ID: 1101039245

View in Genome Browser
Species Human (GRCh38)
Location 12:100737348-100737370
Sequence CTAGAGCAATGGCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101039245 Original CRISPR CTAGAGCAATGGCCTGAGGA GGG (reversed) Intronic
903044962 1:20557624-20557646 CGTGAGCAAAGGCCTGAGGTGGG - Intergenic
903357864 1:22759102-22759124 CAAGTGCAAAGACCTGAGGAGGG - Intronic
903414362 1:23171568-23171590 CTAGAGCACTGGCCTGTGGAAGG + Intronic
905008567 1:34730971-34730993 CTATAGCAATGGCCTGGGGTTGG - Intronic
905248088 1:36628618-36628640 CTAAAGCAGTGTCCAGAGGAGGG + Intergenic
905591854 1:39170904-39170926 TTAGAGGACTGGGCTGAGGAAGG + Intronic
906701097 1:47858834-47858856 CTAGAGAAAGGTCCTCAGGATGG + Intronic
907314827 1:53561629-53561651 CCAGAGCACTGGCCTGGGGTGGG + Intronic
907728741 1:57045297-57045319 CTATAACAATGGCAGGAGGAAGG + Intronic
908303381 1:62784591-62784613 ACAGAGCACTGGCATGAGGAGGG - Intronic
913275357 1:117132440-117132462 CTGGAGCACTGGACTGGGGAGGG + Intergenic
915472527 1:156134620-156134642 CTAGGGCAAGGGACTCAGGAAGG - Intronic
916950682 1:169777283-169777305 CTAGAGCAATGGCCTTGAGTTGG - Intronic
919001470 1:191837240-191837262 CTAGAGATATGGACTGAAGAAGG - Intergenic
919751259 1:201039696-201039718 CTAGATGCATGGCCTGAGGCAGG - Exonic
924282334 1:242451005-242451027 CTAGAGAAAGGACCTCAGGATGG - Intronic
924722006 1:246632631-246632653 TTAGAGCATTGCCCAGAGGAAGG + Intronic
1067031927 10:42884162-42884184 TAAGAGCAGTGGCCTGGGGAAGG + Intergenic
1067142102 10:43666660-43666682 AAAGAGCTGTGGCCTGAGGAGGG - Intergenic
1070406858 10:76104939-76104961 CTAGAGCAAAGGCCTGGAGCAGG - Intronic
1071806283 10:89124633-89124655 ATAGAGCTGTGGCCTGGGGAAGG + Intergenic
1076177847 10:128382427-128382449 CTAGATCTAGGGCCTGGGGAGGG - Intergenic
1077399555 11:2347235-2347257 CAACAGCCATGGCCTGAGCAGGG + Intergenic
1077841442 11:5979834-5979856 CTAAAGCAATGTCAAGAGGAAGG - Intergenic
1078362083 11:10676864-10676886 CCAGAGCAATGGCCGTGGGAAGG - Intronic
1079336356 11:19573968-19573990 CTAGAACCATGGCCTGGGGCAGG + Intronic
1079755270 11:24251419-24251441 CTACAGCAGTTGCTTGAGGAAGG + Intergenic
1081618395 11:44603941-44603963 CAGGTGCAAAGGCCTGAGGAAGG - Intronic
1081858034 11:46316276-46316298 CTGGAGCAGGGTCCTGAGGAGGG - Exonic
1082777027 11:57253590-57253612 ATGTAGCAAGGGCCTGAGGAAGG + Intergenic
1083268152 11:61556569-61556591 CAGGAGCAGTGGCCTGTGGAGGG - Intronic
1084622771 11:70284741-70284763 CTTGAGCAAAGGCCAGAGCAAGG + Intronic
1085726507 11:78959651-78959673 TCAGAGCAAGGGCCTGGGGAAGG + Intronic
1089804255 11:121068956-121068978 AAAGTGCAAAGGCCTGAGGAGGG - Intronic
1089932049 11:122322681-122322703 CTAGACAAAAGGCCAGAGGAAGG - Intergenic
1090309125 11:125719350-125719372 CTAGAGCAATGTCCTAGGGCAGG + Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1092255803 12:6926339-6926361 CTAGATGGAAGGCCTGAGGATGG + Intronic
1092758285 12:11785221-11785243 CAAGTGCAAAGGCCTGAGGTAGG - Intronic
1094325957 12:29239317-29239339 CTAGAGAACTGGCATGAGAAAGG + Intronic
1096149144 12:49297770-49297792 CCAGAGCAAGAGCCCGAGGAGGG - Intronic
1096843331 12:54391728-54391750 CCAGAGTAATGGACTGAGCAGGG + Intergenic
1099640084 12:85275616-85275638 GAAGAGCAATGGTCTGAAGAGGG - Intergenic
1101039245 12:100737348-100737370 CTAGAGCAATGGCCTGAGGAGGG - Intronic
1101834225 12:108283950-108283972 CAAGTGCAAGGGCCTGAGGTGGG + Intergenic
1102812385 12:115835550-115835572 CCAGCGCAAAGGCCTGAGGCAGG - Intergenic
1103171427 12:118823529-118823551 CTTGAGCAAGTGCCTGAAGACGG - Intergenic
1103483811 12:121268999-121269021 CTGGAGCAATGGGCAAAGGAGGG + Intronic
1104855007 12:131897401-131897423 CTAAAGCAGGGGCCTGAGAACGG - Intronic
1106054637 13:26226952-26226974 GTGGAGCAATGGCCTATGGAAGG - Intergenic
1115016020 14:28615449-28615471 CTATTGTAGTGGCCTGAGGAAGG - Intergenic
1116224965 14:42138581-42138603 CAAGTGCAATGCCCTGAGGTTGG - Intergenic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1119986890 14:79148344-79148366 CTAGAGCAAAGGCCTGAGGTGGG + Intronic
1120398923 14:84003514-84003536 GAAGAGCACTGGCCTGAGGGAGG - Intergenic
1121007344 14:90498904-90498926 CCAGTGCAAAGGCCAGAGGAGGG + Intergenic
1121015436 14:90546175-90546197 CTAGAGGACTGGCCAGAGGTGGG + Intronic
1121051345 14:90820762-90820784 CTAGAGCAAAAGCCCCAGGAGGG + Intergenic
1121869557 14:97394741-97394763 CTTTAGCACTGGCTTGAGGATGG + Intergenic
1121878118 14:97473508-97473530 GTGGAGCAATGCCCTGAGAAGGG - Intergenic
1122172656 14:99889604-99889626 CTACAGCAGTGGCCTGAGAGTGG + Intronic
1123129799 14:105975776-105975798 CTGAAGCAGTGGCCTGAGGTTGG - Intergenic
1123519879 15:21062159-21062181 CTGAAGCAGTGGCCTGAGGGTGG + Intergenic
1126479205 15:49099326-49099348 CAAGTGCAACAGCCTGAGGAGGG + Intergenic
1126838122 15:52688367-52688389 CTAAAGCAATGGCATCAGGATGG + Intronic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1127302031 15:57664088-57664110 GTAAAACAATGGCCTCAGGAAGG - Intronic
1128082738 15:64865975-64865997 CTACAGCAATGGCTGCAGGAGGG + Exonic
1128679262 15:69636003-69636025 ATAAAACAATGGCCTCAGGAAGG + Intergenic
1129761993 15:78134542-78134564 CTTGAGCAATGCTGTGAGGAGGG + Intronic
1130608078 15:85335444-85335466 CAAGAGCAAGGGCCAGAGCAAGG + Intergenic
1130771038 15:86923943-86923965 CTAGAGTAATGGCTCCAGGAAGG - Intronic
1131235584 15:90694023-90694045 CCAAAGCCATGGCCTGAGAAGGG + Intergenic
1132513575 16:355350-355372 GTAGAGGAAGGCCCTGAGGAGGG + Intergenic
1132587869 16:714157-714179 CTGGGTCAAGGGCCTGAGGAAGG - Intronic
1135594294 16:23729910-23729932 CCAGGGCAATGTTCTGAGGAAGG - Intergenic
1136090592 16:27917025-27917047 CAAGTGCAAAGGCCTGAGGTGGG + Intronic
1137318983 16:47359077-47359099 CAAGGGCAAAGGCCTCAGGAGGG + Intronic
1138619308 16:58198371-58198393 CTAGGGCAACGGCCAGTGGAAGG - Intergenic
1141055468 16:80809854-80809876 ATAGAGGAATGGCATGAAGAAGG + Intergenic
1141186199 16:81789339-81789361 AGAGAGCAATGGCCTGATCATGG + Intronic
1141623589 16:85249838-85249860 CTGGAGCGATGGGCTGTGGAGGG - Intergenic
1143109159 17:4543885-4543907 CAAGAGCAGTGGCGTGGGGAAGG - Intronic
1148917826 17:50998081-50998103 CTAGAGCAATGGCATGATCTCGG + Intronic
1149664386 17:58355565-58355587 CTAAAGCATGGGCCTGGGGAAGG + Intronic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1154964403 18:21342323-21342345 CTAGAACAAGGACCTAAGGATGG - Intronic
1156674220 18:39508099-39508121 CTAGGGCTATTGCCTTAGGAAGG - Intergenic
1157248122 18:46071540-46071562 CTGGGGCAATGGCCTGGGGAGGG + Intronic
1158401446 18:57125141-57125163 AGAGAGCACTGGACTGAGGATGG + Intergenic
1160872512 19:1283638-1283660 CTAGAGGAAGGACCTGGGGAAGG - Intergenic
1161566262 19:5004500-5004522 CTAGAGCAATGCCCTCAGCCAGG + Intronic
1163077219 19:14904741-14904763 CTAATGCAAAGGCCTGAGGAAGG + Intergenic
1164603717 19:29580663-29580685 CTAGAGCTAAGGACTGAGGGTGG + Intergenic
1165811301 19:38613681-38613703 CGAGAGCAATGGCCAGAAAAGGG + Intronic
1166012316 19:39951606-39951628 CAAGAGAAATGACCTGAGAATGG - Intergenic
1166241221 19:41495723-41495745 TTAGAGTAATGGCCTAAGGGTGG - Intergenic
1166856387 19:45784424-45784446 CTAGAGCAGTGGCCTCTGGGGGG - Intronic
1167868053 19:52344273-52344295 CCAGAACAAAGGCCTGGGGAAGG - Intronic
1168545347 19:57245221-57245243 CAAATGCAATGGCCTGAGGTGGG - Intronic
926983370 2:18595148-18595170 ATAGAGCAAGGGCCTGAGAGTGG - Intergenic
928195735 2:29215339-29215361 CTGGAGCAATGGCCTGGGTCTGG + Intronic
929453847 2:42053123-42053145 CTGAAGCAAAGGCCTGGGGATGG + Intronic
930226232 2:48796784-48796806 ATACAGCAATGGCCTGAGCTAGG - Intergenic
931849250 2:66236282-66236304 CAGGAGCAATGGACTGAGGGGGG + Intergenic
932569647 2:72931830-72931852 TTAGAGCACTGGCATGGGGATGG - Intronic
934904505 2:98187034-98187056 CGAGAGCAAAGGCCTGAGCTGGG - Intronic
935376109 2:102399480-102399502 CTAGGGCAGGGGCCTGCGGAGGG + Intergenic
935625701 2:105170707-105170729 CTAGAACAATCCCCTGGGGAGGG + Intergenic
938134881 2:128748707-128748729 CAAGGCCAATGGACTGAGGATGG - Intergenic
938739849 2:134220717-134220739 CTAGAGCAAAGGAAAGAGGAGGG - Intronic
938957035 2:136308315-136308337 CAAGAGCAAAGGCATGGGGACGG + Intergenic
939204817 2:139087454-139087476 ATAGTGCAATGGCATGATGATGG + Intergenic
940887276 2:159000695-159000717 CGAGAGCAAGGACCTCAGGAGGG + Intronic
941241543 2:163044786-163044808 CAAGAGCAATGGTTTGAGCAAGG - Intergenic
942278577 2:174340482-174340504 CTTGATCACTGGCCTGCGGAGGG - Intergenic
943262314 2:185681868-185681890 CTATATCAAGGGACTGAGGAGGG - Intergenic
945373704 2:209053526-209053548 ATAGAGCAATGGCAAGAAGAAGG + Intergenic
947591959 2:231390953-231390975 CTTGAGCCAGGGCCAGAGGAGGG - Intergenic
1169017327 20:2302527-2302549 ACAGAGCTAGGGCCTGAGGATGG - Intronic
1169154147 20:3315032-3315054 CTACAGTCCTGGCCTGAGGAAGG - Exonic
1169174180 20:3494523-3494545 TTAGAGCATTGGCCTTAGCAAGG + Intronic
1171421564 20:25021100-25021122 CCAAAGCGATGGCCTGAGGCCGG + Intronic
1174050494 20:47764136-47764158 TTTGAGCAAAGACCTGAGGAGGG - Intronic
1174441293 20:50557099-50557121 CCAGAGAAATGGTCTGAGGTGGG - Intronic
1175157584 20:56982353-56982375 CTCAAGCAATGACCTGTGGACGG - Intergenic
1175597599 20:60247662-60247684 CTAGAAAAATGGTCTGAGGCCGG - Intergenic
1176108375 20:63399976-63399998 CTAGGGCTCTGGCCAGAGGAGGG - Intergenic
1177149107 21:17436837-17436859 CTAGAGCAATGCTCTGTGGAAGG + Intergenic
1180117028 21:45714882-45714904 CTAGAGCAAATGCCTGAAAATGG - Intronic
1181419669 22:22789039-22789061 CCAGAGCTCTGGCCTGAGGCAGG - Intronic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1183010692 22:34944270-34944292 CTAGTGCAGTGACCTGAGGGAGG - Intergenic
1183167167 22:36156574-36156596 CCTGAGCAAAGGCCTGAGGCTGG - Intronic
1183660310 22:39216177-39216199 CCAGAGGAATGGACTGAGCATGG + Intergenic
1184770553 22:46594471-46594493 CGGGAGCACTGGCCAGAGGAGGG + Intronic
1185047965 22:48538363-48538385 CCAGAAAACTGGCCTGAGGATGG - Intronic
951234755 3:20221149-20221171 CCAGAGCAAAGGCCTGAAGGTGG - Intergenic
951771039 3:26258101-26258123 CAAGAGCAATGGCCTTTGGCTGG - Intergenic
953443987 3:42946722-42946744 AGAGAGCAATGGCATGACGACGG - Intronic
953465567 3:43116400-43116422 ATAGAGCAAAGGCCAGGGGAAGG + Intergenic
954106958 3:48414689-48414711 GTAGAGCAAGGGCCGGTGGATGG - Intronic
954335270 3:49912632-49912654 CAGGAGCTATGGCCTGAGTAGGG - Intronic
955376871 3:58404662-58404684 CAAGAGCCATGGCCTGAACAAGG - Intronic
955387924 3:58493678-58493700 TTAGAGCATTGGCCTGGAGACGG - Intronic
955958966 3:64319502-64319524 CGAGAGCAAAGTCCTGAGGCGGG + Intronic
959186857 3:103056054-103056076 CAAGAAAAATGGCCTGAGAATGG - Intergenic
962990216 3:140571201-140571223 TTAGAGCAATGGCAAGAGTAGGG - Exonic
963045201 3:141097182-141097204 CTACAGCAATGGCCTATGTAAGG - Intronic
965412241 3:168346477-168346499 CTAGTGCAAAGGCCTGAGGCAGG - Intergenic
967079206 3:186033508-186033530 CAAGAGCAATTCCCTGAAGAAGG - Intergenic
968383188 4:112209-112231 CTATAGCAAGGGCCTGAAGATGG + Intergenic
969300631 4:6294958-6294980 ACAGAGCAATGGGCTGGGGACGG - Intronic
969652030 4:8473772-8473794 CTAGAGCAAGTGCCTCTGGAAGG + Intronic
971451474 4:26805475-26805497 CAAGAGGCACGGCCTGAGGAAGG - Intergenic
977138963 4:93342237-93342259 CTAGTGCAAAGGGCTAAGGATGG - Intronic
979932032 4:126642922-126642944 CTTCAGCACTGGCCTGAAGAGGG - Intergenic
981932459 4:150205871-150205893 CTGGGGCAATGGCCTGGGGGAGG - Intronic
986231021 5:5864875-5864897 CAAGAGCACAGGCCTGAGGGTGG + Intergenic
986347711 5:6850175-6850197 CTAGAGCAAAGGACAGATGATGG + Intergenic
990384484 5:55246340-55246362 TCAAAGCAGTGGCCTGAGGACGG - Intergenic
990507124 5:56455932-56455954 CAAGAGCAATGGCTGGAGAATGG - Intergenic
990883435 5:60565463-60565485 GTAGTGCAATGGCCTGATCATGG - Intergenic
992654012 5:78890511-78890533 CTAAAGCAATGGGCTGCAGAAGG - Intronic
992666569 5:79015283-79015305 CTAAAGCAGTGGCCATAGGATGG - Intronic
993257901 5:85616896-85616918 CTCAAGCAATGGCCTGAGCTGGG + Intergenic
995071687 5:107930022-107930044 CTGTTGCTATGGCCTGAGGAAGG - Intronic
998391019 5:141787048-141787070 CAAGAACATGGGCCTGAGGAGGG + Intergenic
998692176 5:144598925-144598947 CCTGGGGAATGGCCTGAGGAAGG + Intergenic
999871552 5:155756873-155756895 CTACAGCAATGACATGAGTATGG + Intergenic
1000302462 5:159968605-159968627 CTGGAGCCATGGCCCGAGGTGGG - Intronic
1001483049 5:172101771-172101793 TTAGAGCAATGACTTGAAGAGGG + Intronic
1002406570 5:179038314-179038336 GTTGAGCAGTGGCCTGAAGAAGG - Intergenic
1003513993 6:6803566-6803588 CTAAAGCTGTGGCCAGAGGAAGG + Intergenic
1003998498 6:11568215-11568237 CTAGAGTAATGGCCGTAGGTTGG + Intronic
1004127855 6:12890602-12890624 CTAGAGCAAAGGCCCTAAGAAGG - Intronic
1005592051 6:27338671-27338693 CAAGTGCAAAGGCCTGAGGCAGG - Intergenic
1005683620 6:28230944-28230966 CTAGAGCAAAGGTCTTATGATGG + Intronic
1006130881 6:31868880-31868902 TCAGAGCAATGTCCTGGGGAGGG + Intronic
1006234415 6:32616051-32616073 CTAGAGTCATGGCAGGAGGAGGG + Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008951859 6:57170637-57170659 CTTGAGCAAAGACCTGAAGAAGG + Intergenic
1012672113 6:102066536-102066558 CTTGAGCCATGTCCTGAGGTAGG + Intronic
1012811228 6:103961005-103961027 CTAGCTCAATGGCTTGAAGAAGG + Intergenic
1013130976 6:107232402-107232424 CTCCAGCAAAGGCCTGAGGAAGG - Intronic
1015630888 6:135230822-135230844 CTAGAGGAATGGGAAGAGGATGG - Intergenic
1020276678 7:6628760-6628782 CTTGAGCAAGAGCCTGAGGTGGG + Intergenic
1022175803 7:27870604-27870626 CAAGACCAAGGGCCTGGGGAGGG + Intronic
1023130977 7:37002979-37003001 CTTGAGCACTTTCCTGAGGAAGG + Intronic
1024103618 7:46058960-46058982 CTAGAGCAAGTTCCTGAGGGTGG - Intergenic
1025249596 7:57343090-57343112 CAAGTGCAAAGCCCTGAGGATGG - Intergenic
1029494081 7:100887956-100887978 CTAGGGCTATGGCCTGAGGATGG - Intronic
1031013049 7:116543711-116543733 TTAGAGCAGTGGCCTTAAGAAGG + Intronic
1033050400 7:137999133-137999155 CTAGAGCAAAGGCCTAAGGTAGG - Intronic
1033451601 7:141466971-141466993 CAAGAGCAATTGCCTGGGGTGGG - Intronic
1034201571 7:149285885-149285907 CCAGTGCCATGGCCTGGGGAGGG + Intronic
1034854278 7:154526310-154526332 CCATAGCCATGGCCTGAGAAGGG + Intronic
1035281189 7:157779506-157779528 GGAGGGCACTGGCCTGAGGAGGG - Intronic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1040572115 8:48620390-48620412 CTAGAGCATTGGCCTGGCGTAGG + Intergenic
1044803758 8:95983713-95983735 CTGCAGGAATGGCCTGAGGCAGG + Intergenic
1048937913 8:139372268-139372290 CTAGAGCCAAGGTTTGAGGATGG + Intergenic
1049039304 8:140100096-140100118 CAAGAGCAAGGGACTGCGGAAGG + Intronic
1049215616 8:141406494-141406516 CTTGAGCAAGGGCCAGAGGCAGG - Intronic
1051182548 9:14426654-14426676 CTAGAGGAATGGTTGGAGGAAGG - Intergenic
1052401950 9:28011798-28011820 CAAGAGAAGTGGCCTGATGAGGG + Intronic
1053549510 9:39061135-39061157 CTAGAGGAATTGCATCAGGATGG - Intergenic
1053813624 9:41881210-41881232 CTAGAGGAATTGCATCAGGATGG - Intergenic
1054616972 9:67306229-67306251 CTAGAGGAATTGCATCAGGATGG + Intergenic
1055282443 9:74690196-74690218 CTAGAGTAAAGGCCTGATGTGGG + Exonic
1057254701 9:93535953-93535975 TTAAATCAATGGCCTGAGCAGGG - Intronic
1057293718 9:93823449-93823471 CTAGAGGGCTGGCTTGAGGAGGG - Intergenic
1057916804 9:99062687-99062709 CTAGAGCAATGCTTTGAGGTGGG + Intronic
1059096436 9:111420731-111420753 CTAGAGGAGTGACCTGGGGAAGG - Intronic
1060123909 9:121023773-121023795 CTACAGGACTGGACTGAGGAAGG + Intronic
1060129856 9:121085814-121085836 CTAGAGCAATGGTATGTGGTGGG + Intronic
1061212414 9:129201538-129201560 CTAGAACGATGGCATGAGGTGGG + Intergenic
1062165745 9:135106441-135106463 CTGGACCCATGGCCTGGGGATGG - Intronic
1187437089 X:19281767-19281789 CTAGAGCAAGGCAATGAGGAGGG + Intergenic
1188340342 X:28992909-28992931 CTAGTGCAAAGCCCTGAGAATGG + Intronic
1189339926 X:40197164-40197186 CTGGAGCAAGGGCCTGGGGCTGG - Intergenic
1193602517 X:83525613-83525635 CTAGAGCAAAGAGCTGAGGTGGG + Intergenic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1195682605 X:107560125-107560147 CTAGATCAAGGGACAGAGGAAGG - Intronic
1196841677 X:119865081-119865103 CTAGTACAAAGGCCTGAGGCAGG - Intergenic
1198542702 X:137656992-137657014 CTGGAGCAATGGCCTGGTAAGGG + Intergenic
1198714365 X:139540844-139540866 CTAGAAAAGTGCCCTGAGGAAGG - Intronic
1200865647 Y:8040572-8040594 CCAGAGCAATGCCCAAAGGAGGG + Intergenic