ID: 1101022799

View in Genome Browser
Species Human (GRCh38)
Location 12:100571099-100571121
Sequence AGGTGCTGCAGCTGAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 3, 2: 46, 3: 148, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101022797_1101022799 -2 Left 1101022797 12:100571078-100571100 CCAAGGAAGAAAGTTTTAATCAG 0: 1
1: 6
2: 70
3: 161
4: 476
Right 1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG 0: 1
1: 3
2: 46
3: 148
4: 453
1101022795_1101022799 23 Left 1101022795 12:100571053-100571075 CCAAAGACTGATATGACAAGTAC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG 0: 1
1: 3
2: 46
3: 148
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101022799 Original CRISPR AGGTGCTGCAGCTGAAAAGA TGG Intergenic
900731165 1:4261542-4261564 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
901258254 1:7850633-7850655 AGGAGCTGCTGGGGAAAAGAAGG + Intronic
902033166 1:13437553-13437575 AGGTGCTGAAGCTGAGGAAATGG + Intergenic
903039057 1:20514804-20514826 CAGTGCTGCAGCTGAGGAGATGG + Intergenic
903353612 1:22732828-22732850 AGATGCTGCTGGTAAAAAGATGG - Intronic
904320088 1:29690909-29690931 AGGTCCTGGAGCTGAGGAGATGG + Intergenic
904368330 1:30032501-30032523 AGGTGCTACAGCTGAGGAGATGG - Intergenic
904941593 1:34167394-34167416 AAGTTCTGGAGCTGAGAAGAGGG - Intronic
905661582 1:39730366-39730388 AGGTGCTGCGGCTGAGAAGATGG - Intronic
905766800 1:40608188-40608210 GGGTGCTGCAGCCAAGAAGATGG + Intergenic
906099678 1:43251260-43251282 AGGTGCTGCAGCCAAGGAGATGG + Intronic
906732347 1:48093872-48093894 AGGTGCTGCATCGGAAACGCAGG + Intergenic
907049281 1:51318648-51318670 ACAAGCTGGAGCTGAAAAGAAGG + Intronic
907701838 1:56796366-56796388 AGCTGCGGCAGCTGAAAAATGGG - Intronic
907775330 1:57508462-57508484 AGGTGCTGCTATTGAGAAGATGG - Intronic
907887629 1:58607735-58607757 AGGTGTTTCAGCTGTAATGATGG + Intergenic
907907636 1:58798947-58798969 AGGAGCAGCAGCTGAGGAGAAGG - Intergenic
909944471 1:81648405-81648427 AAGAGCTGCTGCTGAAAAGGAGG - Intronic
909944769 1:81650968-81650990 AAGTGCTTCAGTTGCAAAGAAGG + Intronic
911137076 1:94452469-94452491 AGGAGATGAACCTGAAAAGAAGG + Intronic
911547422 1:99235474-99235496 AGTTTCTGCATCTGAAAAGTAGG - Intergenic
911548492 1:99251005-99251027 AGGTGCTACAGCTGAGGAAACGG + Intergenic
913147251 1:116004164-116004186 GGGTGCTGCAGCCAAAGAGATGG - Intronic
913568927 1:120101025-120101047 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
913607301 1:120477799-120477821 GGGTGCTGCAGCTGAGTAGACGG + Intergenic
913666023 1:121049556-121049578 AGGAGCTGCAGCCGCACAGATGG - Intergenic
914000427 1:143690073-143690095 GTGTGCTGCAGCTGAGGAGACGG - Intergenic
914017421 1:143832832-143832854 AGGAGCTGCAGCCGCACAGATGG - Intergenic
914197724 1:145458172-145458194 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914234611 1:145797259-145797281 GGGTGCTGTAGCTGAGGAGAGGG - Intronic
914289736 1:146262016-146262038 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
914319474 1:146545222-146545244 AGATGCTGCAGTTGGAGAGAGGG + Intergenic
914476828 1:148031283-148031305 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914503389 1:148266560-148266582 GGGTGTTGCAGCTGAGGAGATGG + Intergenic
914510373 1:148327368-148327390 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914550780 1:148712799-148712821 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
914656031 1:149741364-149741386 AGGAGCTGCAGCCGCACAGATGG - Intergenic
915314229 1:155018838-155018860 AGGAGCTGGATCTGAACAGATGG - Intronic
915476911 1:156158435-156158457 AGGTGCCGCAGGTGTAGAGATGG - Exonic
916208035 1:162334286-162334308 AAGTGCTACAACTGGAAAGATGG + Intronic
917579788 1:176364270-176364292 AGGGCCTGCAGCTGTAAAGATGG + Intergenic
918362706 1:183775110-183775132 GGGTGCTGCAGCTGAGGAGATGG - Intronic
919152300 1:193716784-193716806 TGATGCTGCTGCTGAAAACATGG - Intergenic
919165760 1:193889373-193889395 AGGTGCTGCAGCCCAGGAGATGG - Intergenic
919178209 1:194047174-194047196 AGGTACTGCAGATGAGGAGATGG + Intergenic
920850383 1:209624345-209624367 TGGAGCTGCAGCTGTACAGATGG - Intronic
921724125 1:218505798-218505820 GGGTGCTGCAGCTGAGGAAATGG + Intergenic
922058588 1:222065400-222065422 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1063427355 10:5960612-5960634 CCGTGCTGCAGCTGAGAGGAGGG - Intronic
1063563047 10:7147712-7147734 AGGGGCTGCACCTGGAAGGAGGG - Intergenic
1063563111 10:7147958-7147980 AGGGGCTGCACCTGGAAGGAGGG - Intergenic
1063563185 10:7148245-7148267 AGGGGCTGCACCTGGAAGGAGGG - Intergenic
1065165863 10:22976308-22976330 AGGTGCAGCAGGTGAAATGATGG - Intronic
1065301711 10:24328164-24328186 AGGTGCTGCAGCCAAGGAGATGG + Intronic
1065835773 10:29656760-29656782 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1065837947 10:29676182-29676204 AGGTGCTGCAGGTGAGGAGATGG - Intronic
1065983259 10:30924275-30924297 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1066279244 10:33898963-33898985 GGGTGCTGCAGCTGAGGAGCTGG - Intergenic
1066617021 10:37305521-37305543 GGGAGGTGCAGGTGAAAAGAGGG + Intronic
1067751585 10:48975290-48975312 GGGGGCTGCAGCTGAAAAATTGG + Intronic
1068212035 10:53932839-53932861 GGGTGCTGCAGCTGAGGACATGG + Intronic
1068215437 10:53977126-53977148 AGGTGCTGCAGCCCAGGAGATGG - Intronic
1068245483 10:54360363-54360385 AGGTGCTTCAGCCAAAAAGATGG - Intronic
1068334115 10:55608664-55608686 AGGTGCTGCAGCCGAGGAAATGG + Intronic
1068655865 10:59575939-59575961 AGCAGCTGCAGCTTCAAAGATGG - Intergenic
1068700633 10:60015934-60015956 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1069024717 10:63527210-63527232 AAGAGATGAAGCTGAAAAGAAGG - Intronic
1069911151 10:71760725-71760747 ATGTGCAGCAGCAGAAAAGGAGG + Intronic
1070293485 10:75138341-75138363 ATGTCCTGCAGCTGATAAGTTGG + Intronic
1070396222 10:76013239-76013261 TGGGGCTGCAGCAGTAAAGAAGG - Intronic
1070825354 10:79387526-79387548 AGGGGCTCCAGCTGAACAGAAGG - Intronic
1070973693 10:80588134-80588156 AGGTGCTGCAGCTGAGGAGATGG + Intronic
1071056211 10:81510771-81510793 GGGTGCTGCAGGTGAGGAGATGG - Intergenic
1071073517 10:81724712-81724734 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1071403611 10:85304865-85304887 GGATGCTGCAGCTGAAGAGACGG - Intergenic
1072417905 10:95264148-95264170 AGGTGTTCCAGCTGCTAAGATGG + Intronic
1072748691 10:97960294-97960316 ATGTGATGCTGCTGACAAGAGGG - Intronic
1072877045 10:99183637-99183659 GGGTGCTGCAGTTGAGGAGATGG - Intronic
1073260379 10:102185449-102185471 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
1073773111 10:106756981-106757003 AGGTGCTGCAGCCAAGGAGACGG - Intronic
1075307898 10:121384146-121384168 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1075705449 10:124497584-124497606 AGGGGCTGCAGCTGTGAGGATGG - Intronic
1076280440 10:129242169-129242191 AGAGGCTGCAGGTGACAAGATGG + Intergenic
1076736217 10:132460303-132460325 GGGGGCTGCAGCTGAAAAGTGGG + Intergenic
1076818573 10:132926833-132926855 AGTTGGTGTAGCTGAAAACACGG - Intronic
1077293168 11:1809723-1809745 GGGTGCTGCAGCTGAGGTGATGG + Intergenic
1077555446 11:3223911-3223933 AGATGCTGCCGTTGAAGAGATGG + Intergenic
1078445193 11:11398961-11398983 GGGAGCTGGAGCTGAAAGGAAGG + Intronic
1078516428 11:12026592-12026614 GGGTGCTGCAGCTGAGGATATGG + Intergenic
1079570768 11:21940938-21940960 AGGTGCTGCAGCAGAGGAGTTGG - Intergenic
1079723356 11:23847255-23847277 GGGTGCTGCAGCAAAAGAGATGG - Intergenic
1079896085 11:26119933-26119955 AGTTTCTGCATCTGTAAAGATGG + Intergenic
1079958455 11:26892932-26892954 AGGTCCTGCAGATGACTAGAAGG - Intergenic
1080599398 11:33807756-33807778 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1080850264 11:36062477-36062499 AGGTGCTGCAGCTTAGGAGATGG + Intronic
1081119384 11:39246679-39246701 AGGTGCTACAGCTGAGGTGATGG + Intergenic
1081130561 11:39373829-39373851 GGGTGCTACAGCTGAGGAGATGG - Intergenic
1081136346 11:39444214-39444236 AGGTGCTGCAGCTGAGAAGATGG - Intergenic
1084865431 11:72052452-72052474 AGGTGCATCAGATGATAAGAAGG + Intronic
1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG + Intergenic
1086721873 11:90130612-90130634 AGGGACTGCAGCTGTAAATAAGG + Intergenic
1086750115 11:90482321-90482343 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1086981250 11:93199775-93199797 AAGTGCTGCAGTTGCAAAGAAGG - Intergenic
1087384208 11:97448987-97449009 AGGTGCTACAGCTGAAAAGATGG - Intergenic
1087416458 11:97862242-97862264 AGGTGCTGCAGCTGAGTAGACGG + Intergenic
1087430441 11:98046731-98046753 AGGTTCTGGACCTAAAAAGAGGG - Intergenic
1087482852 11:98722912-98722934 AAGTTCTGCAGCTGAGGAGATGG + Intergenic
1087486904 11:98769206-98769228 AGGTGCTGCAGCTGAGCAAATGG + Intergenic
1088468027 11:110162877-110162899 AGGTGGAGCAGCTGAGAAGAAGG - Intronic
1088579439 11:111300572-111300594 AGGAGCTGCTGCAGCAAAGACGG + Exonic
1089580140 11:119476554-119476576 AGGTTCTGCAAATGAACAGAGGG + Intergenic
1090059991 11:123456255-123456277 TGGTGCTTCTGCTGACAAGAAGG - Intergenic
1090388684 11:126373233-126373255 AGGTACTGCATCTAGAAAGATGG + Intronic
1091318539 11:134633052-134633074 TGGTGTTGGTGCTGAAAAGAGGG - Intergenic
1091805454 12:3352838-3352860 AGGTCCTGGAGATGAAGAGAAGG + Intergenic
1092200428 12:6578897-6578919 AGGTGCTGCTGATGTAGAGAAGG - Exonic
1092627451 12:10342246-10342268 GGGTGCCGCAGCTGAGGAGATGG - Intergenic
1094436814 12:30430073-30430095 GGGTGCTTCAGCTGAGCAGATGG - Intergenic
1094598517 12:31887596-31887618 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1095923346 12:47553379-47553401 GGGTGCTGCAGCTGAGGGGATGG - Intergenic
1095961430 12:47836817-47836839 AGGTTCTGAAGTTGAAAGGAAGG + Intergenic
1096748887 12:53746369-53746391 AGGAGCTGCAGCTGACACAATGG + Intergenic
1097013310 12:55967952-55967974 AGGTGATCCAGCTGGAAAGGAGG + Intronic
1097083613 12:56451259-56451281 AGAAGCTCCAGCTGAATAGAGGG - Exonic
1097555991 12:61138349-61138371 AGGTGCTGCTGCTGAGGAAATGG + Intergenic
1098435014 12:70459593-70459615 TGGTGCTGCAGCTAAGGAGATGG + Intergenic
1098435481 12:70464156-70464178 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1099065978 12:77979915-77979937 GGGTGCTGCAGCTGAGGAGAAGG + Intronic
1099896527 12:88654611-88654633 GGATGCTGCAGCTGAGAAGATGG - Intergenic
1100068216 12:90677787-90677809 AAGTGCTGCAGCTGAATATAAGG + Intergenic
1100211970 12:92407101-92407123 ATGTGCAGCTGCTGAAAATAAGG + Intergenic
1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG + Intergenic
1101098013 12:101363596-101363618 TGGTGCTGTTGCTGAAGAGAAGG + Exonic
1101907190 12:108836187-108836209 AGGTGCTGCATCAGAATTGAAGG + Intronic
1102082762 12:110111838-110111860 GGGTGCTGCAGCTGAAGTGATGG - Intergenic
1102444869 12:112994275-112994297 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1102709055 12:114909227-114909249 AGACGCTGGAGCTGGAAAGATGG + Intergenic
1102880127 12:116478433-116478455 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1102917653 12:116766682-116766704 TGGTGCTGAAGGTGAAAGGAAGG - Intronic
1103594567 12:122016367-122016389 AAGTGCTGCATCAGAAAGGACGG - Intergenic
1103733579 12:123044253-123044275 GGGTGCTGCTGCTGAAATGGTGG - Intronic
1104012886 12:124944524-124944546 ATGTTCTGCAGCTGATAAAAAGG + Intergenic
1104120102 12:125790796-125790818 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
1104651888 12:130540742-130540764 GGGTGCTGCAGCCAAGAAGATGG - Intronic
1104799577 12:131544654-131544676 AGGAGCTGCAGAAGAAAAGCTGG + Intergenic
1104830503 12:131747626-131747648 AGGTGCTGCAGCTGGAGGGCAGG + Intronic
1106498048 13:30299919-30299941 TGGAGATGTAGCTGAAAAGATGG - Intronic
1107606015 13:42057909-42057931 AGGAACAGCAGCTGCAAAGAGGG + Intronic
1108752051 13:53457772-53457794 GGGTGCTGCAGTTGAGAGGATGG + Intergenic
1108855621 13:54789379-54789401 AGGTGCTGCAGCTGAGGAGACGG + Intergenic
1108871611 13:54993678-54993700 AGGTGCTACAGCTGAGAATATGG - Intergenic
1109119029 13:58430102-58430124 GGGTGCTCCAGTTGAGAAGATGG + Intergenic
1109292034 13:60488118-60488140 GGGTGCTACAGCTGAAGAGATGG + Intronic
1109428824 13:62205166-62205188 GGATGCTGCAGCTGAAGAGATGG + Intergenic
1109698332 13:65992146-65992168 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1111207024 13:85024346-85024368 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1111253917 13:85641035-85641057 AGATGCTGCAGCTGAGGAGATGG - Intergenic
1111290498 13:86162447-86162469 AGGTGCTGCCACTGAAGAGTTGG + Intergenic
1111321825 13:86640996-86641018 AAGGGATGCAGTTGAAAAGAGGG - Intergenic
1111352432 13:87048725-87048747 TGGTGCTGCAGCTGAGGAGATGG + Intergenic
1111430385 13:88142377-88142399 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1111538996 13:89646862-89646884 AGATGCTACAGCTGAGGAGATGG - Intergenic
1111592452 13:90367765-90367787 GGGTTCTGCAGCTGAGGAGATGG - Intergenic
1111847413 13:93529210-93529232 AGGTCCTGCAGTTTGAAAGATGG + Intronic
1112873230 13:104001479-104001501 AGGTGGGGCAGCTGAGAATATGG - Intergenic
1112921140 13:104614304-104614326 GGGTGCTGCAGCTAAAGAGATGG - Intergenic
1113263028 13:108587047-108587069 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1113341388 13:109429576-109429598 GGGTGCTGCAGCCAAGAAGATGG + Intergenic
1113601708 13:111574008-111574030 GGGTGCTGCAGCTGAGGAGACGG + Intergenic
1113619378 13:111702532-111702554 AGGAGCTGCAGCTGGAAACGCGG - Intergenic
1113624907 13:111787793-111787815 AGGAGCTGCAGCTGGAAACGCGG - Intergenic
1113673042 13:112188001-112188023 ATGTCCTGCAGCAGAAATGAGGG + Intergenic
1114128253 14:19756827-19756849 AGGAGATGAGGCTGAAAAGAAGG - Intronic
1114315197 14:21503403-21503425 GGGTGCTGTGGCAGAAAAGAAGG - Exonic
1115082673 14:29476049-29476071 AAGTACTGCAACTAAAAAGAGGG + Intergenic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1117250289 14:53929860-53929882 AGTTTCTCCAGCTGAGAAGAAGG - Intergenic
1117614459 14:57519281-57519303 TGATGCTGCAGCTGGACAGAGGG - Intergenic
1118380079 14:65210408-65210430 GGGTGCTGCAGCTGGGGAGATGG - Intergenic
1118409366 14:65461776-65461798 AGGGGCGGCAGCTGAGAAGATGG + Intronic
1119484358 14:74978310-74978332 TCCTGCTGCAGCTGAAAAAAAGG + Intergenic
1119591091 14:75888608-75888630 AGGTGGTATAGCTTAAAAGAAGG + Intronic
1119681028 14:76592292-76592314 AGCTGCCGCAACTGCAAAGAAGG - Intergenic
1119882572 14:78112728-78112750 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1120313851 14:82866437-82866459 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1120661593 14:87257494-87257516 AGTTTCTGCAGCAGAAAAAATGG - Intergenic
1120704304 14:87731573-87731595 ATCTGCAGCAGCTGCAAAGAGGG - Intergenic
1124001915 15:25767221-25767243 AGGTGCTGCAGCAGAACGTAGGG + Intronic
1124062262 15:26305427-26305449 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124062838 15:26310653-26310675 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124072017 15:26404121-26404143 AGGGCCAGCAGCTGGAAAGAGGG - Intergenic
1124486250 15:30119777-30119799 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124541324 15:30588762-30588784 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124757334 15:32418825-32418847 GGGTGCTGCAGCTAAGGAGATGG - Intergenic
1124937330 15:34185688-34185710 AGGTGCTGCAGCTCAGGAAATGG + Intronic
1125365878 15:38915440-38915462 GGGTGCTGCAGCTGAGGAAATGG - Intergenic
1126522710 15:49614908-49614930 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1126771044 15:52056248-52056270 AAGTGCTACAGCAGGAAAGAGGG - Intronic
1126805054 15:52339887-52339909 AGGATCTGCAGCTGAAATGGAGG + Intronic
1127669391 15:61180746-61180768 AGGTGCTGGAACTCAAAAGTGGG - Intronic
1128382531 15:67123767-67123789 AGGTCCTTCACCTAAAAAGAAGG - Intronic
1129749815 15:78054131-78054153 AGGAGCTTCAGCAGAAGAGATGG - Exonic
1129928299 15:79385477-79385499 AGGTGCTGCACCTGGGAAGGTGG + Intronic
1130187007 15:81693207-81693229 ACATGTTGCAGCTGAAAAGATGG + Intergenic
1130541142 15:84821602-84821624 AGCTGCTGCTCCAGAAAAGATGG - Intronic
1132001713 15:98187218-98187240 AGGTGGTGCTGCTGCAATGATGG - Intergenic
1132842754 16:1986248-1986270 AGGAGCTGCAGCTGAACTGCAGG + Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133857916 16:9566873-9566895 ATGTGATGCAGCTGCAACGAAGG + Intergenic
1133897971 16:9947440-9947462 AGGAGCTGCTGCTGAACTGAAGG + Intronic
1134351896 16:13445265-13445287 AGGTGCTGGAGATGCAAAGAAGG - Intergenic
1134355255 16:13476390-13476412 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1134375609 16:13670052-13670074 TGGTGGTGGAGATGAAAAGAAGG - Intergenic
1134597386 16:15506805-15506827 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1134888426 16:17816302-17816324 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1135075563 16:19390442-19390464 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1135166240 16:20141566-20141588 AGGTCCTGCAGCTCAAGGGATGG + Intergenic
1135205440 16:20480079-20480101 AAGTGCCTCAGCTGAATAGACGG + Intronic
1135213468 16:20543733-20543755 AAGTGCCTCAGCTGAATAGAGGG - Intronic
1135233812 16:20736650-20736672 ATGTGCTGCTGTTGCAAAGAGGG - Intronic
1135921340 16:26651449-26651471 AGGTGATGCAGCTGAGGAGATGG + Intergenic
1136222043 16:28835260-28835282 AGTGGCTGCAGCAGGAAAGAGGG - Exonic
1137875372 16:51991775-51991797 AGGTGCTGGAGTAGACAAGAAGG + Intergenic
1138565186 16:57827978-57828000 AGTTTCTTCACCTGAAAAGAGGG - Intronic
1138742991 16:59332256-59332278 AGGTGCTACAGCTGATGAGATGG - Intergenic
1139189382 16:64843911-64843933 ATGTGCTGAACCTGATAAGAGGG - Intergenic
1139522292 16:67490899-67490921 GGGTGATGCAGGTGAGAAGACGG - Intergenic
1140014049 16:71164859-71164881 AGATGCTGCAGTTGGAGAGAGGG - Intronic
1140019729 16:71226924-71226946 GGGTGCTGCAGCTGTGGAGATGG - Intronic
1140589863 16:76338610-76338632 AGGTGATGCAGATTACAAGAGGG - Intronic
1140718992 16:77753571-77753593 AGGTGCTACAGGTGGAAAGGGGG - Intergenic
1141117735 16:81324888-81324910 AGGTGCTGCAGTTGTTCAGATGG + Intronic
1141206453 16:81936532-81936554 AGGTCCAGCAGCTGAATGGAGGG + Intronic
1141641236 16:85342843-85342865 AGGGGGTGCCGCTGAAAAGGGGG - Intergenic
1141641257 16:85342912-85342934 AGGGGGTGCCGCTGAAAAGGGGG + Intergenic
1141852158 16:86653845-86653867 AGCTGCTGCAGCCGGGAAGATGG - Intergenic
1142115103 16:88352419-88352441 GGGTGCTGCAGGTGCACAGAGGG + Intergenic
1142137230 16:88456974-88456996 AGCTGCTGCAGCTCAGAACAAGG + Intronic
1143463710 17:7121391-7121413 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1143491299 17:7286681-7286703 AAGTGCTGCAGAGGAAAGGAAGG - Exonic
1143620479 17:8077374-8077396 AGGTACTGCAGTTGAGCAGAAGG - Intronic
1144133025 17:12266293-12266315 GGTTTCTGCAACTGAAAAGATGG + Intergenic
1144214744 17:13045361-13045383 AGATGTTTCAGCTGGAAAGATGG + Intergenic
1144608518 17:16688923-16688945 AGATGCTGCAGCCGAGGAGATGG - Intergenic
1144865534 17:18333051-18333073 TGCTGCTGCAGCTGCAATGATGG - Intronic
1144963345 17:19059467-19059489 AGGTGCTGCAGCTGAGGGGATGG + Intergenic
1144964345 17:19066573-19066595 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1144971814 17:19115058-19115080 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1144983621 17:19185571-19185593 AGGTGCTGCAGCTGAGGGGATGG + Intergenic
1144984604 17:19192668-19192690 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1145128289 17:20319845-20319867 AGATGCTGCAGCCGAGGAGATGG - Intergenic
1145196319 17:20897363-20897385 AGATGCTGCAGCCGAGGAGATGG + Intergenic
1146295480 17:31646705-31646727 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
1146295570 17:31647486-31647508 AGGTGCTGCGGCAGAGGAGATGG - Intergenic
1146585405 17:34077730-34077752 AGGGGCTGGAGCTCAAAAGGAGG - Intronic
1147638941 17:41982144-41982166 AGGTCCTTCAGCTGAGAATAAGG - Intronic
1148348998 17:46925428-46925450 AGATACTGCAGCATAAAAGAAGG - Intronic
1149139948 17:53420098-53420120 AGAGGCTGCAGTTCAAAAGATGG + Intergenic
1149257222 17:54840323-54840345 AGATTCTGCAGCTGAAATGTGGG - Intergenic
1149741273 17:59048208-59048230 AGGTAAGGCAGCTGAAAAGTTGG - Intronic
1150968482 17:69999368-69999390 AGGTATGGCAGCTGAAAATATGG + Intergenic
1151100624 17:71551828-71551850 TGGTGCTGGACCTGAGAAGACGG + Intergenic
1153646487 18:7200537-7200559 AGGTGCTGCAACCAAAGAGATGG - Intergenic
1153651975 18:7248856-7248878 AGTTGCTGCAACTGAAACCAGGG - Intergenic
1153939395 18:9964831-9964853 AGGTTCTGCATCTGTAAAAAGGG + Intergenic
1154219516 18:12440099-12440121 AGGTGCAGCAGCTGCAGTGAGGG - Intergenic
1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG + Intergenic
1155790848 18:29968843-29968865 GGATGCTGCAGCTGAGGAGATGG + Intergenic
1156538855 18:37890296-37890318 AGGGGCTGCAGGTTATAAGATGG - Intergenic
1156645681 18:39159631-39159653 GGGTGCTGCAGCTGAGGAGAAGG + Intergenic
1156688775 18:39681304-39681326 AGCTGCTGCTGCTGAAAAATGGG - Intergenic
1156788426 18:40943486-40943508 AGGTCCTGCAGCAGAGGAGATGG + Intergenic
1158226556 18:55207243-55207265 AAGGGCAGCAGCTGGAAAGAGGG + Intergenic
1158692092 18:59669789-59669811 AGGTCCTGCAGCTGAAAGGTGGG - Intronic
1159105103 18:63995832-63995854 GGGTGCTACAGCTGAGGAGATGG + Intronic
1159188793 18:65015226-65015248 AGATGCTACAGCTGAAGAGATGG - Intergenic
1159433960 18:68391773-68391795 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1159669907 18:71210578-71210600 GGGTGCTGCAGCTGAGGAGACGG - Intergenic
1159950276 18:74478050-74478072 AGGTGCTGGAGCTGACAGGAGGG - Intergenic
1160665643 19:326786-326808 AGGTGCAGCAGCTGCATAGAAGG - Intronic
1161832944 19:6623049-6623071 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1161897734 19:7095191-7095213 AGCTGCTGCAGCTGAGGAGGTGG - Intergenic
1162595375 19:11624858-11624880 AGGTTCAGCAGCAGAAAAGCTGG - Intergenic
1165016187 19:32881840-32881862 AGGCGCTGCAGCAGAACAGGTGG - Exonic
1166562873 19:43744923-43744945 AGCTGCTGGAGCTGGAATGAGGG + Intronic
1166812216 19:45521388-45521410 AGGTGGAGCAGCAGAAAAGGTGG + Exonic
1168396163 19:56050563-56050585 AGGTCCTGGAGATGACAAGATGG - Exonic
925396832 2:3539802-3539824 AGATGCTGTGGCTGAAAAGGAGG - Intronic
925841652 2:7997660-7997682 AGGGGCAGCATCTGTAAAGATGG + Intergenic
925931003 2:8707886-8707908 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
926293704 2:11551879-11551901 AAGTGCTACAACTTAAAAGAGGG - Intronic
926353769 2:12021266-12021288 AGGTGCTACAGCTGAGGAGATGG - Intergenic
926569080 2:14509719-14509741 AGGTGCTGCAGCCAAGCAGATGG - Intergenic
926785861 2:16517922-16517944 AGGTGGGGCAGGGGAAAAGAAGG - Intergenic
926817136 2:16810005-16810027 AGTTGCTGGAACAGAAAAGATGG - Intergenic
928472669 2:31589781-31589803 AGAAGCTGCAGCTGAAGGGAAGG + Intergenic
928838737 2:35579693-35579715 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
928840080 2:35595478-35595500 AGGTGCTGCAGCTGAGCAGATGG + Intergenic
928939152 2:36709637-36709659 AGGAGCTGAAGCTTGAAAGATGG + Intronic
929397119 2:41535749-41535771 GGGTGCTGCAGCCAAAGAGATGG - Intergenic
929852132 2:45601878-45601900 AGGTGCTACAGCTGGATAGAGGG - Intronic
929885887 2:45878080-45878102 AGGTGCTGCAGCCAAGGAGATGG - Intronic
930174964 2:48292577-48292599 TGGTCCTGCAGCTGATAAGCGGG - Intergenic
931369510 2:61649326-61649348 GGGTGCTACAGCTGAGAATAGGG + Intergenic
931654573 2:64499295-64499317 AAGTGCTCTAGCTGAAAGGAGGG + Intergenic
931964484 2:67518236-67518258 GGGTGCTACAGCTGAGGAGATGG + Intergenic
932022916 2:68106058-68106080 AGGTGCTGCAGCCAAGGAGAAGG - Intronic
932828868 2:74968818-74968840 GGGGGCTGCAGCAGAAAAGGAGG - Intronic
933320944 2:80774809-80774831 AGGGGCTGCTCCTTAAAAGAGGG + Intergenic
933453570 2:82491632-82491654 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
933463622 2:82621781-82621803 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934130751 2:88946485-88946507 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934132768 2:88965448-88965470 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934135391 2:88991579-88991601 AGGTACTGCAGCCGAGGAGATGG - Intergenic
934137327 2:89009165-89009187 AGGTGCTGCAGCTGTGGAAATGG - Intergenic
934140775 2:89045190-89045212 AGGTGCTGCAGCCGAGGAGACGG - Intergenic
934146418 2:89099046-89099068 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934148145 2:89116529-89116551 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
934221142 2:90084082-90084104 AGGTGCTGTAGCTGAGGAGATGG + Intergenic
934222849 2:90101529-90101551 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
934228459 2:90155352-90155374 AGGTGCTGCAGCCGAGGAGACGG + Intergenic
934233775 2:90211324-90211346 AGGTGCTGCAGCTGAGGAAATGG + Intergenic
934544561 2:95204034-95204056 GGGTGCTGCAGCTGTGAAGATGG - Intergenic
935129873 2:100253644-100253666 AGAGGCTGCAGCTGAAGGGAGGG - Intergenic
935210740 2:100937936-100937958 GGGGGCTGCAGGTGAGAAGAGGG + Intronic
935765649 2:106365104-106365126 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
935794527 2:106628545-106628567 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
935962846 2:108444335-108444357 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
936026282 2:109033463-109033485 AGGTGCTGTAGCTGAGAAGATGG + Intergenic
936467701 2:112767876-112767898 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
937163960 2:119794709-119794731 CGTTGCTGCAGGTGACAAGAAGG - Intronic
937182768 2:120011479-120011501 AGGTGCTGGAGCTGCCAAGGTGG - Intergenic
937468705 2:122157015-122157037 GGGTGCAGCTGTTGAAAAGAGGG + Intergenic
937494648 2:122405230-122405252 ATGTGCTTCAGCAGAAATGAGGG - Intergenic
937783248 2:125864623-125864645 AGGTGCTGCAGTAGAGCAGATGG + Intergenic
938026644 2:127955095-127955117 AGGTGGTGCAGCTGCAATGGTGG + Exonic
938289082 2:130140086-130140108 AGGTGCTGCAGCTGAAAGGCAGG + Exonic
938467447 2:131532852-131532874 AGGTGCCGCAGCTGAAAGGCAGG - Exonic
939568021 2:143807816-143807838 ATGTGCTGCAGTTGAAAACAAGG - Intergenic
939802097 2:146722230-146722252 GGCTGCTGCAGCTGGGAAGATGG - Intergenic
939868283 2:147499307-147499329 TGACCCTGCAGCTGAAAAGAGGG - Intergenic
941309516 2:163911920-163911942 AGGTGCTACAGCTGAGGAAATGG - Intergenic
942386788 2:175451249-175451271 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG + Intergenic
943443970 2:187959850-187959872 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
943451890 2:188052882-188052904 TGGTGCTGCAGCCAACAAGATGG + Intergenic
943551010 2:189339579-189339601 AGATGCTGCAGCTGAGGAGATGG + Intergenic
944856010 2:203767547-203767569 AGGTGCTGCAGCTGAGAAGGTGG - Intergenic
945366988 2:208966328-208966350 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
945680872 2:212912661-212912683 AGTTTCTGCAGCTGAAAAACAGG + Intergenic
946302941 2:218835520-218835542 ATGTGCTGCAGGTGAATTGAGGG - Intergenic
946397964 2:219452803-219452825 AAGTGCTGCAGGAGACAAGATGG + Intronic
946726489 2:222666585-222666607 AGCTGTTGCAACTCAAAAGAGGG - Intergenic
947151070 2:227116065-227116087 AGGTGCTGCAGCTGAGGAGTTGG + Intronic
947483123 2:230521559-230521581 AGGTGCTGCAGCCAAGGAGATGG - Intronic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
948288945 2:236810044-236810066 AGGTACTGCAGTTGAAGAGATGG - Intergenic
948818307 2:240525207-240525229 GGGTGCTGCAGCTGAGGAGCTGG - Intronic
948821592 2:240552141-240552163 TGGAGGTGCAGCTGAAGAGATGG - Intronic
1169337905 20:4772298-4772320 AGGTGCTGCAGCTAAGAAGACGG - Intergenic
1170474149 20:16698288-16698310 CTGTGCTGCAGCTGAGGAGATGG - Intergenic
1171021186 20:21585676-21585698 AGGTGCTGGAGTTGCAAGGATGG - Intergenic
1171032694 20:21691589-21691611 AGGTGGTGAAGTGGAAAAGAGGG + Intergenic
1171285144 20:23930749-23930771 AGGTGCTGCAGCTAAGAAGATGG + Intergenic
1171288194 20:23960810-23960832 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1171357306 20:24557953-24557975 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1171411906 20:24953210-24953232 CGGGGCTGCAGCAGAAAAGCAGG + Intronic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1172855343 20:37997480-37997502 AGATTGTGCAGCTGAACAGAAGG - Intronic
1173061044 20:39661423-39661445 AGTTGCTGCTGCTGACAAAAGGG - Intergenic
1173441686 20:43083057-43083079 GGGCGCTGCAGCTGAGAAGATGG - Intronic
1174543054 20:51304757-51304779 TGGTGCAGCAGCAGAAGAGAAGG + Intergenic
1174787732 20:53448187-53448209 GGGTGCTGCAGCTGAGGAAAGGG + Intronic
1174788439 20:53455073-53455095 AGGTGCTGCAGCTCAGGAGATGG - Intronic
1175158196 20:56988430-56988452 AGGGGCTGCAGCTGAAGCCAAGG - Intergenic
1175527937 20:59648432-59648454 AGGTGCTGAACCAGAAAAGGTGG + Intronic
1175962405 20:62643588-62643610 AGGAGCAGCAGCTGACAAGCTGG - Intronic
1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1177319984 21:19508814-19508836 AGGAGCTGAAGCTGCACAGATGG - Intergenic
1177453011 21:21296517-21296539 TGGAGGTGCAGCTGAAAAGCAGG + Intronic
1177548159 21:22585904-22585926 AGGAGTTGCAGCTGAGGAGATGG - Intergenic
1177640596 21:23839879-23839901 TGGGGCGGCAGCTGAAGAGATGG + Intergenic
1178281577 21:31287729-31287751 AGATGATGAAGCTAAAAAGATGG + Intronic
1178790064 21:35691608-35691630 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1178835479 21:36093980-36094002 GGGTGCTGCAGCAGAGGAGATGG - Intergenic
1179154848 21:38840780-38840802 AGGTGCTGAAGCTGAACTGCAGG + Intergenic
1179289542 21:40006459-40006481 ACATGCTGCTGTTGAAAAGATGG - Intergenic
1181108368 22:20587736-20587758 AGGTGCTGCAGCTGAAAGGCAGG + Intergenic
1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG + Intronic
1181864538 22:25845029-25845051 AGGTCATGTAGCTTAAAAGAGGG - Intronic
1182806236 22:33072916-33072938 AGGTGGTGCAGCTGGAATGAAGG - Intergenic
1183495802 22:38143093-38143115 AGGTGCTGCAGGTGAGCAGGGGG - Exonic
1184900322 22:47442746-47442768 CAGTGCTGCAGATGAAGAGATGG - Intergenic
949439116 3:4061540-4061562 AGGTGCTGCAGCTGAGGAGATGG - Intronic
949839312 3:8302976-8302998 AGGTGATGTTGCTGAAAATACGG - Intergenic
950128063 3:10522874-10522896 AGGTTCTTCAGCTGCAGAGATGG + Intronic
950254606 3:11494139-11494161 AGGCGCTGCAGCAGGCAAGATGG + Intronic
950401618 3:12773396-12773418 AAGTGCTACAGCTGAGGAGATGG + Intergenic
950758529 3:15199217-15199239 AGGGGCTGCAGTTCAAAAGCTGG - Intergenic
951288966 3:20852267-20852289 AGGAGCTGAAGATGAAATGAAGG + Intergenic
951429429 3:22588911-22588933 AGTTCCTGCTGCTGAAATGATGG - Intergenic
951709840 3:25576514-25576536 AGGGGCTGCAGATGGATAGATGG + Intronic
952662650 3:35870264-35870286 AGGTGATGCAGCTGAACAGATGG - Intergenic
952691928 3:36218704-36218726 TGGTGCTGCAGTGGAAAAGTAGG - Intergenic
952941771 3:38451051-38451073 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
953312529 3:41892945-41892967 GGGTGCTGCAGCTAAGGAGATGG - Intronic
953804306 3:46054675-46054697 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
954073534 3:48160098-48160120 AGGTGCTTCAGAGGAAAATAAGG - Intronic
954590907 3:51780696-51780718 AGGTTATGCAGCTGAAATGTAGG + Intergenic
955158204 3:56438419-56438441 AGGTGCTGCAGCTGAGGAGATGG - Intronic
956758136 3:72410380-72410402 AGGTACTGCGGCACAAAAGAGGG + Intronic
957592031 3:82211619-82211641 GGGTGCTGTAGCTGAGGAGATGG - Intergenic
957832396 3:85539741-85539763 AGTTGCTCAAGCTGAAAACATGG - Intronic
957914630 3:86672333-86672355 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
959417794 3:106098399-106098421 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
959497980 3:107073356-107073378 AGGTACTTAAGCTGAAATGAGGG - Intergenic
960908064 3:122621432-122621454 AGGCTGTGCAGCTGAAAAAAAGG - Exonic
961551325 3:127672124-127672146 AGCTGCAGCAACAGAAAAGAAGG + Intronic
961991874 3:131200787-131200809 GGGTGCTGCAGCCAAAAAGATGG - Intronic
962158785 3:132977383-132977405 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
962369438 3:134808643-134808665 TGGTCCTGAAGATGAAAAGATGG + Intronic
962404706 3:135091050-135091072 AGGTGCTGCATCTCAAGAGAAGG - Intronic
963969720 3:151416300-151416322 GGCTGCTGCATCTGGAAAGAGGG - Exonic
964613829 3:158641489-158641511 AGATGCTGCAGTTCAAAAGGTGG - Intergenic
964720886 3:159765909-159765931 GGGTGCTGGAGTGGAAAAGAGGG + Intronic
964869620 3:161299022-161299044 AGGTGCTGCAGCCGAGGTGATGG + Intergenic
965015882 3:163156054-163156076 GGGTGCTGCAGCCGAGGAGATGG + Intergenic
965015996 3:163157121-163157143 AGGTGTTTCAGATGAGAAGATGG - Intergenic
965632388 3:170746517-170746539 AGGTACTGCAGCTGGGAAGATGG - Intronic
965962803 3:174448647-174448669 AGGTGCTGCACCTGAGGAGATGG + Intronic
965984318 3:174733717-174733739 GGGTGCTGCAGCTGAGGAGATGG + Intronic
966110604 3:176396571-176396593 AGGTGCTGCAGCCACAGAGATGG - Intergenic
966931647 3:184679232-184679254 TCGAGCTGCAGCTGGAAAGAGGG - Intronic
967590778 3:191271398-191271420 GGGTGCTGCAGCTGAGGAGATGG - Intronic
967790750 3:193546411-193546433 GGGTGCTGCAGCTGAGAAGATGG - Intronic
968954444 4:3711054-3711076 AGGAGCTGCAGCTGAGGAGCTGG - Intergenic
969040268 4:4290303-4290325 AGCTGCTGCAGGTGAAGAGTAGG + Exonic
969240505 4:5893858-5893880 AGGTGGTGCAGCAGCCAAGAGGG + Intergenic
969505942 4:7587769-7587791 AGGCCCTGCAGCTGGAAAGAGGG - Intronic
970574391 4:17413157-17413179 GGGTGCTGCATCTGAGAGGATGG - Intergenic
971230802 4:24799301-24799323 AGGTGCTGTGGCTGTAAAGATGG - Intronic
971923298 4:32971747-32971769 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
972648968 4:40997222-40997244 GGGTGCTGCAGCTGAGGAGATGG - Intronic
972724468 4:41734265-41734287 GGCTGCTGCAGGTGCAAAGATGG - Intergenic
973138526 4:46736275-46736297 AGGTACTGCAGCAGAGGAGATGG + Intronic
973920774 4:55682638-55682660 AGGTACTGTGGCTGAAGAGATGG - Intergenic
974124368 4:57677453-57677475 AGGTCCTGCTGCTGAGGAGATGG - Intergenic
974453861 4:62100886-62100908 AGATGCTGCAGCTAAGGAGATGG - Intergenic
974553939 4:63418798-63418820 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
975377171 4:73659201-73659223 AGCGGTGGCAGCTGAAAAGAAGG + Intergenic
976632760 4:87255933-87255955 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
976633407 4:87263059-87263081 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
976659470 4:87524679-87524701 AGGTGCTGCAGCTGAGGAGATGG - Intronic
976740090 4:88348112-88348134 AGGTACTGCAGAAGAAAATAAGG + Intergenic
977347116 4:95830115-95830137 AGGTGGAACAGCTGAAAGGATGG - Intergenic
977827792 4:101554130-101554152 AGATGCTGCAGCCAAGAAGATGG + Intronic
978608228 4:110506052-110506074 AGGTTCTGGAGCTGAATAGTTGG + Intronic
978747687 4:112212337-112212359 AGGTGCTACAGCTGAGGAGATGG + Intergenic
979142069 4:117189790-117189812 AGCTGCAGGAGATGAAAAGATGG + Intergenic
979268164 4:118727517-118727539 AGTTGCTGCAGCTGGGATGAAGG + Intronic
979645743 4:123066220-123066242 TGCTGCTGCTGCTTAAAAGAGGG - Intronic
979809580 4:125019306-125019328 AGGTACTGTAGCTGAGAAGATGG + Intergenic
979992883 4:127396179-127396201 AGGTACTTCAGCGGAAAAGTTGG - Intergenic
981147260 4:141339689-141339711 GGGTGCTGCAACTGAGGAGATGG - Intergenic
981199185 4:141959010-141959032 AGATGATGCAACTGAAAATATGG + Intergenic
983066970 4:163222334-163222356 GGATGCTGCAGCTGAGGAGATGG - Intergenic
983283766 4:165713557-165713579 AGCTGCTGCAGATGAAAAACAGG - Intergenic
984035362 4:174661430-174661452 AGGTGCTGAGGCTGAAAATATGG - Intronic
984955153 4:185037659-185037681 AGGTGCTACAGCTGAGGAGATGG - Intergenic
985206967 4:187549439-187549461 AGGTGCTGCAGGCCAAGAGATGG + Intergenic
985234283 4:187856105-187856127 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
985245894 4:187979416-187979438 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
985283145 4:188306816-188306838 GGGTGTTGCAGCTGAAAAGATGG + Intergenic
985295254 4:188431055-188431077 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
985322391 4:188729179-188729201 CTGTGCTGCAGCCGAGAAGATGG + Intergenic
985411828 4:189693729-189693751 TGGTGCTGCAGCTGAGGAGATGG - Intergenic
985753533 5:1698621-1698643 AGAGGCTGCAGCTCAAAAGGTGG - Intergenic
986500440 5:8393196-8393218 AGCTGCTGCTTTTGAAAAGAAGG + Intergenic
986954883 5:13138523-13138545 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
986954984 5:13139645-13139667 AGATGCTGCAGCTGAGGAGATGG + Intergenic
988011169 5:25488075-25488097 AGATGCTGCAGCTGAGGAGATGG + Intergenic
988039597 5:25872670-25872692 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
988045756 5:25950888-25950910 AGGTGCTGCAGTTGAGGACATGG + Intergenic
988049120 5:26000804-26000826 AAGTGCTGTAGAAGAAAAGAAGG + Intergenic
988210918 5:28202271-28202293 TGGTGTTGCAGCTGAGGAGATGG + Intergenic
988566244 5:32321762-32321784 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
988911494 5:35847893-35847915 GGGTGCTGCAACTGAGGAGATGG + Intergenic
989096654 5:37788199-37788221 AGGTCGAACAGCTGAAAAGAGGG - Intergenic
990278539 5:54225698-54225720 AGGCCCTGAAGCTGACAAGAGGG + Intronic
990965925 5:61447811-61447833 AGGTGCTGCAGCTAAGGAGATGG + Intronic
991717861 5:69468713-69468735 GGGTGCTGCAGCTGAAGACATGG + Intergenic
992664734 5:78996192-78996214 AAAAGCTGAAGCTGAAAAGATGG - Intergenic
992865548 5:80953781-80953803 AGGTGCTACAGAGGAAAAGGAGG + Intergenic
992970108 5:82047735-82047757 AGGTGCTGGAGGTGAAAAGAAGG + Intronic
993932255 5:93954520-93954542 AGGTGCTTGAGGAGAAAAGAGGG - Intronic
994571503 5:101520594-101520616 GGGTGCTGCAGCTGAAGAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
994913983 5:105948701-105948723 GGGTGCTGCAGCTGAGCAGGTGG + Intergenic
995464062 5:112432686-112432708 AGATGCTGCAGTTCAAAAGGTGG - Intergenic
996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG + Intergenic
996526303 5:124483823-124483845 AGGAGCTGCAGAAGAAAAGTTGG - Intergenic
996658276 5:125967594-125967616 AAGTGCTGCAGCCAAGAAGATGG + Intergenic
997230341 5:132238101-132238123 AGGTGGTGAAGGTGGAAAGATGG + Intronic
998064823 5:139149455-139149477 AGGTGCTGCAGATACAAATAGGG + Intronic
1000188934 5:158889343-158889365 AGCTGCTCCAACTGAAAAGCTGG - Intronic
1000223977 5:159240359-159240381 AGGTGATGCAGCAGAAACCAAGG - Intergenic
1000473111 5:161671103-161671125 AGGGGCTCCAGATAAAAAGATGG - Intronic
1000540849 5:162538079-162538101 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1000814932 5:165909215-165909237 CAGTGCTGCAGCTGAGGAGATGG + Intergenic
1000969651 5:167699515-167699537 AGCTGCTTCAGCTGAAAGTAAGG - Intronic
1002332988 5:178457769-178457791 AGGTGCTGCTGCTGAGAGGCAGG + Intronic
1002842476 6:918123-918145 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1002905181 6:1442594-1442616 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1003532708 6:6951508-6951530 AGGTGCTGAAGCCGACAAGATGG - Intergenic
1004061069 6:12198611-12198633 AGGTGCTACAGGGGAAAACAAGG + Intergenic
1004086047 6:12450337-12450359 AGTTACTTCAGATGAAAAGAAGG + Intergenic
1004159623 6:13202037-13202059 AGGAGATGCAGCAGGAAAGAAGG + Intronic
1004341108 6:14808115-14808137 AGGTGCTGCCAATGAAGAGATGG + Intergenic
1005035154 6:21549178-21549200 AGGTGCTGCAGAAGAGGAGATGG + Intergenic
1006174246 6:32112396-32112418 AGAGGCTACAGCTGAAAAGGGGG + Intronic
1006220891 6:32490300-32490322 AGGTGCTGCAGCTGAGGATACGG - Intergenic
1006221082 6:32492425-32492447 AGGCACTGCAGCTGAGTAGATGG - Intergenic
1006260707 6:32867094-32867116 AGGTGCTCTAGCTTCAAAGAAGG - Intergenic
1007511225 6:42375782-42375804 AGGTGCAGGAGGTGTAAAGAGGG + Intronic
1007981356 6:46162503-46162525 AGGAGCTACTGCTGATAAGATGG + Intronic
1008266463 6:49433339-49433361 AGATGTTGCAACTGAAAAAAGGG + Intronic
1008310198 6:49959184-49959206 AGGTGCTGCAGTGAAGAAGATGG - Intergenic
1008760144 6:54844202-54844224 AGTTGCTTGAGCTGAAAAGTTGG + Intergenic
1010005833 6:70993948-70993970 AGGTGCTGCAGCTGAGGAAATGG + Intergenic
1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG + Intergenic
1011490032 6:87882222-87882244 AGGTGCTGTAGCAGAGGAGATGG + Intergenic
1012041150 6:94205670-94205692 AGCAGCTGCAGCTGAAATCATGG - Intergenic
1014139889 6:117929240-117929262 TGGTGCTGCAGCTGAGGAGATGG - Intronic
1015342372 6:132115947-132115969 AGGTGATGCAGCTGGTGAGAGGG + Intergenic
1016148255 6:140703317-140703339 AGGTGTTGCAGCTGAGGAGATGG + Intergenic
1016200629 6:141403180-141403202 TGGTGCTGCAGCTGAGGAGACGG - Intergenic
1016442586 6:144099239-144099261 AGAGGCTGCAGTTCAAAAGAAGG - Intergenic
1016728027 6:147397607-147397629 AGATACTGGAGCTAAAAAGATGG - Intergenic
1017552464 6:155523678-155523700 TTGTGCTGCAGCAGAAAACAAGG - Intergenic
1018522970 6:164673043-164673065 AGGTGCTGCAGCCAAGAAGACGG + Intergenic
1018969314 6:168515303-168515325 TGGTGCTGCAGCTGCCAAGGCGG + Intronic
1020771298 7:12398572-12398594 GGGTGCTCCAGCTGAGGAGATGG - Intronic
1020814046 7:12882465-12882487 AGATGCTGCAGCTGAGGAGATGG + Intergenic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1022043535 7:26603574-26603596 AGGTCCTGCAGTTGAAAAAACGG + Intergenic
1022440701 7:30430617-30430639 AGGTTCTGTAGCTGAACAGTGGG - Intronic
1022445108 7:30464018-30464040 AGCTTCTGCAGCTCCAAAGAGGG - Intronic
1022660466 7:32361958-32361980 AGAGGCTGGAGCTGCAAAGATGG + Intergenic
1022837255 7:34130106-34130128 AGATGCTGAAGCTAAAGAGATGG - Intronic
1023192271 7:37595422-37595444 TGCTGCTGCTGCTGAAAGGATGG - Intergenic
1023756774 7:43425931-43425953 AGGTGCTGGAGTAGAAAAAAGGG - Intronic
1024268918 7:47627618-47627640 AGGTGCTGCAACCGAGGAGATGG + Intergenic
1024307715 7:47942219-47942241 AGGTGCTGCAGATGAGGAGAAGG - Intronic
1024421379 7:49170925-49170947 AGGTGCTGCAGCCAAAGAGATGG - Intergenic
1024654800 7:51442569-51442591 GGGTGCTGCGGCTGAGGAGATGG + Intergenic
1024802663 7:53099046-53099068 AGGTGCTGCAGCTGAGAACAGGG + Intergenic
1025938102 7:66053179-66053201 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1026280432 7:68917430-68917452 GGGTGCTGCAGCTGAGGATATGG - Intergenic
1026551677 7:71374184-71374206 AGCTCCTGCTTCTGAAAAGAAGG - Intronic
1027157739 7:75780468-75780490 TGGTGCTGCAGAAGAAAATAAGG - Intronic
1027666772 7:81049672-81049694 AGGTGCTGCAGCCCAGGAGACGG - Intergenic
1027749659 7:82126844-82126866 GGGTGTTGCAGCTGAGGAGATGG - Intronic
1028046063 7:86120444-86120466 AACTGCTGCTGCTGAAAACACGG - Intergenic
1028740914 7:94274030-94274052 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1030012953 7:105189440-105189462 AGCTGCTCCAGCTGAGGAGAAGG + Intronic
1030443413 7:109618417-109618439 AGGTTCTGCAGCCGAGGAGATGG + Intergenic
1030939470 7:115628550-115628572 AGGCTCTGCAGATGAAAGGATGG + Intergenic
1031063288 7:117076111-117076133 AGGTGCTGTAGCTGAGGAGATGG - Intronic
1031697507 7:124876723-124876745 AAGTGCTGCAGTTGAGAACAAGG - Intronic
1033168331 7:139061041-139061063 ATGTGCAGCAGATGAAGAGAGGG - Exonic
1033242979 7:139696057-139696079 GTGTGCTGCAGATGAACAGAAGG + Intronic
1034167459 7:149036839-149036861 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1034247938 7:149663104-149663126 AGGAGCTGCAGCTGACATCATGG - Intergenic
1034689918 7:153006183-153006205 AAGGGCTGAAACTGAAAAGAAGG + Intergenic
1036048222 8:5167296-5167318 AGGTTGTGCAGCTTCAAAGAGGG + Intergenic
1036522660 8:9506515-9506537 AGGTGTTGCAGCCAACAAGAAGG - Intergenic
1037627014 8:20617177-20617199 TGGTGCTGCAGCTGGAATTAGGG - Intergenic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038216951 8:25570421-25570443 AGGAGCGGCAGCAGACAAGATGG + Intergenic
1038943589 8:32332416-32332438 AGGATCTGCAGCTGTCAAGAAGG - Intronic
1039032154 8:33322241-33322263 AGGAGCTGCAGCAGAAAAAGTGG - Intergenic
1039094118 8:33864700-33864722 AAGTGCTTCAGCCAAAAAGATGG - Intergenic
1039269725 8:35867811-35867833 AGGTGCTGCACCTGAGGAAATGG + Intergenic
1039431605 8:37529347-37529369 GGGTGCTGCAGGGGAAAGGAAGG - Intergenic
1039838235 8:41274910-41274932 AGTTGCTCCAGCTGAATGGAGGG - Intronic
1040659426 8:49552938-49552960 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1040877009 8:52164053-52164075 AATTGCTGCAGCTGAAAAATTGG - Exonic
1041834625 8:62197784-62197806 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1041848665 8:62361049-62361071 TGGTGCTCCAGCTGTAGAGATGG - Intronic
1042397283 8:68307038-68307060 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1043037411 8:75215329-75215351 TTATGCTGCAGGTGAAAAGAGGG - Intergenic
1045063341 8:98426557-98426579 AGGAGCTGGAGGGGAAAAGAGGG - Intronic
1045322527 8:101092576-101092598 AGGTGCTGCAGCTGTGAGGAAGG - Intergenic
1045499839 8:102736760-102736782 GGGTGTTGCAGCTGAGCAGATGG - Intergenic
1045531544 8:102989656-102989678 AGGTGCCACAGCGGAGAAGATGG - Intergenic
1045711001 8:104983774-104983796 TGGTGCTGCGGATGCAAAGAAGG + Intronic
1046277283 8:111980617-111980639 AGATGCTGCAGGTGAGGAGATGG + Intergenic
1046912140 8:119639958-119639980 ATGTGCTGCGGAAGAAAAGATGG - Intronic
1047307850 8:123667651-123667673 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1047331630 8:123894353-123894375 AGGTGCTGCAGCCAAGAAGATGG - Intronic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048217148 8:132506727-132506749 AGGTTCTGTAGCTGAGAAAAAGG - Intergenic
1048802005 8:138202620-138202642 AGGTGCATCACCTGAAAAGAGGG + Intronic
1048835956 8:138519156-138519178 AGGTGCTCCAGCTCTAGAGAGGG + Intergenic
1049224174 8:141441769-141441791 ACGTGCTGCAGCTGAGCAGAGGG + Intergenic
1049629888 8:143648083-143648105 AGGTGTTGGGGCTGGAAAGAAGG + Intronic
1051590300 9:18770693-18770715 AGGTTTTGAAGCTGAACAGAAGG - Exonic
1052424784 9:28290546-28290568 GGGTGCTACAGCTGAGGAGATGG + Intronic
1053086630 9:35229467-35229489 TGGTGCTGAAGCTAAAAGGAAGG - Intronic
1053115803 9:35501208-35501230 AGGGGATGTAGATGAAAAGAGGG - Intronic
1055059049 9:72049959-72049981 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1055071154 9:72167344-72167366 AGGTGCTGCAGCTAAGGAGATGG - Intronic
1055189817 9:73504340-73504362 GGGTGCTGCTGCTGAGGAGATGG - Intergenic
1056573910 9:87840177-87840199 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
1057029323 9:91761972-91761994 CGGTGATGCAGCTGAGGAGATGG - Intronic
1057149457 9:92783498-92783520 GGGTGCTGCAGCCGAGTAGATGG + Intergenic
1057302144 9:93892949-93892971 GGGTGCTGCAGCTGGGCAGATGG - Intergenic
1057395794 9:94678920-94678942 AGGTGCTGCAGCTAAAGAGATGG + Intergenic
1057441276 9:95085517-95085539 AAGTTCTGCACCTGAAGAGAAGG + Intronic
1057630097 9:96712774-96712796 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1057755780 9:97833937-97833959 CAGTGCTGCAGCTGGAAGGATGG + Intergenic
1058111358 9:101033750-101033772 AGCTGCTTCAGCTGTAAAGTGGG - Intronic
1059049569 9:110909188-110909210 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1059389585 9:113990425-113990447 TGGTGCTGCAGCTGTCAAGGTGG + Intronic
1061618885 9:131798070-131798092 AGCCTCTGCAGCTGCAAAGAAGG - Intergenic
1061622630 9:131821519-131821541 AGGTGCCCAAGCTGGAAAGAGGG + Intergenic
1062106032 9:134755465-134755487 ATCTGCTGCAGAAGAAAAGATGG + Intronic
1203662621 Un_KI270753v1:59577-59599 CGGTGCTGCAGCTGAGGAGATGG - Intergenic
1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1185446135 X:258905-258927 ATGTGCTGGAGCTAAAGAGAGGG + Intergenic
1186277506 X:7956011-7956033 GGGTGCTGCTGCTGAAAATGTGG - Intergenic
1186396699 X:9216323-9216345 AGATGCTGCCTCTGAAGAGATGG - Intergenic
1187914448 X:24140307-24140329 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1188211774 X:27434154-27434176 AAGTGCTGCAGCTGCAAAGTGGG + Intergenic
1189031960 X:37460192-37460214 AGGTGCTGCAGAAGAAAATAAGG + Intronic
1191678647 X:63818053-63818075 AGGTGATGCAGCAGAATACAAGG + Intergenic
1193833449 X:86314830-86314852 AGACGCTGCAGAAGAAAAGATGG + Intronic
1194008486 X:88528915-88528937 AGGTGCTGCAGCCAAAGAGCTGG + Intergenic
1194009265 X:88538198-88538220 AGGTGCCATAGCTGAGAAGATGG + Intergenic
1194085091 X:89516479-89516501 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1195655599 X:107328820-107328842 GGGGGCTGCAGCAGAAAGGATGG - Intergenic
1196124529 X:112083720-112083742 AGGTGCTTCATGTGAAAGGAAGG - Intergenic
1196294095 X:113979127-113979149 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
1196665119 X:118307961-118307983 AGGTGGTGCAGCTGAGGAGATGG + Intergenic
1197082005 X:122429647-122429669 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1197179332 X:123517515-123517537 AGGTGCTGCACCTGAGAAGATGG + Intergenic
1198369764 X:135979078-135979100 GGGTGCTGCAGCCGAGAAGATGG - Intergenic
1199788709 X:151129735-151129757 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1200437739 Y:3172363-3172385 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1202600712 Y:26590614-26590636 AGGTGCTGCCTGTGAAAAGGGGG - Intergenic