ID: 1101039686

View in Genome Browser
Species Human (GRCh38)
Location 12:100742141-100742163
Sequence ATGTCCAGGCTTACTTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101039686 Original CRISPR ATGTCCAGGCTTACTTTGTT AGG (reversed) Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909796614 1:79747374-79747396 AAGGACAGGCTGACTTTGTTAGG - Intergenic
914343986 1:146782421-146782443 ATATCCATGCTTACTTCCTTAGG + Intergenic
916421557 1:164642240-164642262 AAGTGCAGGCTTACTCTATTTGG + Intronic
919310256 1:195897431-195897453 AGATCCAGGGTTTCTTTGTTAGG + Intergenic
920442841 1:205992766-205992788 ATGTCAAGGCTTCTTTTGCTGGG + Intronic
920875826 1:209834624-209834646 CTTCCCAGGCTTACTGTGTTAGG - Intronic
921181440 1:212634913-212634935 CTGGCCAGGTTTACTTTCTTAGG - Intergenic
921239856 1:213167836-213167858 ATGTCCAGACTTTTTTTTTTAGG + Exonic
923369997 1:233300435-233300457 ATATCCAGGCTTCCCTTGATAGG + Intergenic
923496164 1:234526738-234526760 ATGTGAAGATTTACTTTGTTGGG - Intergenic
1065756555 10:28936084-28936106 TTGCCCAGGCTTGCTTTGTATGG - Intergenic
1069578912 10:69551769-69551791 ACTTACAGACTTACTTTGTTTGG + Intergenic
1070448261 10:76530109-76530131 ATGTCCATGCTTTCTGTTTTGGG - Intronic
1071636047 10:87255149-87255171 ATGGCCGGGCTTACTTTGGGAGG - Intergenic
1074642234 10:115399300-115399322 ATGTCCTGGGTTTCTTTGGTTGG + Intronic
1080916260 11:36663451-36663473 AAGTGCAGGATTACTTGGTTAGG - Intergenic
1082293642 11:50412395-50412417 CTGTCCAGTCTTACCTGGTTTGG + Intergenic
1082733486 11:56828385-56828407 AAGTCCAGGGTTTCTTTGTTAGG - Intergenic
1085565726 11:77511959-77511981 ATGTCCAGTCTCACTTTGGTAGG + Intergenic
1086429606 11:86723332-86723354 ATGTTCATTCTTACTTTTTTTGG - Intergenic
1093096110 12:14974000-14974022 ATTTCAAGGCATACTTTTTTAGG - Intronic
1094114539 12:26896228-26896250 ATTTCCTGGATTTCTTTGTTAGG - Intergenic
1094798770 12:34005410-34005432 AAGTCCAGAGTTTCTTTGTTAGG - Intergenic
1099325672 12:81211675-81211697 ATGTCCATGTTTAATTTATTTGG - Intronic
1101039686 12:100742141-100742163 ATGTCCAGGCTTACTTTGTTAGG - Intronic
1102602883 12:114046126-114046148 ATGTCCACCCTTGCTTTTTTGGG + Intergenic
1102627306 12:114245290-114245312 AGGTACAGGCTTACCTTTTTAGG - Intergenic
1107863921 13:44685125-44685147 ACTTCCAGCCTTACTTTGTCAGG - Intergenic
1110242677 13:73286344-73286366 ATCTCCAGGGTTACTATGTCTGG + Intergenic
1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG + Intergenic
1114792197 14:25672223-25672245 ATATACAGGCTTACTCTGCTTGG - Intergenic
1115489808 14:33948449-33948471 ATTTCCAGGTTTACTTTGGCTGG - Intronic
1116246464 14:42420051-42420073 ATGTCCAGGCTTGTTTTATAAGG - Intergenic
1117654076 14:57936678-57936700 ATGTCAATGCTTCCTTGGTTTGG + Intronic
1117661195 14:58006635-58006657 ATGTCTAGGCTTTGTTTCTTGGG - Intronic
1119136940 14:72229696-72229718 ATGTACTGGCTTACTGAGTTGGG + Intronic
1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG + Intronic
1121703279 14:95972988-95973010 ATGTCTTAGTTTACTTTGTTGGG + Intergenic
1123538638 15:21263104-21263126 ACCTCCAGGCTTACTCTGATTGG - Intergenic
1126734168 15:51714809-51714831 ATGTTCATGCATACTTTATTTGG + Intronic
1128218591 15:65951720-65951742 TTGTACAAGCCTACTTTGTTGGG - Intronic
1138077290 16:54055196-54055218 ATGTTCAGTCTTGCTCTGTTTGG + Intronic
1139990009 16:70932914-70932936 ATATCCATGCTTACTTCCTTAGG - Intronic
1144048252 17:11472634-11472656 ATGTGCAGGGTTTCTTTGTGTGG + Intronic
1145193631 17:20868411-20868433 ACCTCCAGGCTTACTCTGATTGG - Intronic
1145404050 17:22570421-22570443 ACCTCCAGGCTTACTCTGATTGG - Intergenic
1145722846 17:27089342-27089364 ACCTCCAGGCTTACTCTGATTGG + Intergenic
1146443865 17:32920790-32920812 ATTTCTAGGCTACCTTTGTTGGG + Intergenic
1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG + Intronic
1157895215 18:51460161-51460183 ATGTCCTGTTTTCCTTTGTTGGG + Intergenic
1158558272 18:58492865-58492887 ATGTCCTGGCTGGCTCTGTTGGG + Intronic
1159677893 18:71308968-71308990 ATCTCCAAGATTAATTTGTTGGG + Intergenic
1162848057 19:13409084-13409106 ATCTCCAGGGTTACCTTGCTTGG + Intronic
1168589407 19:57620114-57620136 ATGTACATGCTGACTTTGGTGGG - Intronic
926072907 2:9914674-9914696 ATAACCAGACTTACTTTCTTTGG - Intronic
927054577 2:19356976-19356998 ATGTCAAGGCTGATTTTCTTGGG - Intronic
927296451 2:21460084-21460106 TTGTCCAGCCTTTCCTTGTTAGG + Intergenic
927591977 2:24364508-24364530 ATTTTCAGGGTTAGTTTGTTTGG - Intergenic
927645208 2:24873025-24873047 CTGGCCAGCCTTGCTTTGTTGGG - Intronic
929562612 2:42965146-42965168 ATGGCCAGGCTTACTTTGGGAGG + Intergenic
931175510 2:59850585-59850607 ATGGCCAGGCTTACCTTGTTAGG + Intergenic
934616682 2:95775525-95775547 ATGTCCAGGCTGACTCCCTTGGG - Intergenic
934644208 2:96049034-96049056 ATGTCCAGGCTGACTCCCTTGGG + Intergenic
934837623 2:97605124-97605146 ATGTCCAGGCTGACTCCCTTGGG + Intergenic
935612672 2:105042138-105042160 TTCTCCAGGCACACTTTGTTGGG + Intronic
936607259 2:113970999-113971021 ATGTGGGGGCTTACTGTGTTTGG + Intergenic
938399820 2:130981194-130981216 ATTCCCAGGCTATCTTTGTTTGG - Intronic
943518338 2:188914955-188914977 AAGTCCTGGCTTTCTTTGGTGGG - Intergenic
948325780 2:237119623-237119645 ATGTCCAGGATAATTTTGTTAGG - Intergenic
1169806803 20:9568006-9568028 AGATCCAGGCTTAGTTTGTGAGG + Intronic
1171562200 20:26135917-26135939 ACCTCCAGGCTTACTCTGATTGG - Intergenic
1173174032 20:40750848-40750870 AAGTCCAGGCTTCCTCTCTTGGG - Intergenic
1174536989 20:51258792-51258814 AGAACCAGGCTTCCTTTGTTTGG - Intergenic
1176649129 21:9529732-9529754 ACCTCCAGGCTTACTCTGATTGG + Intergenic
1177515975 21:22152223-22152245 ATATCCTGGCCTACTTTTTTTGG + Intergenic
1178951287 21:36988125-36988147 ATCTCCAGGCATACCTTTTTTGG - Intronic
1179040752 21:37800371-37800393 ATGTCCAGTGTTACATTGTGGGG + Intronic
1182262070 22:29080563-29080585 ATGACTAGGCCTTCTTTGTTAGG + Intronic
1184640972 22:45869857-45869879 ATTCCCAGGGTTACCTTGTTTGG - Intergenic
950204597 3:11069121-11069143 ATGCCTAGGCTGCCTTTGTTGGG + Intergenic
950728540 3:14935838-14935860 AAGTTCAGCCTTACTGTGTTAGG - Intergenic
951104075 3:18722603-18722625 GTGTCCAGGCTTATGTAGTTAGG - Intergenic
951501622 3:23394109-23394131 ATGTCTAAGCTTGCTTGGTTTGG + Intronic
952112681 3:30142488-30142510 GTGTAGAGGCCTACTTTGTTTGG + Intergenic
959066313 3:101660749-101660771 ATTTCAAGGCTTACATTTTTAGG + Intronic
959523799 3:107352684-107352706 ATGTCCGAGCTTACTTTATTAGG - Intergenic
962182488 3:133223213-133223235 ATTTGCAGACTTGCTTTGTTTGG + Intronic
966566505 3:181388166-181388188 ATTTCCAGGATTAATTTATTCGG + Intergenic
966953022 3:184841538-184841560 GTGTCCATGATTACTTTTTTAGG + Intronic
971749633 4:30630700-30630722 ATCTCCTAGCTTACTGTGTTAGG + Intergenic
974965687 4:68758378-68758400 AAGTCCAGAGTTTCTTTGTTAGG + Intergenic
975895180 4:79080344-79080366 AAGTTTAGGCTTGCTTTGTTGGG + Intergenic
976875064 4:89843291-89843313 ATGTGCAGGGTTGCTTTTTTTGG + Intergenic
976946789 4:90780283-90780305 ATGTTTAGACTTACTTTTTTAGG - Intronic
977188319 4:93968584-93968606 ATTTTCATGCTTACCTTGTTTGG - Intergenic
979651540 4:123138151-123138173 ATGTCCATGCCTCCTTTCTTGGG + Intronic
982822751 4:159964545-159964567 ATGTCCATTCTGTCTTTGTTGGG + Intergenic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
986915576 5:12615694-12615716 ATGTCCAGAGTTGCTTGGTTGGG - Intergenic
996247223 5:121279925-121279947 ATGAGAAAGCTTACTTTGTTTGG - Intergenic
998514077 5:142737078-142737100 TTGTCCAGGCTCACCTTGTCGGG + Intergenic
1001336175 5:170798720-170798742 ATGTCCAGGGCTACATTTTTAGG + Intronic
1003284684 6:4724397-4724419 ATGTCAGGGCTTACCTTGATGGG + Intronic
1004522478 6:16375124-16375146 ACGTCCAGGCTGTCTTTGCTGGG - Intronic
1014862822 6:126491188-126491210 AGGTCCTGGCTTACTTTGATGGG + Intergenic
1017083398 6:150690542-150690564 ATATGCATGCTTACTTTATTTGG - Intronic
1020839510 7:13197862-13197884 GACTCCTGGCTTACTTTGTTTGG - Intergenic
1025275661 7:57579788-57579810 ACCTCCAGGCTTACTCTGATTGG + Intergenic
1027947116 7:84761207-84761229 ATGTCCTTGTTTCCTTTGTTTGG + Intergenic
1028155939 7:87429442-87429464 ATTCCCAAGCTTACTTTCTTAGG - Intronic
1029147684 7:98458472-98458494 ATCCCCAGGCTGACTTTGGTGGG - Intergenic
1031068952 7:117140988-117141010 TTGGCCAGGCCTAATTTGTTTGG + Intronic
1033280328 7:140001882-140001904 ATGTCCAGGCTGAGATTTTTAGG - Intronic
1036820489 8:11935798-11935820 ATGTCCAGGCTTCCTTCGTATGG + Intergenic
1038824659 8:30987865-30987887 ATGGTCAGGCTTATTTTGCTCGG - Intergenic
1039066934 8:33617283-33617305 CTTTACAGGCTGACTTTGTTAGG + Intergenic
1041257464 8:55991490-55991512 ATGGGCAGGCTTATCTTGTTTGG - Intronic
1045943182 8:107763310-107763332 ATGGCCAGGCTTACATTTTAGGG + Intergenic
1046310786 8:112434185-112434207 TTGTCCAAAGTTACTTTGTTAGG - Intronic
1047922420 8:129649094-129649116 ATGTCCACGTTTCATTTGTTGGG + Intergenic
1048476903 8:134751741-134751763 ATGTCCAGGCCTCCTTTTCTAGG - Intergenic
1049061412 8:140278874-140278896 ATGGCCAGGCTTGCTTTGCAGGG - Intronic
1049527011 8:143132119-143132141 TTGTCCAGGCTTACGGTGCTTGG - Intergenic
1050672871 9:8017624-8017646 ATGTCCAGGCTGGTTTTGATTGG + Intergenic
1050753135 9:8965075-8965097 AAGTTCAGGATTCCTTTGTTAGG + Intronic
1050889946 9:10811872-10811894 ATGTCCAGGCCTTCTTTCATTGG + Intergenic
1052197021 9:25730210-25730232 ATTTCCAGGCCTGCTTTCTTGGG - Intergenic
1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG + Intronic
1052789683 9:32863671-32863693 ATGTCCAGGTTTTCTTTGCCTGG - Intergenic
1056587754 9:87939440-87939462 ACCTCCAGGCTTACTCTGATTGG - Intergenic
1056609115 9:88113500-88113522 ACCTCCAGGCTTACTCTGATTGG + Intergenic
1056814453 9:89791552-89791574 ATGTGCAGGTTTATTTTGTATGG + Intergenic
1058647395 9:107143130-107143152 ATTTCCACACTTACTTAGTTTGG + Intergenic
1059591458 9:115667270-115667292 ATGTCCAGGCTTGCCTTCTTGGG + Intergenic
1203626865 Un_KI270750v1:33280-33302 ACCTCCAGGCTTACTCTGATTGG + Intergenic
1189678153 X:43485545-43485567 ATGTCCTTGCTGACTTTTTTTGG - Intergenic
1191023982 X:55893867-55893889 AGGTCCTGGCTTACTTTTGTTGG + Intergenic
1192622644 X:72694505-72694527 ATATCCAGCCTTACCTTGATGGG + Intronic
1197108138 X:122740242-122740264 AGGTCCTGGCCTACTTTTTTGGG - Intergenic
1198294768 X:135275774-135275796 ATTCCTAGGCTAACTTTGTTGGG + Intronic
1199905060 X:152218422-152218444 ATGTTCAGTCTTATGTTGTTTGG + Intronic