ID: 1101022920

View in Genome Browser
Species Human (GRCh38)
Location 12:100572255-100572277
Sequence CTAAGAGTCTTGAAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101022920_1101022926 -5 Left 1101022920 12:100572255-100572277 CCATCACCCTTCAAGACTCTTAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1101022926 12:100572273-100572295 CTTAGGGGTTCCTTCTTTCATGG 0: 1
1: 0
2: 0
3: 14
4: 169
1101022920_1101022928 17 Left 1101022920 12:100572255-100572277 CCATCACCCTTCAAGACTCTTAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1101022928 12:100572295-100572317 GACCTCCACAGACTTCCATTTGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101022920 Original CRISPR CTAAGAGTCTTGAAGGGTGA TGG (reversed) Intergenic
900413007 1:2521544-2521566 CAAAGGGTCTTGAAGGGACACGG + Intronic
901643537 1:10704974-10704996 CTAAGAGGCTGGCAGGGAGAAGG - Intronic
904050098 1:27633832-27633854 CTGAGTGTCCTGAAGGGTTAAGG - Intronic
907115811 1:51967456-51967478 TTCAGAGTCTTAAAGGATGAGGG + Intronic
907375938 1:54039987-54040009 CCAAGAGTTTTTAAGGGTAATGG - Intronic
907660110 1:56384003-56384025 AGAAAAGTCTTTAAGGGTGAGGG - Intergenic
911434725 1:97843025-97843047 ATAACAGTCTTTAAGGATGAAGG - Intronic
911693861 1:100865263-100865285 CAAGGAGTTATGAAGGGTGAGGG - Intergenic
911930573 1:103897989-103898011 CGATGAGTCTTGAAAAGTGATGG - Intergenic
912040476 1:105383639-105383661 CTATGATTCATGAAGGGTGAGGG + Intergenic
912704265 1:111900222-111900244 TAAAGAGTCTTGAAGTGGGAAGG - Intronic
912795604 1:112691610-112691632 CTCAGAGTGTTGGAGGGTGAGGG + Intronic
915446380 1:155977070-155977092 TTAGGAGTCCTTAAGGGTGATGG - Intronic
921339909 1:214124472-214124494 CTAAGATTCCTGGAGGTTGACGG + Intergenic
921840269 1:219820825-219820847 CTAAAACTCTTGAGGGATGAGGG - Intronic
924503121 1:244654747-244654769 TTAAGAGTCTTGAAAGATAAAGG - Intronic
1066153673 10:32651605-32651627 CTAAGAGTATTTAAGGGTTCAGG + Intronic
1067320321 10:45213464-45213486 CTAAGAGTTTTTATGGGTGTTGG - Intergenic
1068913693 10:62406002-62406024 CCAAGATTCTTAAAGGGTAAGGG + Intronic
1070365615 10:75733974-75733996 GTAAGAATCTTGAAGGGAAAGGG - Intronic
1072212938 10:93263398-93263420 CTTACAGTCTTGATGGGTGAGGG - Intergenic
1073648111 10:105327945-105327967 CTAAGAGTCCAGAAGAGAGATGG + Intergenic
1073737911 10:106370897-106370919 CTAAGAGTTTTGAAGGATTCGGG - Intergenic
1074892486 10:117747304-117747326 ATAACAGTCTTGCAGGTTGAGGG + Intergenic
1077061974 11:621482-621504 CTAAGAGCCTTGGAGGGCGAGGG + Intronic
1078903806 11:15666029-15666051 CTCAGAGTTTTGTAGGGTGAGGG + Intergenic
1082626524 11:55494207-55494229 CTGAAAGTCTTGAACAGTGAGGG + Intergenic
1083242827 11:61402381-61402403 TTAGGAATCTTGAAGGGTAAAGG + Intergenic
1086264158 11:84978058-84978080 CTAAATGTCTTGAAGGGGAAGGG + Intronic
1090135209 11:124190748-124190770 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
1092053771 12:5492133-5492155 GTAAGAGTCTTTATGGGTGGTGG - Intronic
1092070032 12:5624720-5624742 CTCCCAGTCTAGAAGGGTGAGGG + Intronic
1096479679 12:51930642-51930664 CTAAGAGTTGTCAAGGGTGTGGG + Intergenic
1097777662 12:63667805-63667827 CTAGGAGTTTTAAAGGCTGAGGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098583741 12:72132307-72132329 AAAAGAGTTTTGAAGGCTGAAGG + Intronic
1099076850 12:78120204-78120226 CTAAGAGACTTAAAAGCTGATGG + Intronic
1100287194 12:93178198-93178220 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
1101022920 12:100572255-100572277 CTAAGAGTCTTGAAGGGTGATGG - Intergenic
1102987389 12:117289682-117289704 CTAAGAGTATTTAAGGGTTTAGG + Intronic
1104917696 12:132274362-132274384 GTGAGCCTCTTGAAGGGTGAGGG - Intronic
1105237517 13:18572220-18572242 ATAAGTGTCTTCAAGGGAGAAGG - Intergenic
1106920150 13:34554393-34554415 GTGAGAGTCTTGAAGGCTCAGGG - Intergenic
1108552311 13:51558884-51558906 CTAAAAGTCTTTGAGGGTGCAGG - Intergenic
1109165891 13:59034671-59034693 CTAAGAATCTTTATGGGTGATGG - Intergenic
1110880771 13:80569567-80569589 TTATGAGTCTTGAAAGGTGAAGG - Intergenic
1110986579 13:81978097-81978119 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
1112636939 13:101226337-101226359 CTAAGGGTATTTAAGGGTGTAGG - Intronic
1118648444 14:67864500-67864522 TTAAGAGTATTTAGGGGTGAAGG - Intronic
1119381347 14:74230988-74231010 CTTAGAGTCTTCTAGGATGAAGG + Intergenic
1120037824 14:79717942-79717964 CTCAGAGTCTACAAGGGTGATGG - Intronic
1120747576 14:88165973-88165995 CCATGAGTCTTGCAGGGTGTAGG - Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1122434870 14:101688691-101688713 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
1122607004 14:102953418-102953440 CTAAGACTCTTGCAGAGTCAGGG - Intronic
1122691342 14:103533373-103533395 CTGAGAGGGTTGAAGGGTGGAGG + Intronic
1124033353 15:26031321-26031343 CAAAGAACCTAGAAGGGTGAAGG - Intergenic
1124199214 15:27662809-27662831 CTAAGAGTTTTTAAGGGTTCAGG + Intergenic
1127365392 15:58284579-58284601 CTAAGAGTGTTGAATTGGGATGG - Intronic
1128494974 15:68192512-68192534 CAAAGAGTTTTGTGGGGTGAGGG - Exonic
1129114680 15:73358637-73358659 CTCAGAGTCCTCAAGGGTGAAGG + Intronic
1131300343 15:91194216-91194238 CTCAGTGACTTGAGGGGTGATGG + Intronic
1132129616 15:99263815-99263837 GTCAGTGTCTTGAAGAGTGATGG - Intronic
1133381426 16:5334083-5334105 CTAAGAGTATTTAAGGGTTTAGG + Intergenic
1133632583 16:7635682-7635704 CTAAAAGGCTTAAAGGGAGACGG - Intronic
1136292199 16:29281807-29281829 CTAAGAGTATGGAAGGGTTCAGG + Intergenic
1141798291 16:86289222-86289244 CGAAAAATATTGAAGGGTGAAGG + Intergenic
1142098091 16:88255760-88255782 CTAAGAGTATGGAAGGGTTCAGG + Intergenic
1144478556 17:15610300-15610322 CTAAGAGTCTTTAAGGATTCAGG + Intronic
1144919739 17:18753430-18753452 CTAAGAGTCTTTAAGGATTCAGG - Intronic
1145956088 17:28855747-28855769 CTAAGGGTCAAGAAGGGAGAGGG - Intronic
1146628499 17:34453174-34453196 CAAAGAGTCTGGAAGTGTGAGGG - Intergenic
1148321316 17:46756150-46756172 CTGAGAGTTTTCAAGGGTGATGG - Exonic
1148450530 17:47774852-47774874 CTAAGAGTCTAAAGGGCTGAAGG - Intergenic
1153477878 18:5517210-5517232 CTGAGAGTCTGACAGGGTGAGGG + Intronic
1154023102 18:10682550-10682572 CCCACAGTCTTGAAGGGAGAAGG - Intronic
1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG + Intronic
1158547320 18:58407119-58407141 CCAACAGAATTGAAGGGTGAAGG + Intergenic
1161081060 19:2310377-2310399 CTATGAGTCCTGGAGGGTGAGGG + Intronic
1162393315 19:10402749-10402771 CTAAGGATCCTGAAGGGGGACGG + Intronic
1165110424 19:33498946-33498968 CGAAGAGACCTGAAGGGTCAAGG + Intronic
1167571793 19:50293137-50293159 CCAAGAGCCTTGAGGTGTGAGGG + Intronic
1168589070 19:57617793-57617815 CTTAGAGTCTAGAAGAGGGAGGG + Intronic
925175680 2:1782090-1782112 ATGAGTGTCTTGAAGGGAGAAGG - Intergenic
925599568 2:5594086-5594108 CTCAGGGTTTTTAAGGGTGAGGG - Intergenic
926114931 2:10206884-10206906 AAAAGATTCTTGAAGGATGAGGG + Intronic
926662390 2:15481913-15481935 ATAAGGGTCTTCAAGGGAGAAGG - Intronic
927085588 2:19671684-19671706 CAAAGAGTCTTTCAGGTTGATGG - Intergenic
928440472 2:31287937-31287959 TTCAGAGTCTTGAAGGAGGATGG + Intergenic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
930515796 2:52406340-52406362 TTAAAAGTCTTGAAAGCTGAGGG + Intergenic
932013207 2:67998963-67998985 AGAACAGTCTTGAAAGGTGAGGG + Intergenic
932700202 2:73986283-73986305 TCAAGAGTCTACAAGGGTGAAGG - Intergenic
933723040 2:85410275-85410297 GTAGGAGTGTTGAAAGGTGAAGG - Intronic
933779463 2:85791486-85791508 CGGAGAGGCTTGAAGGGAGAGGG + Intergenic
935456318 2:103271261-103271283 CTAAAAGACTTGAAGGATAAAGG - Intergenic
935693720 2:105752695-105752717 ACCAGAGACTTGAAGGGTGATGG - Intronic
936749532 2:115624516-115624538 CTAACAGTCTAGAATTGTGATGG - Intronic
938138154 2:128775812-128775834 CTAATAGTCTAGAAGCATGAAGG - Intergenic
938512257 2:131962279-131962301 ATAAGTGTCTTCAAGGGAGAAGG + Intergenic
940361699 2:152803109-152803131 CTACCAGTCTGGAAGGTTGAGGG + Intergenic
941647462 2:168056738-168056760 ATCAGAGTCTTGAATGGAGATGG + Intronic
945320289 2:208413856-208413878 CTAAGAGTATTTAAGGGTTCAGG + Intronic
945326777 2:208491527-208491549 CTAAGAGTTTTTAAGGGTTCAGG + Intronic
947172162 2:227322824-227322846 CTAAGAGTATTTAAGGGTTTAGG + Intergenic
1168760927 20:348910-348932 CTAAGAGTCTTTAATCCTGAGGG + Intronic
1170795054 20:19539954-19539976 ATGAGAGTCTTCAAGGGAGATGG + Intronic
1174120196 20:48259310-48259332 ATAAGAAACTTGAAAGGTGAAGG - Intergenic
1176781507 21:13200497-13200519 ATAAGTGTCTTCAAGGGAGAAGG - Intergenic
1178512724 21:33219287-33219309 CAAAAAGTCTTTAGGGGTGATGG - Intergenic
1182035754 22:27197028-27197050 AAAAGAGTCTAGAAGGGTCATGG + Intergenic
1183258428 22:36778083-36778105 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
949653914 3:6194204-6194226 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
949882080 3:8669798-8669820 CTGAGAGTCTTGAAGAGTACAGG - Intronic
954679225 3:52332721-52332743 CTAAGGGTTTTGAAGAATGATGG - Intronic
957501638 3:81066074-81066096 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
957502111 3:81070145-81070167 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
959320439 3:104867084-104867106 CTAACATTCTTGAGGGGAGAGGG + Intergenic
960397602 3:117156253-117156275 CTAAGAGCATTAAAGGATGAGGG - Intergenic
962086625 3:132198311-132198333 GTAAGCATCTTGAAGGGTAAAGG - Intronic
962118643 3:132538720-132538742 CTAATAGTCTTGGATGGTGGGGG - Exonic
962405153 3:135094268-135094290 GTAAGAGCCTTGGAGAGTGAAGG + Intronic
963863064 3:150330592-150330614 CCAAGAGTCATGAAGGGGAAAGG + Intergenic
964759991 3:160126125-160126147 ATAAGAATCTTCAAGGGAGAAGG + Intergenic
967648119 3:191951664-191951686 TTAAAATTCTTAAAGGGTGAGGG - Intergenic
967881679 3:194306100-194306122 CCAAGCATCTTGAAGGGTGCCGG - Intergenic
967932412 3:194699945-194699967 CTAAGACTTTGGAAGGGTCATGG + Intergenic
969731287 4:8959421-8959443 CTAAGAGCCATGGGGGGTGAGGG - Intergenic
969731312 4:8959500-8959522 CTAAGAGCCATGGGGGGTGAGGG - Intergenic
969790914 4:9493608-9493630 CTAAGAGCCATGGGGGGTGAGGG - Intergenic
970263645 4:14256688-14256710 CTAAGAGTTGTGATGGGTTAAGG + Intergenic
970741389 4:19241965-19241987 TTAAGAGTCTGGAAGGGGGCGGG + Intergenic
971362750 4:25952318-25952340 CTAATGGTCATGTAGGGTGATGG - Intergenic
971628798 4:28961595-28961617 ATGAGGGTCTTCAAGGGTGAAGG - Intergenic
977044970 4:92058103-92058125 GTAGGGGTTTTGAAGGGTGATGG + Intergenic
979084381 4:116388374-116388396 CTAAGGGTATTGAAGGGTTTAGG - Intergenic
981942862 4:150303874-150303896 CAAAGATTCTTAAAGGGTGAGGG - Intronic
982197140 4:152927995-152928017 CTGAGAGACTTGCAGGATGAGGG - Intergenic
982248262 4:153377710-153377732 ATAAGGGAATTGAAGGGTGAAGG + Intronic
983833814 4:172365148-172365170 CTAAGAGTATTTAAGGGTTTAGG + Intronic
985061427 4:186083181-186083203 CGAAGAGGCTGGAATGGTGAAGG - Exonic
986130781 5:4928045-4928067 CCAACAGTCTCGAAGGGTGTGGG - Intergenic
987166936 5:15208770-15208792 CCAAGAGGCTAGAAAGGTGAAGG - Intergenic
992003867 5:72459935-72459957 CTTAGAGTCTAGAAGGCTGCTGG + Intronic
993371368 5:87096804-87096826 CTAAGAGTCTTTGAGGGTTTAGG - Intergenic
994992480 5:107014960-107014982 CTTGGAGGCTTGCAGGGTGATGG - Intergenic
995064685 5:107846415-107846437 CTTACAGACTTGAAGGGTCAGGG + Intergenic
998258713 5:140611156-140611178 CTAAGAGTTTTTAAGGGTTCAGG + Intergenic
999479395 5:151932828-151932850 TTAAGAGTTTTGAAGAGTGCTGG + Intergenic
1001209882 5:169800812-169800834 CTCAGAATCTTGGAGGGAGAGGG + Intronic
1001915785 5:175558824-175558846 CTGATAGTCTTAAAGGGGGATGG + Intergenic
1003704199 6:8506239-8506261 CTTAGAGTCTTAGAGGGGGATGG + Intergenic
1004137645 6:12983439-12983461 CAAAGAGTCTTGAAGGTACATGG + Intronic
1005137156 6:22582824-22582846 CTAAGATTCATGAAGGCTGAAGG + Intergenic
1006243583 6:32708651-32708673 CTAAGAGTATTTAAGGGTTTGGG - Intergenic
1006683699 6:35814997-35815019 CTGAGAGTGTAGAGGGGTGAGGG - Intronic
1006930825 6:37687222-37687244 CTACGTGTCTGGAAGGGTGGTGG - Intronic
1010628674 6:78170547-78170569 CAAAGAGCCATGCAGGGTGAAGG + Intergenic
1010720861 6:79281988-79282010 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011355345 6:86467620-86467642 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011442871 6:87405986-87406008 CTAAGAGGCATGAAGGATTAGGG + Intergenic
1011828692 6:91341985-91342007 CAGAGAATCTTAAAGGGTGAAGG - Intergenic
1012319345 6:97823614-97823636 CCAGAAGTCTTGAAGAGTGAGGG + Intergenic
1012670466 6:102039126-102039148 CTCAGAGTGATGAATGGTGATGG - Intronic
1013537030 6:111072475-111072497 CTAAAAGACTTGGAGTGTGAAGG - Intergenic
1013862605 6:114653697-114653719 CTAAGAGTTTTGACTGCTGAGGG + Intergenic
1015767217 6:136731416-136731438 CTTAGAATCTTGAAGGGGCAAGG - Intronic
1017887609 6:158611842-158611864 CTAAGAGTATTTAAGGGTTCAGG + Intronic
1018530642 6:164759278-164759300 ATAAGAGTCTTGGAAGGAGAAGG - Intergenic
1018946043 6:168347154-168347176 GTCAGAGTGTTGAAGGGAGATGG + Intergenic
1019491542 7:1316125-1316147 CTCAGACTCTTGGAGGGTAAGGG + Intergenic
1020586992 7:10080670-10080692 CTAAGAGTTTTTAAGGGTTCAGG - Intergenic
1021631825 7:22655112-22655134 CTAACAGACTTAAAAGGTGAAGG - Intergenic
1022360595 7:29653071-29653093 CTAGGAGTTTTAAAGGTTGAGGG + Intergenic
1022701050 7:32761250-32761272 CTAGGAGTTTTAAAGGCTGAGGG - Intergenic
1023264590 7:38392303-38392325 GACAGAGTCTTGAAGGGTGAGGG + Intronic
1023868181 7:44248800-44248822 CTCAGAGTCCTAATGGGTGATGG + Intronic
1024845954 7:53642645-53642667 CTAAGAGTATTTAAGGGTTCAGG - Intergenic
1026065003 7:67063242-67063264 CTAAGAGTTTTTAATGATGAAGG - Intronic
1026711864 7:72748626-72748648 CTAAGAGTTTTTAATGATGAAGG + Intronic
1028373518 7:90120095-90120117 CTAGGAGTTTTAAAGGCTGAGGG + Intergenic
1029832828 7:103279581-103279603 CTAGGAGTTTTAAAGGCTGAGGG - Intergenic
1030474670 7:110015741-110015763 CCATAAGTCTTGAAGAGTGAGGG + Intergenic
1032685928 7:134233566-134233588 CTAAGAGTATTGAAAGGAAATGG - Intronic
1035857842 8:2995832-2995854 ATAACATTCTTGAAGGGAGAAGG + Intronic
1035974165 8:4288327-4288349 TTAAGAAAATTGAAGGGTGAAGG - Intronic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1041882118 8:62763858-62763880 CTAAGAGTATTTAAGGGTTCAGG + Intronic
1043094290 8:75946845-75946867 CTAAGAGGCTTTAATGGTGGAGG + Intergenic
1046343568 8:112891512-112891534 CTATGAAGCTTGAAGGGAGAGGG + Intronic
1048092897 8:131260437-131260459 CTGAGAGTTTTGCAGGCTGAAGG + Intergenic
1048196969 8:132339355-132339377 TTTAGATTTTTGAAGGGTGAGGG - Intronic
1052395806 9:27936566-27936588 GTCAGAGTCTTGAAGTGTCAAGG + Intergenic
1059016271 9:110519430-110519452 GTTAGAGTCTTGAAGGATGCTGG - Intronic
1186166941 X:6836705-6836727 TTAAGAGTCTTGATGTGTGGAGG - Intergenic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1194114585 X:89880366-89880388 CTAAGAGTGAAGAAGTGTGATGG + Intergenic
1195434360 X:104825428-104825450 CTAACATTCTTGAGGGGAGAGGG + Intronic
1196626742 X:117885582-117885604 GCAAGAATCTTGAAGGGTGTAGG + Intergenic
1197350720 X:125379671-125379693 CGAGGAGTCGGGAAGGGTGATGG - Intergenic
1200467326 Y:3535764-3535786 CTAAGAGTAAAGAAGTGTGATGG + Intergenic