ID: 1101035873

View in Genome Browser
Species Human (GRCh38)
Location 12:100705839-100705861
Sequence CTTTCTTTTCTGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101035860_1101035873 6 Left 1101035860 12:100705810-100705832 CCCTTCCTCTCTTCCTTCCCTCC No data
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035855_1101035873 18 Left 1101035855 12:100705798-100705820 CCCTTCCTCCCTCCCTTCCTCTC 0: 17
1: 379
2: 2678
3: 14698
4: 31382
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035858_1101035873 10 Left 1101035858 12:100705806-100705828 CCCTCCCTTCCTCTCTTCCTTCC 0: 21
1: 510
2: 4931
3: 15071
4: 30240
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035857_1101035873 13 Left 1101035857 12:100705803-100705825 CCTCCCTCCCTTCCTCTCTTCCT 0: 32
1: 644
2: 6061
3: 20495
4: 70946
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035856_1101035873 17 Left 1101035856 12:100705799-100705821 CCTTCCTCCCTCCCTTCCTCTCT 0: 32
1: 686
2: 5048
3: 22269
4: 76419
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035859_1101035873 9 Left 1101035859 12:100705807-100705829 CCTCCCTTCCTCTCTTCCTTCCC 0: 5
1: 90
2: 1238
3: 9786
4: 61411
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035861_1101035873 5 Left 1101035861 12:100705811-100705833 CCTTCCTCTCTTCCTTCCCTCCT No data
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035863_1101035873 -7 Left 1101035863 12:100705823-100705845 CCTTCCCTCCTTCCCTCTTTCTT 0: 10
1: 261
2: 2653
3: 13839
4: 64261
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035862_1101035873 1 Left 1101035862 12:100705815-100705837 CCTCTCTTCCTTCCCTCCTTCCC 0: 2
1: 57
2: 1056
3: 8842
4: 59003
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data
1101035854_1101035873 29 Left 1101035854 12:100705787-100705809 CCTAACTTCTTCCCTTCCTCCCT No data
Right 1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101035873 Original CRISPR CTTTCTTTTCTGAGGGTGGG AGG Intergenic
No off target data available for this crispr