ID: 1101044829

View in Genome Browser
Species Human (GRCh38)
Location 12:100794426-100794448
Sequence CATTAACAGCAGCAGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101044829 Original CRISPR CATTAACAGCAGCAGTGGAG AGG Intronic
900761798 1:4477441-4477463 CTTTTGCAGCAGGAGTGGAGTGG + Intergenic
900923644 1:5689627-5689649 AATTAAAAGCAGCACTGGATGGG - Intergenic
901416577 1:9120648-9120670 CTTTAACTGCAGAAGGGGAGAGG + Intronic
903302043 1:22386129-22386151 CATCATCAGCAGCAGGGGTGTGG - Intergenic
903525475 1:23990511-23990533 CATTCCCACCAGCAGTGTAGAGG + Intergenic
904110666 1:28123604-28123626 CAACAGGAGCAGCAGTGGAGGGG + Intergenic
904392584 1:30195758-30195780 CCTTGACAGCAGCCTTGGAGGGG - Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
909344657 1:74571639-74571661 CAGAAACAGCCGCAGAGGAGAGG - Exonic
911641922 1:100298662-100298684 CATTAAAAGCAGTAGTGAAAGGG + Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916642175 1:166742109-166742131 CATTCACAGCAGAAATGGAATGG + Intergenic
916711555 1:167415067-167415089 CATTAACAACAGGAGGTGAGTGG - Intronic
916822076 1:168409623-168409645 AGTCAACAGCAGCAGTGCAGAGG - Intergenic
918294440 1:183142884-183142906 CATGGACAGCAGCAGAGGAGTGG - Exonic
920083610 1:203397067-203397089 CAACAACAGCAGCAGAGAAGAGG + Intergenic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
922522063 1:226262669-226262691 CATTCCCAGCAGCAGTGAATGGG - Intronic
923438788 1:233995652-233995674 TAACAACAGCAGCAGAGGAGAGG + Intronic
923568232 1:235092553-235092575 CATTAACAGGAGAAGTGAGGCGG - Intergenic
923771182 1:236938924-236938946 CATGAGGTGCAGCAGTGGAGAGG + Intergenic
1063072697 10:2682106-2682128 CTCTGACAGCAGCAGTGGAATGG - Intergenic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1064303576 10:14144820-14144842 GATGAAGAGCAGCAGAGGAGAGG + Intronic
1064636240 10:17370744-17370766 CATTAACAGCACCAAGGAAGTGG - Intronic
1065363545 10:24912350-24912372 CATTCCCATCAGCAGTGTAGGGG + Intronic
1065636348 10:27740013-27740035 GATTTGCTGCAGCAGTGGAGGGG - Intronic
1066475756 10:35746138-35746160 CATTAACAGCAGGAGGGCAAAGG + Intergenic
1067695324 10:48530804-48530826 CATTCCCACCAGCAGTGTAGAGG - Intronic
1067738363 10:48876872-48876894 CATTTCCAGAAGCAGTGGAGGGG + Intronic
1067755952 10:49005392-49005414 CAGTCACAGCAACAGTGGACGGG + Intergenic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068102178 10:52569384-52569406 CATTGAGAGCAGGAGTGGAAGGG + Intergenic
1069597221 10:69680059-69680081 CACTGACTGCAGCAATGGAGAGG - Intergenic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069916563 10:71790397-71790419 CATCAACAGCAGCACCGGTGAGG + Intronic
1071290786 10:84187551-84187573 CATTCAGAACAGCAGTGGAGAGG + Intergenic
1072484103 10:95837906-95837928 CATGAACAGAAGCAGTGGTCTGG - Intronic
1072553525 10:96496913-96496935 CATTAGCAGGAGGTGTGGAGTGG + Intronic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074524876 10:114254507-114254529 CAGTAACAGCAGCAATGTGGAGG - Intronic
1074985357 10:118653660-118653682 CATTCCCACCAGCAGTGTAGAGG + Intergenic
1079141959 11:17817041-17817063 CAACACCAGCAGCAGAGGAGAGG - Intronic
1080147590 11:29005824-29005846 CAGTATCAGCACCTGTGGAGGGG - Intergenic
1082904696 11:58293033-58293055 CATTAACTGGAATAGTGGAGTGG - Intergenic
1083611935 11:64008462-64008484 CACTAAATGCAGCAGTGGAGGGG + Intronic
1084400967 11:68942693-68942715 CTTGCAAAGCAGCAGTGGAGAGG + Intergenic
1084454601 11:69261188-69261210 CATAATCAGCAAAAGTGGAGGGG - Intergenic
1087917979 11:103831946-103831968 CACTGGCAGCAGCAGTGCAGTGG - Intergenic
1088183784 11:107141187-107141209 CACTTTCAGAAGCAGTGGAGAGG - Intergenic
1088262071 11:107953736-107953758 CATAAACAGAAGCTGTGGTGTGG - Intronic
1089642077 11:119854362-119854384 CATTATGAGCAGGAATGGAGTGG - Intergenic
1090025131 11:123161061-123161083 CTTTGACAGCAGCACTGGAAAGG + Intronic
1090239021 11:125168762-125168784 CGTAAACAGCAGCAGAGCAGGGG + Intronic
1093533492 12:20195574-20195596 CATTCCCAGCAGCAGTGTATAGG + Intergenic
1094724337 12:33097749-33097771 CATTCCCACCAGCAGTGTAGAGG - Intergenic
1095736856 12:45567040-45567062 CAGAAAGAGCAGCAGAGGAGTGG + Intergenic
1096562269 12:52444695-52444717 CATTAGCAGAAGCTTTGGAGCGG - Intergenic
1096658641 12:53107256-53107278 CACCAAAAGCAGCAGTGGAGTGG + Intronic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1098380917 12:69868553-69868575 CATCTAAAGCAGCAGCGGAGGGG + Intronic
1099208160 12:79752075-79752097 CATTTATAACAACAGTGGAGTGG - Intergenic
1101044829 12:100794426-100794448 CATTAACAGCAGCAGTGGAGAGG + Intronic
1102833102 12:116025706-116025728 CATTATCAGAGGCAGGGGAGGGG + Intronic
1104070722 12:125343106-125343128 CATTAATAACAGCTGTGGTGGGG - Intronic
1104898189 12:132174346-132174368 CAGGCAGAGCAGCAGTGGAGCGG + Intergenic
1111986488 13:95071290-95071312 CAGAAGCTGCAGCAGTGGAGGGG + Intronic
1114225634 14:20735939-20735961 AATGAAGATCAGCAGTGGAGTGG + Intronic
1114227187 14:20749589-20749611 AATGAACATCAGCAGTTGAGAGG + Intergenic
1114229880 14:20771537-20771559 CATGAAGATCAACAGTGGAGAGG + Intergenic
1114278590 14:21169721-21169743 CTTCAACTGCAGTAGTGGAGGGG - Intergenic
1114483686 14:23050453-23050475 CATGCACAGCACCAGTGGGGTGG + Intronic
1115455472 14:33596905-33596927 CATTTAGAACAGCAGTGGACAGG + Intronic
1116101030 14:40436418-40436440 TATTAAGATCAGGAGTGGAGGGG + Intergenic
1116117585 14:40676402-40676424 CATTCCCACCAGCAGTGTAGAGG + Intergenic
1116348132 14:43822717-43822739 CAATAGCACCAGCACTGGAGAGG + Intergenic
1117252120 14:53948542-53948564 GATTAAGAGGAGCAGAGGAGAGG - Intergenic
1119267870 14:73275112-73275134 GATTTACAGCAGCAGTAGAATGG + Intronic
1121221837 14:92291384-92291406 CATAAACATCAGAACTGGAGAGG - Intergenic
1123008698 14:105336760-105336782 CATTCCCAGCAGCAGTGCACAGG - Intronic
1124841322 15:33244650-33244672 AATTGGCAGCAGCAGTGCAGAGG + Intergenic
1127050678 15:55080412-55080434 CATTCCCACCAGCAGTGTAGAGG - Intergenic
1127594225 15:60462263-60462285 CATTAACAGCTGGGGTGGTGGGG + Intronic
1127895359 15:63294036-63294058 AATTAAAAGCAGCAGTGGCTAGG - Intronic
1127932116 15:63603794-63603816 CACCACCAGCTGCAGTGGAGTGG + Intergenic
1128387422 15:67160248-67160270 CATTTGCACCAGCAGTGGAAGGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1130088370 15:80797664-80797686 CAGTCACTGCAGCAGAGGAGAGG - Intronic
1130123025 15:81068616-81068638 CATGTCCAGCAGCAGTGGAGGGG + Intronic
1132413618 15:101604614-101604636 CATTAGGAGTGGCAGTGGAGGGG - Intergenic
1135529773 16:23243078-23243100 CAGTGACAGTAGGAGTGGAGAGG + Intergenic
1137431447 16:48421104-48421126 CATTCTCACCAGCAGTGGTGAGG - Intronic
1137638782 16:50010319-50010341 AAATAACAGCAGCAGTGATGAGG + Intergenic
1138400954 16:56743584-56743606 GATTGGCAGCAGCAGTGGGGCGG + Intronic
1139270028 16:65673246-65673268 AATTAAAAGCAGCAGGGGATTGG + Intergenic
1140597102 16:76429582-76429604 CATTAAGAGCAACAGTTTAGTGG + Intronic
1142726727 17:1820702-1820724 TATTAATTGCAGGAGTGGAGAGG + Intronic
1142905688 17:3040202-3040224 CAGTAACAGCAGAGGTGGATGGG + Intergenic
1143394202 17:6579193-6579215 AATAAACTGCAGCAGAGGAGAGG + Exonic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1146677355 17:34782627-34782649 CACTAACAGCAGTAGGGGTGGGG + Intergenic
1148749017 17:49934253-49934275 GATTCACTGCAGCAGGGGAGGGG - Intergenic
1148957981 17:51369811-51369833 CATTCACTGCAGGAGGGGAGGGG + Intergenic
1150950932 17:69801700-69801722 CATGAACAGCTGCAGGAGAGAGG + Intergenic
1151233297 17:72700273-72700295 CATTAACAGTTGGGGTGGAGCGG + Intronic
1151926857 17:77204079-77204101 CAATGGCGGCAGCAGTGGAGCGG - Intronic
1154103228 18:11496401-11496423 CAATAATGGCATCAGTGGAGGGG - Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1155550460 18:26959570-26959592 CATTAACAGAAGCAGATTAGGGG + Intronic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1157343780 18:46804885-46804907 CAAGAAAAGCAGCAGTAGAGAGG + Intergenic
1157994062 18:52533849-52533871 CATTCACATCAGCAGTGTATAGG + Intronic
1159818109 18:73102731-73102753 CATTAACAGAAGCACTCGATTGG + Intergenic
1160378919 18:78434611-78434633 CATTCCCACCAGCAGTGGATAGG - Intergenic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1164513853 19:28917907-28917929 TATTAACAGCAGCAGTGATGAGG - Intergenic
1164719759 19:30423778-30423800 CAGTGACAGCAGCTGTGGCGGGG + Intronic
1165148421 19:33747257-33747279 CACTAACTGCAGCAGGGGAAGGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167898783 19:52602478-52602500 GATAAACAGCAGAAGAGGAGAGG + Intronic
1167903106 19:52637079-52637101 GATAAACAGCAGGAGAGGAGAGG - Exonic
1167904510 19:52647699-52647721 AATAAACAGCAGCAGAAGAGAGG - Intronic
1167921251 19:52785158-52785180 GATAAACAGCAGGAGAGGAGAGG - Intronic
1167940301 19:52941376-52941398 GATAAACAGCAGGAGAGGAGAGG - Intronic
925187652 2:1860229-1860251 CACGTCCAGCAGCAGTGGAGCGG + Intronic
925454605 2:4004494-4004516 CATCAACAGCAGGTGTGGAATGG - Intergenic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
927110264 2:19859412-19859434 TATTAACAGCAGAAGTGAAGGGG - Intergenic
929722459 2:44384080-44384102 CATTCCCACCAGCAGTGTAGAGG + Intronic
931315986 2:61132552-61132574 CATTCCCATCAGCAGTGTAGAGG - Intronic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
934674360 2:96239239-96239261 CAAGAACAGCTGCAGTGGTGGGG + Intergenic
936614987 2:114039469-114039491 CACTTACAGCAGCAGTTGGGAGG - Intergenic
936720229 2:115242616-115242638 CATTACTACCAGCAGTGTAGAGG + Intronic
940944821 2:159603736-159603758 CATTAATAGTTTCAGTGGAGTGG - Intronic
941300395 2:163794114-163794136 CAATAAAAGCATCAGTGAAGTGG + Intergenic
941656680 2:168151918-168151940 AATTAGCCACAGCAGTGGAGAGG + Intronic
941683929 2:168428406-168428428 CACTAACGGCAGCAGAGCAGTGG + Intergenic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942526687 2:176860739-176860761 AATGAAGAGCAGAAGTGGAGGGG - Intergenic
945480739 2:210342522-210342544 CATTCTCACCAGCAGTGTAGAGG + Intergenic
945803888 2:214466384-214466406 CATTAAAAGCAGCTAGGGAGGGG - Intronic
1169477090 20:5941297-5941319 CAAAGACAGCAGCAGGGGAGTGG + Exonic
1170458340 20:16554063-16554085 CATGAACAGCAGCAGGAGACAGG + Intronic
1171004518 20:21451223-21451245 AATTAACAGCACCAATTGAGGGG + Intergenic
1172223559 20:33289704-33289726 CATTGTGAGCAGGAGTGGAGGGG + Intronic
1174157722 20:48527606-48527628 CAACAGCAGCAGCAATGGAGAGG - Intergenic
1178744774 21:35238255-35238277 CATGAACAGCAGGGGTGGAGGGG + Intronic
1178963120 21:37086596-37086618 CATTAGAAGCAGCAGTCGATAGG + Intronic
1179439271 21:41381763-41381785 CATTCCCACCAGCAGTGGAGGGG - Intronic
1181377059 22:22467720-22467742 CATTCCCACCAGCAGTGTAGAGG - Intergenic
1182170721 22:28226248-28226270 CATTCTCAGCAGCAGTGTATGGG + Intronic
1182639129 22:31752978-31753000 GATTAGAAGCAGCAGAGGAGAGG + Intergenic
1182685839 22:32121282-32121304 CATTTCCTGCAGCAGTGGTGGGG - Intergenic
950360172 3:12444452-12444474 CATAAACAGCCACAGGGGAGGGG - Intergenic
951778148 3:26333344-26333366 CATTTTCAGCAGCAGTGTACAGG + Intergenic
951980969 3:28566470-28566492 CATTAATTCCTGCAGTGGAGAGG + Intergenic
953385389 3:42503036-42503058 CAGGCACAGCATCAGTGGAGGGG + Intronic
953427656 3:42808614-42808636 CATAAACAGAGGCAGTGTAGGGG + Intronic
955355534 3:58228441-58228463 CATTCCCACCAGCAGTGTAGAGG - Intergenic
955526216 3:59822403-59822425 CATTCCCATCAGCAGTGTAGAGG + Intronic
958262943 3:91403980-91404002 CATCAGCAGTAGCAGTGCAGAGG + Intergenic
959274870 3:104265861-104265883 CATTCCCACCAGCAGTGTAGAGG + Intergenic
961325805 3:126108582-126108604 CAGTGACAGCAGCAGTGCAATGG + Intronic
963446720 3:145420548-145420570 CATTAACATGAGCAGTCGTGTGG + Intergenic
964191320 3:154004334-154004356 CAGTCATAGCAGCAGTGGAGAGG + Intergenic
965717031 3:171615947-171615969 CACTCCCAACAGCAGTGGAGGGG + Intronic
967956462 3:194881116-194881138 CATTTACTGCAGCAGTAGTGGGG - Intergenic
970764764 4:19534342-19534364 ACTTCACAGCAGCAGTGAAGCGG + Intergenic
970948284 4:21721229-21721251 CATTAAAGGCAGCATTAGAGTGG - Intronic
972269564 4:37497486-37497508 CATTCCCACCAGCAGTGTAGAGG + Intronic
973639814 4:52891797-52891819 CATCAACTGCAGCAGATGAGAGG - Intronic
973853639 4:54987273-54987295 TAGTAGTAGCAGCAGTGGAGTGG - Intergenic
976627368 4:87200670-87200692 CATTCCCACCAGCAGTGGAAAGG - Intronic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
979509410 4:121535266-121535288 CATGAACACCAGGAATGGAGAGG + Intergenic
980768727 4:137343170-137343192 CACTCACAGCAGCTGTGGAATGG + Intergenic
980784018 4:137529601-137529623 CCTCAACAGCAGGAGTGGCGTGG + Exonic
981579652 4:146238874-146238896 CATTCAAAGCATCTGTGGAGGGG + Intergenic
988034825 5:25813761-25813783 CATTGCCACCAGCAGTGCAGAGG + Intergenic
988635036 5:32974012-32974034 CAGTAACAGGAGCAGTGGTTTGG - Intergenic
990320677 5:54627392-54627414 CATTAACAGCAATACTGGATGGG - Intergenic
992015495 5:72571613-72571635 CATGAACACCAGCAATGAAGAGG + Intergenic
992120304 5:73585773-73585795 CACCATCAGCAGCACTGGAGAGG + Intergenic
992436420 5:76759753-76759775 GAGTGACAGCAGCAGGGGAGGGG + Intergenic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
998327118 5:141290992-141291014 CATTACTAGCAACACTGGAGTGG - Intergenic
999552472 5:152704359-152704381 CTTTAAGTACAGCAGTGGAGAGG + Intergenic
1000090363 5:157924851-157924873 CTTTAATAGCAGTAGTGGTGTGG - Intergenic
1000661392 5:163943434-163943456 CATTCCCACCAGCAGTGGACAGG - Intergenic
1001029005 5:168248007-168248029 CATGGAGAGCAGCAGTGGGGAGG + Exonic
1003122065 6:3326557-3326579 CAAAAACAGAAGGAGTGGAGAGG - Intronic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1007139108 6:39554040-39554062 CAAGAACAGCATCAGTGGAAAGG + Intronic
1008992464 6:57618906-57618928 CATCAGCAGTAGCAGTGCAGAGG - Intronic
1009181085 6:60518019-60518041 CATCAGCAGTAGCAGTGCAGAGG - Intergenic
1009919734 6:70042725-70042747 AAGTAACAGCAGCATTTGAGAGG - Intronic
1009978475 6:70699705-70699727 CGTTAACATCAGCAGTGGCGAGG - Intronic
1012429116 6:99145735-99145757 CATTAACAGGAGCTATGGTGGGG - Intergenic
1012890001 6:104886603-104886625 CAATAAGAGCCTCAGTGGAGAGG - Intergenic
1016212910 6:141562205-141562227 CATGATCGGCAGCAGAGGAGTGG + Intergenic
1016905965 6:149151198-149151220 CACTGAAAGCAGCAGTGGGGAGG + Intergenic
1017894471 6:158667384-158667406 CATTAACAGGAGAAGTCGGGAGG + Intronic
1017911469 6:158796462-158796484 CAATATCAGCAGCAAGGGAGAGG - Intronic
1019345943 7:531048-531070 CCATCACAGCAGCACTGGAGTGG - Intergenic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021203711 7:17754060-17754082 CATTGCCAGCAGCAGTGGTGTGG - Intergenic
1021640855 7:22735004-22735026 TATCCACAGCAGCAGTGGTGTGG + Intergenic
1023818363 7:43966664-43966686 CATTCCCACCAGCAGTGTAGAGG - Intergenic
1024708640 7:51989730-51989752 CATTACCATCAACAGTGGATAGG - Intergenic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1026200055 7:68206815-68206837 GCTTAACAGCAGCAGTGAAAAGG + Intergenic
1026486050 7:70822291-70822313 CATTCCCACCAGCAGTGTAGAGG - Intergenic
1028481389 7:91309753-91309775 CATTAACACCAGCAGTGTATTGG + Intergenic
1029742992 7:102501496-102501518 CATTCCCACCAGCAGTGTAGAGG - Intronic
1029760982 7:102600657-102600679 CATTCCCACCAGCAGTGTAGAGG - Intronic
1031431192 7:121671544-121671566 TATTCACAGCAGCTGTGGATGGG + Intergenic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031972363 7:128074008-128074030 CATGAAAAGCAGGAGAGGAGAGG - Intronic
1033336548 7:140458058-140458080 CATTTCCAGCAGCAGTGTATGGG - Intronic
1033407865 7:141088186-141088208 CAATGTCAGCATCAGTGGAGTGG + Intronic
1034504089 7:151472269-151472291 CCTCAGCGGCAGCAGTGGAGGGG - Intronic
1037210248 8:16377296-16377318 CATAAAAAGCAGAAGAGGAGAGG - Intronic
1037406786 8:18551127-18551149 CTTTCACAGGAGCAGTGCAGAGG - Intronic
1040669835 8:49676755-49676777 CATTCAAAGCAGCTGTGTAGAGG - Intergenic
1041719132 8:60960585-60960607 GAGTCACAGCAGCAGTGGAGAGG - Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1042940318 8:74100686-74100708 TTCTTACAGCAGCAGTGGAGAGG - Intergenic
1043075827 8:75698315-75698337 CATGAACAGCACCAATGGAGAGG - Intergenic
1045249142 8:100468574-100468596 CACAAACAGCAGCAGGGCAGGGG + Intergenic
1046275419 8:111953158-111953180 GGTTACCAGGAGCAGTGGAGGGG - Intergenic
1046868171 8:119174218-119174240 CCTTAACAGGAGCAGTGGAGTGG + Intronic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1048762086 8:137805945-137805967 CATCAGCAGCATCTGTGGAGTGG + Intergenic
1050082396 9:1928705-1928727 CATGAATAGCAACAATGGAGAGG - Intergenic
1053043963 9:34898280-34898302 CATTCCCACCAGCAGTGTAGAGG + Intergenic
1053221056 9:36313584-36313606 CATGAACAGGACAAGTGGAGTGG + Intergenic
1055183635 9:73422679-73422701 CATAAACAGCAACAGTGGAGGGG - Intergenic
1055426962 9:76206365-76206387 TATTAACAGCAGCAATGCTGAGG + Intronic
1056828473 9:89892999-89893021 CATTGTCAGTGGCAGTGGAGGGG - Intergenic
1058912247 9:109532020-109532042 AATTAACAGCAGAAATGAAGAGG - Intergenic
1059081963 9:111259755-111259777 CATTCACAGCAGAAGGGGAAGGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060808838 9:126597653-126597675 AATAAACAGCAAGAGTGGAGAGG + Intergenic
1060920283 9:127415699-127415721 CATTCCCACCAGCAGTGTAGGGG + Intergenic
1061276372 9:129571263-129571285 GATTAACAGCAGCTGTGGGCTGG + Intergenic
1061519126 9:131107233-131107255 CATGAACGGCAGCAGTGGTTGGG - Intronic
1062711010 9:137975222-137975244 CGGGCACAGCAGCAGTGGAGGGG - Intronic
1187099375 X:16177166-16177188 CATTTAAAGGAGCACTGGAGTGG - Intergenic
1187576633 X:20563383-20563405 AAGTGAAAGCAGCAGTGGAGAGG - Intergenic
1187933775 X:24316540-24316562 AATTAACGGCAGCAGGGAAGAGG - Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190577262 X:51852725-51852747 CCTCCACAGCAGCAGGGGAGCGG + Intronic
1191720604 X:64225440-64225462 CATCAACAGCAGGAGTGGCTGGG - Exonic
1191995260 X:67088808-67088830 CATTGACAGTAGCAGTGGTAAGG + Intergenic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1195267244 X:103194440-103194462 CATTCACAACAGCAGTGCATAGG - Intergenic
1198263320 X:134986168-134986190 CATTCATAAAAGCAGTGGAGAGG - Intergenic
1198320005 X:135511163-135511185 CATTCACAGCAGCTGTGGGATGG + Intergenic
1200783217 Y:7235679-7235701 CATTACCAGCAGGAGTGCATGGG + Intergenic