18:6846080-6846102 TAGGAGCGATAGAAGGACGGGGG + Intronic
1153807391 18:8721330-8721352 CAGGTGCAGCAGATGGGAGGGGG - Intronic
1153945816 18:10016282-10016304 CAGGAGCATCTGCAGGAAGCAGG + Intergenic
1154412209 18:14147520-14147542 AAGGAGGAACGGAAGGAGGGAGG + Intergenic
1155113539 18:22739951-22739973 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1155396041 18:25387741-25387763 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155597576 18:27505238-27505260 CAGGAAGAAAAGAAAGAAGGAGG + Intergenic
1155692568 18:28643984-28644006 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156202714 18:34852680-34852702 CAGGAGGAACACATGGGAGGTGG - Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156736836 18:40270304-40270326 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1157324177 18:46657206-46657228 CAGGAGCCAGAGAAGGCAGAGGG - Intergenic
1157597244 18:48871266-48871288 CAGGTGCAATTGATGGAAGGAGG - Intergenic
1157614481 18:48978511-48978533 CAGGTGCAATTGAAGGAAGGAGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158203293 18:54963444-54963466 CAAGAGCAACAAAAGGAATAAGG - Intergenic
1158475432 18:57775325-57775347 AAAGAGAAAGAGAAGGAAGGAGG + Intronic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1158904917 18:62002438-62002460 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1159777722 18:72623082-72623104 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1160099167 18:75904397-75904419 CAGGGGCCACAGGAGGCAGGTGG + Intergenic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161559209 19:4962231-4962253 CAGGAGAAACATGAGGCAGGTGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162013992 19:7833856-7833878 CCCGGGCAATAGAAGGAAGGAGG + Intronic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1162532849 19:11245804-11245826 CGGGAGAAAAAGAAGGTAGGAGG - Exonic
1163054632 19:14709095-14709117 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1163382489 19:16978205-16978227 CATGGGCAACAGGAGGAAGTGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163718424 19:18885986-18886008 CAGGTGCACCAGGAGGCAGGAGG - Intronic
1164515768 19:28934059-28934081 CAGCAGGAACACAAGGCAGGAGG - Intergenic
1164566216 19:29327725-29327747 CACGAGCAACTGAAGGCAAGAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164788026 19:30952243-30952265 AAGGAGCAAAAGAGGGAGGGAGG - Intergenic
1164788036 19:30952286-30952308 AAGGAGCAAAAGAGGGAAAGAGG - Intergenic
1164788044 19:30952329-30952351 AAGGAGCAAAAGAGGGAAAGAGG - Intergenic
1164818129 19:31222534-31222556 CAGGAGGTCCTGAAGGAAGGAGG - Intergenic
1164915117 19:32046065-32046087 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165268248 19:34679488-34679510 GAGGAGGCAGAGAAGGAAGGTGG - Intronic
1165274453 19:34735729-34735751 GAGGAGGCAGAGAAGGAAGGTGG - Intronic
1165596650 19:37015214-37015236 GAGGAGCATCAGAAGGTAGGTGG - Intronic
1166182412 19:41118224-41118246 AGGGACCAACAGAAGGAAGGAGG + Intronic
1166560287 19:43728314-43728336 CAGGAGCAAGAGGGGGCAGGTGG - Exonic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166863111 19:45821051-45821073 CCCGAGGAACAGAAGGAAGCAGG - Intronic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167225589 19:48237272-48237294 CAGGAGCAAGACAGTGAAGGGGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
925121294 2:1420729-1420751 CAGGAGGGACAGAAGGATGGTGG + Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925248030 2:2402187-2402209 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925842591 2:8006582-8006604 GAGGAGGAAAAGAAGGATGGAGG - Intergenic
925929855 2:8698287-8698309 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
926172115 2:10558996-10559018 CAGCAGCAACTGAATGAATGGGG - Intergenic
926221596 2:10939461-10939483 CAGGAGGAAGACAATGAAGGAGG + Intergenic
926244510 2:11113231-11113253 AAGGAGGAAGGGAAGGAAGGAGG - Intergenic
926560837 2:14415670-14415692 CAGGAGCAAGAGAAAGAGTGGGG - Intergenic
926665150 2:15513647-15513669 AAAGAGCAACAGACAGAAGGAGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927099154 2:19774652-19774674 GAGGAGCCACAGAATGAATGAGG - Intergenic
927127940 2:20030380-20030402 CGGGAGCAAGAGAGAGAAGGGGG + Intergenic
927141250 2:20132349-20132371 CAGGAGCAAGAGCGAGAAGGGGG + Intergenic
927220962 2:20708626-20708648 CATGTGCAAAAGAAGGAAGCTGG + Intronic
927455207 2:23242859-23242881 CAGGAGCAGGAGAAGGTTGGGGG - Intergenic
927649053 2:24899849-24899871 GGGGAGCAAGGGAAGGAAGGAGG + Intronic
927858394 2:26541895-26541917 CAGCTGCCTCAGAAGGAAGGAGG - Intronic
927922812 2:26986554-26986576 CAGCTGCAACAGAAAGATGGGGG + Intronic
928060410 2:28107111-28107133 CAGGAGCAACAGTAGCAAGTTGG - Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928873719 2:36012216-36012238 CAGGAGCTAGAGAAGGAAATAGG - Intergenic
929095946 2:38263425-38263447 CAGAAGCAAGAGAAGGACGTGGG + Intergenic
929273368 2:39998987-39999009 CATGAGCAATAGAGGGTAGGGGG - Intergenic
929380009 2:41338035-41338057 AAAGAGGAACAGAGGGAAGGAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
930081909 2:47457472-47457494 CAGGAGCAAGAGAGAGAAGGGGG + Intronic
930868875 2:56149897-56149919 CAGGAAGAACAGAATGAAGGTGG + Intergenic
931121660 2:59226492-59226514 AAGGAGGGAAAGAAGGAAGGAGG + Intergenic
931398552 2:61909759-61909781 TAGAAGCAAAGGAAGGAAGGAGG + Intronic
931445625 2:62324806-62324828 CACGCCCTACAGAAGGAAGGGGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
931939394 2:67235187-67235209 CAGAAGCAGCAGTAGGTAGGTGG - Intergenic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
932177263 2:69614346-69614368 CAGGTGTAACAGCTGGAAGGAGG + Intronic
932446616 2:71785687-71785709 CAGGAGGGGCAGAAGAAAGGCGG - Intergenic
933014228 2:77104106-77104128 CTTGAGCAACTGAAGGAAGGTGG - Intronic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933180633 2:79222650-79222672 CAGGAAGAAAAGAAGGCAGGAGG - Intronic
933635238 2:84701641-84701663 CAGGAGCAAGAGAGAGAGGGGGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
933998231 2:87685640-87685662 GAGGGGCAGCTGAAGGAAGGAGG + Intergenic
934184287 2:89657913-89657935 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935325071 2:101928411-101928433 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
935564898 2:104595767-104595789 AGGGAGCAAGAGAGGGAAGGGGG - Intergenic
935854615 2:107260473-107260495 AAATAGCTACAGAAGGAAGGTGG + Intergenic
936007854 2:108906403-108906425 AAGGGGCAACAGTAGAAAGGAGG + Intronic
936158460 2:110065656-110065678 CACAAGCAAAAGAATGAAGGTGG - Intergenic
936186201 2:110305666-110305688 CACAAGCAAAAGAATGAAGGTGG + Intergenic
936295619 2:111265233-111265255 GAGGGGCAGCTGAAGGAAGGAGG - Intergenic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936451363 2:112636152-112636174 CAGGTGCAGGGGAAGGAAGGTGG + Intergenic
936492694 2:112986200-112986222 CAGGAGCAACAGAGAGAGTGAGG - Intergenic
936638519 2:114286552-114286574 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
936684739 2:114814835-114814857 CAGCAGCAACTGAAGGAAAGAGG - Intronic
936721592 2:115257476-115257498 CAGGAGCAAAAGAGGGAGTGAGG + Intronic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
936882768 2:117274516-117274538 CACAAGCAACAGAATGAAGTTGG - Intergenic
937084551 2:119162022-119162044 CAGGAGGAGCAGAAGCCAGGTGG - Intergenic
937263034 2:120598453-120598475 CAGGGGCTACAGGAGGAAAGCGG + Intergenic
937447035 2:121967129-121967151 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
937726867 2:125176712-125176734 CAAGAGCAAGAGAGAGAAGGGGG - Intergenic
937818170 2:126276297-126276319 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818181 2:126276329-126276351 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818192 2:126276361-126276383 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818203 2:126276393-126276415 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938600046 2:132828435-132828457 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939184209 2:138841344-138841366 TAGGAGCAAAAAAAGGAAGTTGG - Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939687314 2:145215141-145215163 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
939692045 2:145275473-145275495 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
939828665 2:147046370-147046392 CAGGAACAATAGAGGGAAAGAGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
941075637 2:161003278-161003300 CACCAGCAACAGAAGAAAGCTGG + Intergenic
941207142 2:162588054-162588076 CAGGAGCGATGGGAGGAAGGAGG - Intronic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941413216 2:165186446-165186468 CAGGACCAAAAGAAGGCAGAGGG - Intronic
941450320 2:165652890-165652912 CAAGAGCAAGAAAAGGAGGGAGG - Intronic
941692494 2:168515672-168515694 TACTAGCAACAGAAGGAATGCGG + Intronic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
942242007 2:173971589-173971611 CAGAAGCATCAGAGGGGAGGAGG - Intergenic
942360637 2:175168237-175168259 GAGGGGCGCCAGAAGGAAGGTGG - Intronic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943272399 2:185823543-185823565 AGGGAGGGACAGAAGGAAGGAGG + Intronic
943354814 2:186839895-186839917 CAGGAGTAGGAGATGGAAGGGGG - Intronic
943575933 2:189631076-189631098 GAGGAAAAACAAAAGGAAGGAGG + Intergenic
944191591 2:197009817-197009839 CAGGAACTAGAAAAGGAAGGTGG - Intronic
944305410 2:198173426-198173448 CAAGAGCAGCAGGAGGAACGTGG - Intronic
944390838 2:199217798-199217820 CAGGAACAAGAGAGAGAAGGGGG - Intergenic
944755271 2:202755045-202755067 CAGGAGCAAGAGAGAGAAGTGGG + Intronic
944950636 2:204744928-204744950 CAGATGCAACAGAAGGACTGAGG + Intronic
944955535 2:204803776-204803798 CAGGAAGGAAAGAAGGAAGGAGG + Intronic
945856664 2:215077022-215077044 CTTCAGGAACAGAAGGAAGGAGG + Intronic
946061122 2:216942417-216942439 CAGGGGCAGCAGAAGGCCGGGGG - Intergenic
946530406 2:220564276-220564298 GAGGAGCGATGGAAGGAAGGAGG - Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
947096094 2:226568538-226568560 CAGGAGCAAGAGAGGGAGAGAGG - Intergenic
947336303 2:229088413-229088435 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947767028 2:232644382-232644404 CAGGAGCCACTAAAGGAATGAGG - Intronic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
1169196404 20:3685054-3685076 CAGGAGCACCAGTATGGAGGTGG + Intergenic
1169208384 20:3752535-3752557 GAGGAGCCGCAGGAGGAAGGAGG + Exonic
1169305090 20:4482682-4482704 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1169585983 20:7086045-7086067 GAGGAGGAAAAGAAGGAAGGAGG - Intergenic
1170005743 20:11667205-11667227 CAGGAGCAGTAAAAGGCAGGAGG + Intergenic
1170278479 20:14619469-14619491 AAGGAGGAAAGGAAGGAAGGAGG + Intronic
1170532411 20:17307998-17308020 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170532424 20:17308100-17308122 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1170700793 20:18701524-18701546 TAGGAGCAACAGAATGCGGGTGG + Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170821354 20:19758204-19758226 GAGGAGGAAGAGGAGGAAGGGGG - Intergenic
1171186136 20:23125688-23125710 CAGGAGCAAAAAAAGGAAGTCGG + Intergenic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1171791201 20:29526879-29526901 CACCAGCAACAGAACAAAGGTGG + Intergenic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172784068 20:37454455-37454477 CTGGAGCAACATGAGCAAGGGGG - Intergenic
1172823291 20:37758056-37758078 CAGTAGCAACAAAAGAGAGGAGG - Intronic
1172904624 20:38359893-38359915 CAGGAGTACCAGCAGGAATGGGG + Intronic
1172974463 20:38895790-38895812 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974469 20:38895817-38895839 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974514 20:38895979-38896001 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1173094005 20:40006771-40006793 CAGGAGGAAAAGACAGAAGGGGG - Intergenic
1173149965 20:40558603-40558625 AAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1173872301 20:46349809-46349831 CAGGAGCGAGAAAATGAAGGAGG + Exonic
1174395106 20:50242559-50242581 TGGGAGCCACAGGAGGAAGGTGG - Intergenic
1174459691 20:50673562-50673584 CATGAGCTGGAGAAGGAAGGAGG - Intronic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1174925126 20:54750788-54750810 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1174981582 20:55401479-55401501 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1175046851 20:56114878-56114900 CAGGAGCAAGAGACAGAACGGGG + Intergenic
1175130000 20:56782025-56782047 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175130011 20:56782061-56782083 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175130022 20:56782097-56782119 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175130041 20:56782157-56782179 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175130052 20:56782193-56782215 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175130063 20:56782229-56782251 AAGGAGGGAGAGAAGGAAGGAGG + Intergenic
1175652455 20:60737348-60737370 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176913321 21:14595015-14595037 CAAGAGCAAAAGAATGAAGGCGG + Intronic
1177298670 21:19211303-19211325 CAGGAGCAAGAGAAAGATAGGGG - Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177483767 21:21728409-21728431 GAGGAGCAACAGGAGGAAGTTGG - Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1177722820 21:24929043-24929065 CAGGAGCAACAGAGAGACAGGGG - Intergenic
1177737085 21:25104589-25104611 AAGGAGGGAGAGAAGGAAGGAGG - Intergenic
1178102384 21:29283683-29283705 CAGGAGGAAGGGAAAGAAGGGGG + Intronic
1178673528 21:34612780-34612802 CATGAGCAACAGCTGGAAGCTGG - Intronic
1178758408 21:35376026-35376048 CAGGAGCGAGAGTAGAAAGGTGG - Intronic
1178825768 21:36015506-36015528 CAACAACAACAAAAGGAAGGTGG - Intergenic
1179052609 21:37901010-37901032 CAGGAAGGAGAGAAGGAAGGGGG - Intronic
1179163460 21:38916801-38916823 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163467 21:38916838-38916860 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163477 21:38916883-38916905 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179291219 21:40019933-40019955 CAGGAGGAAGGGAAAGAAGGAGG - Intronic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179399505 21:41070789-41070811 TAGGAGGAAAAGAAGGATGGAGG + Intergenic
1179524103 21:41964491-41964513 CCAGAGCTACAGGAGGAAGGCGG - Intergenic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1179598733 21:42461395-42461417 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1179620594 21:42613303-42613325 CAGGAGGAAGAGAATGAAGTTGG + Intergenic
1179722675 21:43324505-43324527 CAGGAGCTGCAGGAGGCAGGAGG - Intergenic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179797551 21:43794213-43794235 CTGGAGCTCAAGAAGGAAGGAGG + Intronic
1179878840 21:44285166-44285188 CAGGTGCTTTAGAAGGAAGGCGG - Intergenic
1180230387 21:46423751-46423773 GAGGAGGAAGAGAAGGGAGGGGG + Intronic
1180817370 22:18799495-18799517 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181203560 22:21233816-21233838 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181436780 22:22915726-22915748 CAGGAGCCATAGAAGGAAAATGG + Intergenic
1181581269 22:23829366-23829388 CAGGTGCTTGAGAAGGAAGGTGG + Intronic
1182422709 22:30256294-30256316 GAGGAGGAAGAGGAGGAAGGGGG + Intergenic
1182753241 22:32658228-32658250 CAGGAGAAACCAAAGGAAGGTGG + Intronic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183272115 22:36868678-36868700 AAGGAGGAAGAGAAGGCAGGAGG + Intronic
1183645453 22:39123769-39123791 GAGGAGCACAAGGAGGAAGGAGG + Intronic
1183828425 22:40405653-40405675 CAGGAACAGCAGGAGGCAGGCGG - Exonic
1183847660 22:40555436-40555458 CAGGAGCAAGAGAAAGAAGGGGG - Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184432369 22:44449047-44449069 CTGGAGCAACAGAAAGCACGGGG - Intergenic
1184449807 22:44576137-44576159 GAGGAGTAAGAGAAAGAAGGAGG + Intergenic
1184653639 22:45930635-45930657 CAGGAGCAGCCTGAGGAAGGTGG - Intronic
1184672556 22:46023039-46023061 AAGGAGGAAGGGAAGGAAGGAGG + Intergenic
1184813910 22:46856005-46856027 CCGGAGCCACAGAAGGAAAGTGG + Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184825906 22:46950649-46950671 AAGGAACAACAGGAGGATGGTGG + Intronic
1184913203 22:47549748-47549770 TGGCAGCAACAGCAGGAAGGTGG + Intergenic
1185129196 22:49028092-49028114 ATGGAGGTACAGAAGGAAGGAGG + Intergenic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
1203223361 22_KI270731v1_random:61598-61620 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1203267468 22_KI270734v1_random:25222-25244 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
949127826 3:467770-467792 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
949219832 3:1618523-1618545 AAGGAGGAACATAGGGAAGGAGG + Intergenic
949352956 3:3144210-3144232 CAGGATTAACAGAAGAAACGAGG - Intronic
949366605 3:3288436-3288458 CAGGAGCAAGAGAGAGAAAGTGG - Intergenic
949606776 3:5662047-5662069 CAGGAGCAAAAGAGAGAAGGAGG + Intergenic
949895948 3:8767789-8767811 CATGAGCAGCAGCAGGTAGGTGG + Exonic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
950335137 3:12187449-12187471 GAGGAGGAAGAGGAGGAAGGTGG - Exonic
950342169 3:12257327-12257349 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
950460627 3:13120233-13120255 GAGGAGCCAGAGAAGTAAGGAGG - Intergenic
950466388 3:13157643-13157665 GGGGAGCAAAGGAAGGAAGGAGG + Intergenic
950741412 3:15055078-15055100 CAGGAGCAAGAAAGAGAAGGGGG + Intronic
951129895 3:19029878-19029900 CAGGAGCTACAGCTGGAATGGGG - Intergenic
951167326 3:19498599-19498621 CACCAGCAACAGAAGAAAGCTGG - Intronic
951295294 3:20926318-20926340 AGGGAGCAAGAGAGGGAAGGGGG + Intergenic
951759445 3:26129517-26129539 CACGAGCAACAGAACAAAGCTGG - Intergenic
952082101 3:29771803-29771825 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
952525287 3:34203631-34203653 CAGGAGGAACAACAGGAAAGGGG + Intergenic
952562480 3:34611405-34611427 CAGGAGAGAATGAAGGAAGGAGG - Intergenic
952852462 3:37740474-37740496 GAGGAGCAAAAGAAGAAGGGAGG - Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953236429 3:41111453-41111475 CAGAAGCAACCGAAGGGATGGGG - Intergenic
953237628 3:41120211-41120233 AAACAGAAACAGAAGGAAGGAGG - Intergenic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953502910 3:43455177-43455199 CAAGAGCAAGGGAGGGAAGGAGG + Intronic
954097084 3:48337238-48337260 CAGGAGGAAGAGAACGAATGGGG - Intergenic
954163494 3:48738698-48738720 CAGGAGCTAGAGGAGGATGGTGG + Intronic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
954593496 3:51804483-51804505 CAAGATCAACACAAGGAAGAGGG - Intergenic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
954986860 3:54802230-54802252 AAAGAGCTAGAGAAGGAAGGTGG + Intronic
955234116 3:57124537-57124559 AAGGAGCCACAGAAAGCAGGCGG + Intronic
955566946 3:60257621-60257643 CAGGAGGAGGACAAGGAAGGTGG + Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956261689 3:67350196-67350218 CAGAAGCAAGAGAAAGATGGGGG - Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
956753398 3:72362928-72362950 CGGGAGGAAGAGAATGAAGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956901830 3:73724761-73724783 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
957037621 3:75309515-75309537 CAGGAGCTACATTGGGAAGGTGG + Intergenic
957212086 3:77272399-77272421 CAGGAGGAAGAGAAGGGCGGGGG + Intronic
957504427 3:81101270-81101292 CAGGAGAGAGAGAAAGAAGGGGG - Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958124714 3:89341161-89341183 CACGGGCAACAGAAGGAAATGGG - Intronic
958144907 3:89612199-89612221 AGAGAGAAACAGAAGGAAGGAGG - Intergenic
959037318 3:101383225-101383247 CAGGAGCAAGAGAAAGAGTGGGG - Intronic
959124899 3:102279001-102279023 CAGGAGCAAGAGGAAGAAGTGGG + Intronic
959790603 3:110356834-110356856 CAGGAAGAATAAAAGGAAGGAGG - Intergenic
959988337 3:112601712-112601734 CAGCAGCAACGAAAGGAGGGAGG + Intergenic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960316160 3:116179619-116179641 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960913563 3:122674548-122674570 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
960957681 3:123045700-123045722 CAGGAGCGACAGGAGAGAGGTGG - Intergenic
961003405 3:123389012-123389034 CAGGAGTCATGGAAGGAAGGAGG + Intronic
961008423 3:123420415-123420437 CAGGAGGAAAAGGAGAAAGGAGG - Intronic
961085651 3:124065052-124065074 CAGGAGCTACATTGGGAAGGTGG + Intergenic
961254191 3:125533170-125533192 GGGGAGGAAGAGAAGGAAGGGGG - Intronic
961340210 3:126212601-126212623 CGGGAGGAAGGGAAGGAAGGAGG + Intergenic
961660253 3:128464859-128464881 AAGGAGGAAATGAAGGAAGGAGG - Intronic
961976543 3:131030913-131030935 CAGGAGGAACAGAAAGCAGAAGG + Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962366726 3:134791679-134791701 CAGCAGGAAAAGAAGGAGGGAGG - Intronic
963109144 3:141671016-141671038 CACTAGCAACAGAACGAAGCTGG + Intergenic
963352587 3:144170201-144170223 AAGGAGCAAGAGAAGAGAGGAGG - Intergenic
963707870 3:148710897-148710919 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964715369 3:159715365-159715387 CAGCAGCAACAGAACAAAGCTGG + Intronic
964756097 3:160092062-160092084 CAGGAGCTTCATAAGGCAGGTGG - Intergenic
964852994 3:161115197-161115219 CAGGAGCAAGAGAGGGGTGGAGG + Intronic
964969480 3:162542145-162542167 AAGGAGTGAGAGAAGGAAGGAGG - Intergenic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965393150 3:168129398-168129420 CACCAGCAACAGAACGAAGCAGG + Intergenic
965756210 3:172029909-172029931 AGGAAGCAAGAGAAGGAAGGAGG - Intergenic
965807126 3:172553183-172553205 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
966097762 3:176227136-176227158 CAGGACCAACAGAGAGACGGGGG - Intergenic
966262745 3:178000166-178000188 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
966882699 3:184359132-184359154 CTGGAGCAACAGAGGGGATGGGG + Intronic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
968159973 3:196418243-196418265 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969270317 4:6095149-6095171 AAGGAGCAAAGGAAGGAAGAAGG + Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969552983 4:7884112-7884134 CAGGAGCAAGAGAGGGAGTGGGG - Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
970016456 4:11517586-11517608 CTGGAGGAAGAGAATGAAGGTGG - Intergenic
970281084 4:14456431-14456453 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970421449 4:15909102-15909124 CAGGAGCAAAAGAGTGAGGGAGG + Intergenic
970542513 4:17094221-17094243 AAGGAGCAAGGGAAGAAAGGAGG + Intergenic
970733725 4:19140701-19140723 GAGGAGCAAGAGAGTGAAGGGGG + Intergenic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
970796707 4:19921242-19921264 CACCAGCAACAGAACGAAGCTGG + Intergenic
970801711 4:19979706-19979728 CAGGAGCAAGAGAGAGATGGGGG - Intergenic
970931015 4:21512020-21512042 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
970935603 4:21566468-21566490 CAGGAGGAAGAGAGCGAAGGGGG - Intronic
970984511 4:22140642-22140664 CAGGAGGAAGAGAGCGAAGGCGG + Intergenic
971005663 4:22371746-22371768 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971231652 4:24804968-24804990 TGGGAGCAAGAGAAGGAACGGGG + Intergenic
971255199 4:25008096-25008118 GTGGTGCTACAGAAGGAAGGGGG - Intronic
971343359 4:25790584-25790606 AAGGAGGGAAAGAAGGAAGGAGG + Intronic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
971550739 4:27952942-27952964 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
971617289 4:28808160-28808182 CAGTAGTTACAGAAGAAAGGAGG + Intergenic
972009651 4:34160846-34160868 CAGGAAGAAAAGAAAGAAGGAGG + Intergenic
972282233 4:37613591-37613613 CAGGAGCAAGAGAGAGAAAGGGG - Intronic
972428378 4:38956574-38956596 CAGGAGCAAGAGATGGGGGGCGG - Intergenic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972754532 4:42032069-42032091 CAGGAGCAAGAGAGAGATGGGGG + Intronic
972774414 4:42228107-42228129 CAGGAGGAAAAGAGCGAAGGGGG - Intergenic
972785908 4:42326678-42326700 GAGGAACAAGGGAAGGAAGGAGG + Intergenic
972878713 4:43396828-43396850 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973054772 4:45641939-45641961 AAGGAGGGAAAGAAGGAAGGAGG - Intergenic
973091116 4:46137565-46137587 CAGGAGCAAGAGAGGGGTGGGGG - Intergenic
973169103 4:47116904-47116926 CAGGAGAGAGAGAAAGAAGGGGG + Intronic
973244594 4:47997240-47997262 CAGCAGCAACAAAAGTTAGGAGG - Intronic
973806728 4:54533955-54533977 CACCAGCAACAGAACGAAGCTGG - Intergenic
973933419 4:55817092-55817114 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
973965077 4:56153516-56153538 TGGGAGAAACAGGAGGAAGGAGG - Intergenic
974036941 4:56825743-56825765 CAGGAGCAAGAGAAAAAATGAGG - Intergenic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
974606629 4:64160200-64160222 CAGGAGAGAGAGAGGGAAGGCGG - Intergenic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
974733423 4:65898562-65898584 CAGGAGAAACAGAGTGAAAGGGG + Intergenic
975252299 4:72194201-72194223 CAGGAGCAACAGAGAGAAGGAGG - Intergenic
975948334 4:79736701-79736723 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
976650642 4:87430180-87430202 CATGAGCCACAGAATGCAGGTGG + Intronic
976820203 4:89197817-89197839 CAGGAGCAAAAGAGAGAAAGGGG - Intergenic
976998327 4:91463479-91463501 CACCAGCAACAGAACAAAGGTGG + Intronic
977139129 4:93344776-93344798 CAGGAGCTAGAGAAGGCTGGCGG - Intronic
977194833 4:94045569-94045591 CACAAGCAACAGAAGAAAGATGG + Intergenic
977453515 4:97227861-97227883 CAGGTGCAAGAAAAGGAGGGAGG + Intronic
977580003 4:98714506-98714528 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
978203050 4:106045678-106045700 AAGGAACAAAAGAAGGAGGGAGG - Exonic
978344733 4:107755416-107755438 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
978421856 4:108541787-108541809 CAGGAGCAAGGGAGAGAAGGGGG - Intergenic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
978872306 4:113594121-113594143 CAGGAACAAGAGAGAGAAGGAGG + Intronic
978926044 4:114246087-114246109 CAGGAGCAAGAGAGAGAATGGGG + Intergenic
979101072 4:116615353-116615375 AAGGAACAAAGGAAGGAAGGAGG + Intergenic
979101100 4:116615489-116615511 AAGGAACAAAGGAAGGAAGGAGG + Intergenic
979101108 4:116615521-116615543 AAGGAACAAAGGAAGGAAGGAGG + Intergenic
979101117 4:116615561-116615583 AAGGAACAAAGGAAGGAAGGAGG + Intergenic
979140800 4:117171600-117171622 CAGGAGCAAGAGAAAGAGTGAGG - Intergenic
979333054 4:119438578-119438600 AAGGAGGAAGGGAAGGAAGGAGG + Intergenic
979452582 4:120890248-120890270 CAGGAGCAAGAGAGAGTAGGGGG + Intronic
979595321 4:122528258-122528280 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
979604365 4:122622072-122622094 CAAGAGAAGCAGAAGAAAGGAGG - Intergenic
979677949 4:123430156-123430178 CAGGAGCAAGAGTGAGAAGGGGG + Intergenic
980219962 4:129901687-129901709 GAGGAGGAAGAGGAGGAAGGTGG - Intergenic
980406909 4:132365700-132365722 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
980830550 4:138125828-138125850 CAGGAGCAAGAGAGACAAGGGGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981497392 4:145409619-145409641 CAGAAACATCAGAAAGAAGGAGG - Intergenic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982166495 4:152618111-152618133 CATGAGCAAGAGAAGCAGGGTGG - Intergenic
982187890 4:152820604-152820626 CAGGAGGAAGAGAATGAAGGGGG + Intronic
982256842 4:153459172-153459194 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
982400868 4:154966425-154966447 CAGGAGCAAGAGAAAGAAGAAGG - Intergenic
982666521 4:158271040-158271062 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
982722013 4:158869113-158869135 CAGGAGGAACGGGAGGGAGGAGG + Exonic
983197772 4:164826507-164826529 AAGGAGCAACGGAAGGAGCGAGG + Intergenic
983294591 4:165850143-165850165 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
983585305 4:169348119-169348141 CAGGACCAAGAGAGAGAAGGGGG + Intergenic
983698255 4:170559466-170559488 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
983917834 4:173311551-173311573 CAGGAGCAAGAGAGAGAAGCAGG + Intronic
984116938 4:175693979-175694001 CAGGAGCAAGAGAGAGTAGGGGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984275200 4:177600807-177600829 CAGGGGCAACAGCATGCAGGTGG - Intergenic
984352424 4:178612876-178612898 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
984660842 4:182373502-182373524 CAGGAGCAAGAGAAAGGAGGAGG + Intronic
984888481 4:184472646-184472668 AAGGAGCAACCGGAGGGAGGAGG + Intronic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985259940 4:188106006-188106028 CACATGCAACAGAAGGAATGGGG + Intronic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
985631333 5:1015613-1015635 CAGGAGCATCAGGAAGCAGGAGG + Intronic
985917083 5:2930337-2930359 CAGGAGCATAAGAAGGCAGGAGG - Intergenic
986099492 5:4594190-4594212 CAGGAGGAAGAGAATGAAGCAGG + Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986490907 5:8289190-8289212 AAGGAGAGAGAGAAGGAAGGAGG + Intergenic
986500573 5:8394985-8395007 CACGTGCAACAGAATGAAGTTGG + Intergenic
986511598 5:8512798-8512820 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
986538893 5:8822625-8822647 CAGGAGCAAGAGAAAGAAATAGG - Intergenic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986890722 5:12301643-12301665 CAGGAAGAAGAGAAGAAAGGGGG - Intergenic
986924722 5:12732586-12732608 CAGAAGCAAGAGAAAAAAGGAGG + Intergenic
987542528 5:19274494-19274516 CAGAAGTTACAGAAGGAAAGGGG + Intergenic
987779031 5:22408482-22408504 CAGGAGCAACAGAAGCAATCTGG + Intronic
988078767 5:26388710-26388732 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988409134 5:30864079-30864101 AAGGAGAAAAAGAAGGAATGGGG + Intergenic
988440248 5:31225585-31225607 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
988634129 5:32963315-32963337 TAGGAGCAAGAGAAAGAGGGAGG + Intergenic
988825207 5:34929349-34929371 CGGGAAGAACAGGAGGAAGGCGG - Intergenic
988930980 5:36035359-36035381 GAGGCGCATGAGAAGGAAGGTGG + Exonic
989508751 5:42259255-42259277 CACCAGCAACAGAACAAAGGTGG - Intergenic
989671044 5:43917432-43917454 CACCAGCAACAGAAGAAAGCTGG - Intergenic
989677177 5:43985496-43985518 CAGGAGCCACAGAGCGAGGGGGG + Intergenic
989797898 5:45498604-45498626 CACCAGCAACGGAAGGAAGCTGG - Intronic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990277520 5:54214082-54214104 AAGGAGGAAGAGATGGAAGGGGG + Intronic
990494931 5:56337993-56338015 GAGGAGGAACAGAAAGGAGGAGG - Intergenic
990553674 5:56909491-56909513 CCAGAGCAACAGAAGTCAGGCGG + Exonic
990887999 5:60616264-60616286 CAGCAGCAACAGAACAAAGCTGG + Intronic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991163304 5:63531228-63531250 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
991316277 5:65310111-65310133 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
991636828 5:68714722-68714744 CATGACCAACAGGAGGAAGGAGG - Intergenic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
991942135 5:71863230-71863252 AAGAAACAACAGAGGGAAGGAGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992090671 5:73313077-73313099 GAGGAGGAAGAGGAGGAAGGAGG - Intergenic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992313595 5:75529255-75529277 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
992334247 5:75749063-75749085 CAGGAGCAAGAGAGAGAATGGGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992648782 5:78836921-78836943 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
992769716 5:80035557-80035579 CAGGTGCAGCAGGAGGACGGCGG - Exonic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
992899350 5:81277751-81277773 CACCAGCAACGGAACGAAGGTGG + Intergenic
992959697 5:81946367-81946389 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
993117018 5:83731816-83731838 TAAGAGCAACAGAAGAAAAGAGG + Intergenic
993189985 5:84669435-84669457 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
993190247 5:84671424-84671446 CAGGAGGAAGAGAATGAAAGAGG - Intergenic
994060884 5:95475427-95475449 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994160046 5:96547346-96547368 CATAAGAACCAGAAGGAAGGAGG + Intronic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995309403 5:110693426-110693448 CACCAGCAACAGAAGAAAGCTGG + Intronic
995651622 5:114376237-114376259 AAGTAGCCACAGAAGGAAAGGGG + Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995856062 5:116593584-116593606 CAGGAACATCAGAAGCAAGCGGG - Intergenic
997044620 5:130299364-130299386 TTTGAGCAACAGAAGGATGGTGG + Intergenic
997068852 5:130594912-130594934 CAGGAGCAAGAGAGAGAAGGTGG - Intergenic
997273624 5:132563902-132563924 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
997456030 5:134018243-134018265 CAGGAGCAAGGGAGAGAAGGAGG + Intergenic
997716387 5:136046309-136046331 CAGGAGCAGAAGACAGAAGGAGG - Intronic
997851458 5:137336605-137336627 CAGGAGCTAGAGAATTAAGGGGG - Intronic
997854199 5:137358497-137358519 AAGGAGAGACAGAAGGGAGGAGG + Intronic
998186368 5:139982836-139982858 CAGGGGCAGCAGAATGAATGGGG + Intronic
998405101 5:141869740-141869762 AAGGAGGAAAAGAAGGAAAGAGG - Intronic
998410463 5:141906692-141906714 GAGGAGGAAGAGAAAGAAGGAGG + Intergenic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998803965 5:145900272-145900294 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
998880265 5:146638226-146638248 GAGTAGCAACTGAAGGGAGGTGG - Intronic
998930235 5:147173481-147173503 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999153116 5:149439999-149440021 AAGGAGCACAGGAAGGAAGGTGG - Intergenic
999175706 5:149630402-149630424 CAGGAGCAACAGAAAGGATCTGG + Intronic
999195936 5:149781693-149781715 TGGGAGCAACAGAATGATGGGGG + Intronic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
999329381 5:150662315-150662337 CAGGAGGAAGAGAAGGGACGAGG + Intronic
999383165 5:151136003-151136025 CAGAAGCAATGGCAGGAAGGAGG + Intronic
999445429 5:151634964-151634986 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
999867663 5:155718957-155718979 CACCAGCAACAGAAGAAAGCTGG - Intergenic
999971576 5:156869093-156869115 CAGAAGCAAGAGAGTGAAGGAGG - Intergenic
1000071533 5:157744422-157744444 TAGGAGCAACAGAGGGAGAGTGG + Intronic
1000106699 5:158066748-158066770 CAGGAACAAGAGAGAGAAGGGGG + Intergenic
1000770312 5:165344806-165344828 AAGGAGGGAGAGAAGGAAGGGGG + Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001489945 5:172148267-172148289 CATGATCAACTGAAGGAATGAGG + Intronic
1001802760 5:174558454-174558476 AAGGAGGGAAAGAAGGAAGGAGG - Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002641850 5:180634187-180634209 CGGGAGGGAAAGAAGGAAGGAGG - Intronic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1002857700 6:1052685-1052707 CAAGTGCATCAGAAGGATGGGGG - Intergenic
1003019732 6:2499252-2499274 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1003490121 6:6613838-6613860 GAGGAGTGACTGAAGGAAGGCGG - Intronic
1003652985 6:7978357-7978379 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1003973432 6:11321138-11321160 AGGGAGGGACAGAAGGAAGGAGG + Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004076990 6:12352718-12352740 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1004168525 6:13277446-13277468 CAGGAACAAGACAAGGCAGGAGG - Intronic
1004201152 6:13549226-13549248 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1004284484 6:14308067-14308089 CAGGAGCCAGAGAAAGAGGGTGG - Intergenic
1004317538 6:14603245-14603267 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1004627447 6:17390200-17390222 CAGGAGCAAGGGGAGGAGGGAGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005550768 6:26912233-26912255 AAGGAGGAAGAGAAGTAAGGGGG - Intergenic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006199716 6:32277162-32277184 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1006394532 6:33778459-33778481 CAGGAGGAAGCGAAGGAAAGTGG + Intronic
1006548983 6:34804716-34804738 CAGTAGCAACTGAAGGCAGCAGG - Intronic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1006881096 6:37340868-37340890 CAGCAGCAGCAGAAGGCAGTGGG - Intergenic
1007188887 6:39996868-39996890 CAAGAGGAAAAGAAGGAAGCTGG - Intergenic
1007591000 6:43020965-43020987 CAGGAGCAGCTGAAAGGAGGTGG - Exonic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008916794 6:56796773-56796795 AAGGAGGGAGAGAAGGAAGGAGG + Intronic
1008932366 6:56954513-56954535 CAGAAGCAACAAGAGGAAGAGGG + Intronic
1009399532 6:63237879-63237901 CAAGAGAGACAGTAGGAAGGGGG + Intergenic
1009449478 6:63784592-63784614 CAGGAGGAAAAGAGTGAAGGGGG + Intronic
1009544238 6:65003992-65004014 CAGGAAGAAAAGAAGGAAAGAGG - Intronic
1010472217 6:76242183-76242205 CAGGAGGAAAAGAGAGAAGGGGG - Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1011848800 6:91600719-91600741 CAGGAGGAAGAGAGTGAAGGTGG - Intergenic
1011849019 6:91602975-91602997 CAGGAGCATGAGAGAGAAGGGGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1012525009 6:100166875-100166897 CAGGAGCAGCACCAGGAATGTGG - Intergenic
1012763672 6:103335622-103335644 CAGGAGCAACAGAGTGAAGGAGG + Intergenic
1012848029 6:104414091-104414113 ATGGAGCAACAGAAAGGAGGTGG + Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013487015 6:110606930-110606952 CAGGAGGAAGAGATCGAAGGGGG + Intergenic
1013731287 6:113170577-113170599 CAGGAGCAAGAGAGAGAAAGGGG - Intergenic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015019844 6:128459958-128459980 CAGGACCAAGAGAAAGAAGTGGG + Intronic
1015323345 6:131900602-131900624 CAGAGGCAACAAAAGGAATGGGG - Intergenic
1015347141 6:132174004-132174026 CAGGAGAGAGAGACGGAAGGGGG + Intergenic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015383987 6:132601030-132601052 AAGGAGGGAAAGAAGGAAGGAGG + Intergenic
1015715784 6:136190984-136191006 CTGGAGCTAAAGAAGGCAGGCGG - Intronic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1016543606 6:145195349-145195371 CAGGAGGAAGAGAACAAAGGGGG + Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016996237 6:149964069-149964091 CGGGAGGCACAGAAGGAACGCGG - Exonic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017062985 6:150503777-150503799 CAGGAGCAACAGCGAGACGGGGG + Intergenic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1017570591 6:155740986-155741008 AAGGAGGGAAAGAAGGAAGGGGG - Intergenic
1017940146 6:159045584-159045606 CAGGAGTTACAGAAAGGAGGAGG - Intergenic
1018082602 6:160271296-160271318 GAGAGGCAACAAAAGGAAGGAGG - Intronic
1018114077 6:160565643-160565665 CACGAGCAACAGAACAAAGCTGG + Intronic
1018115167 6:160576229-160576251 GAAGAGCAAAAGCAGGAAGGCGG - Intronic
1018855379 6:167670650-167670672 CAGGAGGAAGAGAAGGGATGAGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019975052 7:4574459-4574481 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020890884 7:13876563-13876585 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021206274 7:17785198-17785220 CAGGAGCAAGAGAGAGGAGGGGG + Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021842954 7:24736102-24736124 CAGGAAGAAAAGAAAGAAGGAGG + Intronic
1022343211 7:29487653-29487675 AAGGAGAAAAAGAAGAAAGGAGG - Intronic
1022437440 7:30403038-30403060 CAGGAGCAACAGAGGGCGAGGGG - Intronic
1022474098 7:30699255-30699277 CAGGGGCCACCGATGGAAGGTGG - Intronic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023275538 7:38515411-38515433 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1024226637 7:47330584-47330606 CAGCAGAAACAAAAGGACGGAGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024895042 7:54249213-54249235 CAGGAGCAAGAGAACGAGGCGGG + Intergenic
1025049298 7:55721031-55721053 CAGGAGCAAGAGAGAGAGGGTGG - Intergenic
1025528236 7:61843046-61843068 CACCAGCAACAGAACGAAGCTGG - Intergenic
1025887756 7:65614442-65614464 GAGGAGGAAGAGAAAGAAGGAGG - Intergenic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026054281 7:66971084-66971106 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1026058536 7:67006250-67006272 CAGGAACAAGAGAGAGAAGGAGG - Intronic
1026069368 7:67104379-67104401 CAGGAGGAAGAGAATGAAGGGGG + Intronic
1026121328 7:67540524-67540546 CAAGAACAACAAAAAGAAGGTGG - Intergenic
1026154541 7:67815703-67815725 GAGGAGGAAGAGAAGAAAGGAGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026299003 7:69081154-69081176 CAGGAGCAAAGGAACCAAGGTGG - Intergenic
1026302794 7:69112377-69112399 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1026595760 7:71733058-71733080 AAGGAGCAAGGGAAGGAGGGAGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026650020 7:72209025-72209047 AAGGAGAGAGAGAAGGAAGGAGG - Intronic
1026707535 7:72707939-72707961 CAGGAGGAAGAGAATGAAGGGGG - Intronic
1026719551 7:72818769-72818791 CAGGAACAAGAGAGAGAAGGAGG + Intronic
1026879717 7:73900792-73900814 GAGGAGCAGGAGAAGAAAGGGGG - Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028110087 7:86929864-86929886 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1029165277 7:98584864-98584886 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
1029174503 7:98655038-98655060 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1029174719 7:98656446-98656468 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1029510021 7:100988343-100988365 CAGGAGCAAGAGAGGCAAAGAGG - Intronic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1029938457 7:104453818-104453840 CAGGAGCAAGTGAGGGAAGTGGG - Intronic
1030440039 7:109577867-109577889 CATCATCAACAGAAAGAAGGAGG - Intergenic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1030921537 7:115395593-115395615 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1031878069 7:127164140-127164162 CAGGAGCAAGAGAGTGAGGGGGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032427969 7:131837008-131837030 TGGGAGCAACCAAAGGAAGGCGG - Intergenic
1032536505 7:132668964-132668986 CAGGAGCAAGAGAGAGATGGAGG + Intronic
1032891555 7:136200118-136200140 CAGGAGCCACAGAGAGAATGTGG + Intergenic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033300392 7:140179475-140179497 CAGGAGCAAAAGAGAGAGGGAGG - Intergenic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1033985953 7:147225836-147225858 AAGGAGGGAAAGAAGGAAGGAGG + Intronic
1033985957 7:147225852-147225874 AAGGAGGGAAAGAAGGAAGGAGG + Intronic
1034121627 7:148633225-148633247 CAGGAGCAATAGAGGAAAGGGGG - Intergenic
1034282389 7:149863314-149863336 GAGCAGCAACAGCCGGAAGGAGG - Intronic
1034282397 7:149863369-149863391 GAGCAGCAACAGCCGGAAGGAGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034490575 7:151391166-151391188 GAGAAGCCACAGAAGGCAGGAGG + Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035120870 7:156565504-156565526 AAGGAGCAAAGGAAGGAAGTGGG + Intergenic
1035180504 7:157085965-157085987 AAGGAGGAAGAGAAGAAAGGGGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035587830 8:789348-789370 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1035776588 8:2191868-2191890 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036123968 8:6046456-6046478 AAGGAGGAAGAGAAGAAAGGAGG + Intergenic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1036188836 8:6650833-6650855 GAGGAGAGAGAGAAGGAAGGAGG - Intergenic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036405576 8:8451990-8452012 GAGGAGGAAGAGAAGGAAAGGGG + Intergenic
1036460818 8:8950871-8950893 CAGCAACAACAAAAGGCAGGGGG + Intergenic
1036637966 8:10564558-10564580 AAAGAGCAAGAGAAGGAATGGGG + Intergenic
1037300273 8:17444103-17444125 CGGGAGGAAGAGGAGGAAGGGGG - Intergenic
1037441055 8:18916569-18916591 CAGGGGCTACAGCAGGGAGGAGG + Intronic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037627018 8:20617189-20617211 CTGCAGCACCAGAAGTAAGGTGG + Intergenic
1037909917 8:22738218-22738240 GAGCAGCGAGAGAAGGAAGGAGG - Intronic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1038037035 8:23695147-23695169 CAGCAGGAAGAGAAGGAAAGTGG + Intergenic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038653479 8:29427414-29427436 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1038870063 8:31484028-31484050 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1038959397 8:32502225-32502247 CAGGAGCAACAGAGGGTAAGGGG + Intronic
1039081724 8:33740158-33740180 AAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1039886285 8:41655933-41655955 AGGGAGCAAGAGAAGGAGGGCGG - Intronic
1040390237 8:46943267-46943289 CACCAGCAACAGAAGAAAGCTGG + Intergenic
1040676368 8:49756034-49756056 CAGTAACAACAGCAGGGAGGAGG - Intergenic
1041223350 8:55673660-55673682 CAGGAGCAAGAGAAAGGAGTGGG + Intergenic
1041291156 8:56310088-56310110 AAGGAGGAAGAGGAGGAAGGAGG + Intronic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1041411412 8:57560521-57560543 AAGGAGAAAGAGAAGGGAGGAGG - Intergenic
1041466242 8:58160189-58160211 CATAAGCATCTGAAGGAAGGAGG - Intronic
1041706420 8:60850971-60850993 GATAAGCAAAAGAAGGAAGGGGG - Intronic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041953610 8:63533127-63533149 GAGGAGAAAAGGAAGGAAGGTGG - Intergenic
1042230052 8:66545799-66545821 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042324013 8:67509030-67509052 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1042665024 8:71195169-71195191 CAGGAGCAAGAGAAGAAATGGGG - Intergenic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1043085676 8:75828199-75828221 CAGGAGCTAGAGAGTGAAGGGGG - Intergenic
1043577429 8:81674173-81674195 CAGGAGGAAGAGAAGTAAGGTGG - Intronic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044079657 8:87867801-87867823 CAGGAGCACCAGGTGGGAGGAGG + Intergenic
1044574680 8:93754982-93755004 GAGGAACAACAGAAGGAACGCGG - Exonic
1044636698 8:94332338-94332360 GAGGAGCAAGAGAAAGACGGGGG + Intergenic
1045370142 8:101514894-101514916 AAGGAGGAAGAGAAGAAAGGGGG - Intronic
1045889280 8:107135194-107135216 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1045957031 8:107920115-107920137 TAGGAGGAAGAGAAAGAAGGAGG + Intronic
1046258934 8:111740719-111740741 CTGGAGGAACAAAAGGAATGAGG - Intergenic
1046273488 8:111926104-111926126 CAGGAGGAAGAGGAGGAATGAGG + Intergenic
1046735292 8:117769657-117769679 CAGGAGGAAGAGAAAGAAGGGGG - Intergenic
1047511611 8:125520256-125520278 GAGGAGCCACAGGAGGAAGGAGG + Intergenic
1047735626 8:127762550-127762572 CAAGAACAACAAGAGGAAGGAGG + Intergenic
1047813274 8:128433928-128433950 AAGGAGCAAGAGGTGGAAGGGGG - Intergenic
1047838037 8:128715346-128715368 CACCAGCAACAGAACAAAGGTGG + Intergenic
1047843873 8:128785009-128785031 CAGGAGGAAGAGAATGAAGTGGG + Intergenic
1047937870 8:129799741-129799763 CAGGAGGAAGAGAGAGAAGGAGG + Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048551911 8:135441433-135441455 AGGGAGCCACAGGAGGAAGGAGG + Intergenic
1048592487 8:135833631-135833653 AAGGAGCAAGGTAAGGAAGGAGG - Intergenic
1048993367 8:139774311-139774333 CAGGAGAAACCGGAGGATGGAGG + Intronic
1048993711 8:139776000-139776022 CAGAAGCAACAGAAGCTGGGAGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049102319 8:140588625-140588647 AAGGAGGAAGGGAAGGAAGGAGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1050676816 9:8064961-8064983 CAGGACCAAGAGAGGGAAAGGGG - Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051136013 9:13922383-13922405 CTGGAGCAAGAGGAGAAAGGAGG - Intergenic
1051491714 9:17674016-17674038 CAAGAGCCACACAAGGAAAGAGG - Intronic
1051654803 9:19369233-19369255 CAGGTACAACAGAAGGAACCTGG - Intronic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052189429 9:25641211-25641233 CAGGGGCAACAGAAAGAATTAGG - Intergenic
1052415513 9:28172060-28172082 CAGTAGCCACAGCAGGAAAGTGG - Intronic
1052502808 9:29314111-29314133 CGGGAGGAAGAGAAGGAGGGAGG + Intergenic
1053198650 9:36137986-36138008 AGGGAGGAACAGAGGGAAGGAGG - Intronic
1053286956 9:36855838-36855860 CATGAGGAAGGGAAGGAAGGTGG - Intronic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1055644141 9:78346894-78346916 GGGGAGCAACAGGAGGCAGGTGG + Intergenic
1056006364 9:82275793-82275815 GAGGAGGAAAACAAGGAAGGTGG - Intergenic
1056342722 9:85653529-85653551 CAGTAGTAACACCAGGAAGGAGG - Intronic
1056450951 9:86716294-86716316 CAGGACTAACAGAATGATGGGGG - Intergenic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1057423490 9:94930033-94930055 CAGGACCTTCAGCAGGAAGGTGG + Intronic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1058189118 9:101891549-101891571 CAGGAGCAAGAGAGAGCAGGGGG + Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058454917 9:105130041-105130063 GAGGAAGAACAAAAGGAAGGAGG + Intergenic
1058539138 9:105993653-105993675 CACTAGCAACAGAATGCAGGCGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1059372031 9:113849208-113849230 AAGGAGGAAAAGAAGGAATGGGG - Intergenic
1059444026 9:114327229-114327251 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059445233 9:114334008-114334030 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1059612794 9:115917157-115917179 CAGGAGCATGAGAGAGAAGGGGG + Intergenic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1059855525 9:118393070-118393092 CAGGAGCAAGAGAGAGAAGGAGG - Intergenic
1060257582 9:122046281-122046303 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060594831 9:124841572-124841594 CAGGAGCAAGGGAAGAATGGGGG + Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060906442 9:127311299-127311321 CAGGGGTAACAAAAAGAAGGGGG + Intronic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062678082 9:137760063-137760085 CAGCAGCAACAGGAGGCAGAGGG + Intronic
1203444728 Un_GL000219v1:44749-44771 AAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1185524944 X:770361-770383 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1185591525 X:1280644-1280666 GAGGAGGAAGAGGAGGAAGGGGG - Intronic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185806330 X:3060428-3060450 CACGAGCAACGGAAGAAAGCTGG + Intronic
1186045503 X:5532541-5532563 AAGGAGCAACAGAAAGGAAGAGG + Intergenic
1186145783 X:6622114-6622136 ATGGAGGGACAGAAGGAAGGAGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186830997 X:13390116-13390138 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187891264 X:23937133-23937155 CAGGAACAACTGAAGGGAGAGGG + Intronic
1187912098 X:24120524-24120546 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188115456 X:26237996-26238018 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1188163223 X:26828221-26828243 AAGGAGGGAAAGAAGGAAGGGGG - Intergenic
1188260660 X:28019190-28019212 CAGGAGGAAGAGAAAGAGGGTGG + Intergenic
1189060824 X:37751901-37751923 CAGGAGCAAAAGAGGGACGGGGG + Intronic
1189139868 X:38592049-38592071 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1189188037 X:39070780-39070802 CAGGAGGAAAAGAAGGTTGGGGG - Intergenic
1189279725 X:39812664-39812686 CAGGAGCAACTTAAGAAAGTAGG + Intergenic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1189382996 X:40515175-40515197 CAGGAGGAAGAGAAAAAAGGGGG + Intergenic
1189424022 X:40882107-40882129 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1190087759 X:47410577-47410599 CATGAGCTGCACAAGGAAGGGGG - Intronic
1190113215 X:47608625-47608647 AGGGAGCAACAGGAGGGAGGGGG + Intronic
1190577202 X:51852119-51852141 CAGGAGCCAAGGAAGGTAGGTGG - Intronic
1190966026 X:55302666-55302688 CACCAGCAACAGAAGAAAGCTGG - Intergenic
1191023856 X:55892453-55892475 CAGGAGAAAGGGAAAGAAGGAGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191995967 X:67095349-67095371 CAAGAGCAAGAGAGAGAAGGTGG - Intergenic
1192314231 X:70039561-70039583 AGGCAGCAACAGAAGGAAGATGG + Intergenic
1192525772 X:71842944-71842966 CACCAGCAACAGAACAAAGGTGG - Intergenic
1192668882 X:73117895-73117917 CACAAGCAACAGAACGAAGCTGG + Intergenic
1192941253 X:75913763-75913785 CAGGAGCAAAATAGAGAAGGGGG + Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193045331 X:77047214-77047236 CACTAGCAACAGAACAAAGGTGG + Intergenic
1193333105 X:80257085-80257107 TAGGAGGAACAGAGAGAAGGGGG - Intergenic
1193498842 X:82247407-82247429 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1193558284 X:82984299-82984321 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1193758254 X:85435294-85435316 CAGGAGCAAAAGAGAGATGGGGG - Intergenic
1193861266 X:86671539-86671561 CAGGAGGAACAGAGTAAAGGGGG - Intronic
1194064049 X:89240505-89240527 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194944585 X:100051884-100051906 CACCAGCAACAGAACGAAGCTGG + Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1196496327 X:116328670-116328692 CAGGAGCAAGAAAGAGAAGGGGG - Intergenic
1196630644 X:117935621-117935643 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1197101446 X:122660793-122660815 CAGGAGCCAAAGAAGGCAAGAGG - Intergenic
1197524046 X:127539605-127539627 CAGGAGCAAGAGAAATAAGTTGG + Intergenic
1197558725 X:127991470-127991492 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1197667351 X:129238272-129238294 CAGGAGCAAGAGAAAGAGAGTGG + Intergenic
1197915603 X:131530958-131530980 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198081265 X:133242029-133242051 CAGGAGGAAGAGAGCGAAGGGGG + Intergenic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198762234 X:140044521-140044543 CAGAAGCAAAAGAATGAAGCTGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1198979106 X:142374572-142374594 CAGGAGCAAGAGAGGGAGCGGGG - Intergenic
1199151658 X:144494200-144494222 CTGGAGCTACAGCAGTAAGGGGG - Intergenic
1199273953 X:145920963-145920985 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1199387132 X:147236085-147236107 AAGGAGCAACTGAAGGGAAGTGG + Intergenic
1199679477 X:150215288-150215310 AGGGAGAAACAGAGGGAAGGAGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199751550 X:150824134-150824156 GAGGAGGAGAAGAAGGAAGGAGG + Intronic
1199993400 X:153003127-153003149 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
1200050437 X:153426868-153426890 CAGGAGCAAGAGAGAGAAAGGGG - Intergenic
1200246999 X:154531724-154531746 CCAGCCCAACAGAAGGAAGGAGG - Exonic
1200273357 X:154709136-154709158 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1200335970 X:155351852-155351874 CAGGAGAGACAGAAGGTAAGGGG - Intergenic
1200350500 X:155489375-155489397 CAGGAGAGACAGAAGGTAAGGGG + Intergenic
1200377354 X:155797326-155797348 CAGGAGCAACAGCAAAAAGGGGG + Intergenic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1200718224 Y:6574604-6574626 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1200738876 Y:6831571-6831593 CAGGAAGAAAGGAAGGAAGGAGG - Intergenic
1200957525 Y:8967103-8967125 GAGGAAGGACAGAAGGAAGGAGG - Intergenic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201461674 Y:14232562-14232584 AAGAAGCAGAAGAAGGAAGGAGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1201626734 Y:16023453-16023475 CACCAGCAACGGAAGGAAGCTGG - Intergenic
1201728394 Y:17180279-17180301 CAGGAGCAAGAAAGAGAAGGGGG - Intergenic
1202043532 Y:20713028-20713050 CAGATGCATCAGAAGGAAGCTGG - Intergenic
1202598582 Y:26569395-26569417 CAGGAACAACAGAAGAATGACGG + Intergenic