ID: 1101034047

View in Genome Browser
Species Human (GRCh38)
Location 12:100687330-100687352
Sequence CAGGACAACCAGCAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101034047_1101034050 -10 Left 1101034047 12:100687330-100687352 CCTCCTTCCTGCTGGTTGTCCTG No data
Right 1101034050 12:100687343-100687365 GGTTGTCCTGTATACATGACAGG No data
1101034047_1101034053 12 Left 1101034047 12:100687330-100687352 CCTCCTTCCTGCTGGTTGTCCTG No data
Right 1101034053 12:100687365-100687387 GGATGCTCAAGCAATTATCTTGG No data
1101034047_1101034051 -9 Left 1101034047 12:100687330-100687352 CCTCCTTCCTGCTGGTTGTCCTG No data
Right 1101034051 12:100687344-100687366 GTTGTCCTGTATACATGACAGGG No data
1101034047_1101034054 13 Left 1101034047 12:100687330-100687352 CCTCCTTCCTGCTGGTTGTCCTG No data
Right 1101034054 12:100687366-100687388 GATGCTCAAGCAATTATCTTGGG No data
1101034047_1101034055 21 Left 1101034047 12:100687330-100687352 CCTCCTTCCTGCTGGTTGTCCTG No data
Right 1101034055 12:100687374-100687396 AGCAATTATCTTGGGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101034047 Original CRISPR CAGGACAACCAGCAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr