ID: 1101044931

View in Genome Browser
Species Human (GRCh38)
Location 12:100794993-100795015
Sequence AAGAGTCAACAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 764}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101044931_1101044934 -10 Left 1101044931 12:100794993-100795015 CCCTTCTCCTTCTGTTGACTCTT 0: 1
1: 0
2: 5
3: 64
4: 764
Right 1101044934 12:100795006-100795028 GTTGACTCTTTCTATTTTTATGG 0: 1
1: 0
2: 7
3: 35
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101044931 Original CRISPR AAGAGTCAACAGAAGGAGAA GGG (reversed) Exonic
900141417 1:1140741-1140763 GAGAGTCCACAGGTGGAGAACGG + Intergenic
900217125 1:1487505-1487527 AAGAGTCCACGCAAGGAGCAGGG - Intronic
900721958 1:4182439-4182461 TAGAGTTAATATAAGGAGAAAGG + Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900821450 1:4892531-4892553 AAGACTCAAGAGTAGTAGAATGG - Intergenic
900841366 1:5051144-5051166 TAGAGTTAATATAAGGAGAAAGG - Intergenic
901300444 1:8196492-8196514 AAAAGTTAACATCAGGAGAATGG + Intergenic
902315099 1:15612775-15612797 AGGAGGCTAAAGAAGGAGAATGG + Intergenic
902359035 1:15932021-15932043 AAGAGTGACCAGAAAGAGATTGG + Exonic
903396290 1:23004091-23004113 ATGAGTCAACAAAGGGAGATAGG + Intergenic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904917092 1:33977901-33977923 AAGAGTCAACAGAAGCGGGCAGG + Intronic
905121830 1:35688453-35688475 AAGAGTCAGAAGATGCAGAAAGG + Intergenic
905332265 1:37213483-37213505 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
905332417 1:37214617-37214639 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
907917492 1:58884385-58884407 AAGAGTCCCCTAAAGGAGAATGG - Intergenic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908387826 1:63659239-63659261 AAGACTTAACAGCAGGAGAGTGG + Intronic
908574231 1:65441965-65441987 GAGAGTGAAGAAAAGGAGAATGG + Intronic
908697775 1:66864462-66864484 AGGTGTCAACAGATGGAGACTGG + Intronic
909081541 1:71118384-71118406 AAGAGAAAAAAGAAAGAGAAGGG + Intergenic
909536699 1:76745171-76745193 GAGATTCAACAGCAGAAGAAAGG - Intergenic
909932102 1:81507984-81508006 TAAAGTCAAGAGAAGGAGATTGG - Intronic
910003055 1:82360255-82360277 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
910006993 1:82410003-82410025 AAGAGTAAAAGGAGGGAGAATGG + Intergenic
910574070 1:88738425-88738447 AAGAGATAACTGCAGGAGAAAGG + Intronic
911367889 1:96961601-96961623 AACAGTCAACAAAATGAAAAAGG + Intergenic
911489550 1:98546484-98546506 AAGAGTCAGCAAAAGGGGGAAGG - Intergenic
911975458 1:104489046-104489068 AAGAATCAAAAGAAGCAAAATGG - Intergenic
912540654 1:110412497-110412519 ATGAGTCAACAAAAGGAGTTAGG - Intergenic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
912592883 1:110844648-110844670 AAAAGTTAACAGATGGAGAAAGG - Intergenic
912961213 1:114197356-114197378 ATGATTCCAAAGAAGGAGAAGGG - Intergenic
912992297 1:114500551-114500573 AAGAGTGAGCAAAAGGTGAATGG + Intronic
913225035 1:116691602-116691624 AAGAGTGATTTGAAGGAGAAAGG + Intergenic
913523309 1:119666847-119666869 AATGTTCAACAGAAGTAGAATGG - Intronic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914931581 1:151939004-151939026 AAGAGTCCTTAGAAGTAGAAAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916531580 1:165661402-165661424 AAGAGAAAACAGCAGGGGAAAGG - Intronic
916898220 1:169190204-169190226 AAAAATCAACAGTAGGGGAATGG + Intronic
916958753 1:169867734-169867756 AAGAGACAACAGTAGGAGCCAGG - Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
918393543 1:184091196-184091218 ATGATCCAAAAGAAGGAGAAGGG + Intergenic
918625563 1:186652777-186652799 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
918780057 1:188688452-188688474 AATAGTCAACAAAAGGGAAAAGG - Intergenic
918784600 1:188749743-188749765 AAGATTCAAAAGAAGCAAAATGG - Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
918933124 1:190883083-190883105 AAGAGTCAACAGAAATCTAAAGG + Intergenic
919368051 1:196690621-196690643 AATAGGCAAAAGAAAGAGAAAGG + Intronic
919380823 1:196858790-196858812 AATAGGCAAAAGAAAGAGAAAGG + Intronic
919435923 1:197560845-197560867 GATCGTCAACTGAAGGAGAATGG - Intronic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
920267749 1:204737050-204737072 AAGAGTCAAGAGAGAGGGAATGG + Intergenic
920879001 1:209863007-209863029 AGGTGTCAACAGGAGGCGAATGG + Intergenic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
920970702 1:210741539-210741561 AAGATTCCCCAGAAGGAAAATGG - Intronic
921181285 1:212633535-212633557 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
921257207 1:213353413-213353435 AAGAGGCAACTGAAGCAAAAAGG + Intergenic
921520574 1:216150708-216150730 TAGAGTTAATATAAGGAGAAAGG - Intronic
921764747 1:218958286-218958308 AAAAGTCAATAGTAGGAGAAGGG - Intergenic
921987914 1:221332800-221332822 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922219833 1:223550160-223550182 AAGAGTGGAGAGAAAGAGAAGGG - Intronic
922412198 1:225387778-225387800 GACAGTAAACAAAAGGAGAAAGG + Intronic
922663601 1:227450596-227450618 AAGAGTCCACACAAGGAGAGAGG - Intergenic
923075738 1:230607164-230607186 TAGAGTTAATATAAGGAGAAAGG - Intergenic
923120393 1:230984701-230984723 AAGAATCAAAAGAAGCAAAATGG + Intronic
923646468 1:235826375-235826397 AAGATTAAACAGCAGGTGAATGG + Intronic
923650369 1:235867375-235867397 AGGAGTCAGGAGAGGGAGAAAGG + Intronic
923831051 1:237557743-237557765 TAGAATCAGCAGAAGGACAAAGG + Intronic
923841453 1:237676202-237676224 AAGAGTCATCATTTGGAGAAAGG + Intronic
923980193 1:239312835-239312857 AAGAGGCGAAAGATGGAGAATGG + Intergenic
1063160648 10:3415853-3415875 AAAAGTCAAGAGAAGGAGAAGGG - Intergenic
1063740109 10:8808011-8808033 AATAGGCAAAAGAAGGAGAAAGG + Intergenic
1063804374 10:9621275-9621297 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1063985926 10:11501804-11501826 AGGAGAGAAAAGAAGGAGAAAGG - Intronic
1064325908 10:14350999-14351021 AATAGGCAAAAGAAAGAGAAGGG + Intronic
1064617592 10:17177769-17177791 AAGAATCATCAGAAAAAGAAAGG - Intronic
1065392257 10:25194870-25194892 AATAGTCAACAGAGGTAGGAGGG - Intronic
1065442216 10:25764286-25764308 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1065485491 10:26232861-26232883 TAGAGACACAAGAAGGAGAAGGG - Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067360064 10:45571454-45571476 GAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067360773 10:45575971-45575993 AAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067409830 10:46054649-46054671 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1068297923 10:55098942-55098964 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1068489645 10:57706967-57706989 CAGAGCCAACAGACAGAGAAGGG + Intergenic
1068522608 10:58094177-58094199 GAGAGTCAGCAGACGGAGATAGG + Intergenic
1068578212 10:58708481-58708503 AATAGGCAAAAGAAAGAGAAAGG + Intronic
1069586423 10:69606937-69606959 AAAACTCAACAAATGGAGAAGGG + Intergenic
1069759524 10:70799040-70799062 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070461145 10:76671769-76671791 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1070949155 10:80417134-80417156 AAGAATCAAAAGAAGCAAAATGG + Intronic
1071714885 10:88085686-88085708 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1071886029 10:89951654-89951676 CAGAGACAACAGAGAGAGAATGG - Intergenic
1072167632 10:92829390-92829412 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1072758426 10:98036351-98036373 AAAAGTGAACAGAAGAGGAAGGG + Intergenic
1073164041 10:101428020-101428042 AGAAGGCAACAGAAAGAGAATGG - Intronic
1073541459 10:104319043-104319065 AAGACTCAACAGAAGCACCAGGG + Intronic
1073698588 10:105898581-105898603 TAGATTGAACAAAAGGAGAATGG + Intergenic
1073723102 10:106197612-106197634 AAAAAACAACAGAAGGAAAATGG - Intergenic
1074213754 10:111363946-111363968 AACAATCAACAACAGGAGAAGGG + Intergenic
1074603590 10:114938624-114938646 AAGAGACAAAAGGAGGGGAAAGG + Intronic
1075293027 10:121246643-121246665 AACAGCCAACAGTAGGGGAATGG + Intergenic
1075564275 10:123492372-123492394 GAGAGACAAGAGGAGGAGAAGGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1077615457 11:3670703-3670725 AGGAGGCAGCAGAGGGAGAAGGG - Intronic
1078391444 11:10938665-10938687 AAGAGGAAAAAGAAGGGGAAGGG - Intergenic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1078923343 11:15851713-15851735 AAGAGTCAACACAATGACACGGG + Intergenic
1079115279 11:17636660-17636682 AAGACAGAAGAGAAGGAGAAAGG - Intronic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079364910 11:19800650-19800672 AAGAGAGAAAAAAAGGAGAATGG + Intronic
1079917736 11:26391501-26391523 AAGAGTCAAGGGAAGGGGTAGGG + Intronic
1080139860 11:28903823-28903845 TAGAGCCTTCAGAAGGAGAATGG - Intergenic
1080160118 11:29163620-29163642 GAGAGGCAGCAGAAGTAGAATGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080249361 11:30215752-30215774 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1081022882 11:37969308-37969330 GAGAGTCAGCAAAAGGAGATAGG + Intergenic
1081357177 11:42125233-42125255 AAGAGTCAGCAAAAGGAGATAGG - Intergenic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082284189 11:50301781-50301803 AAGAGGCAGCAGAGGGAGCAGGG - Intergenic
1082632611 11:55559683-55559705 AAGAGTCAGCAAAGGGAGAAAGG - Intergenic
1082672801 11:56056288-56056310 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1082786734 11:57321442-57321464 AAGAGTCTACACAAGGAGCCAGG + Intronic
1083331662 11:61901264-61901286 AAGAGTCAACAGAGGGACAGAGG + Intronic
1083353051 11:62044813-62044835 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1083422458 11:62562163-62562185 AAGAATCAAAAGAAGCAAAATGG - Intronic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084353709 11:68623084-68623106 AAGAGTCAGCAAAGGGAGATGGG - Intergenic
1084796154 11:71505799-71505821 AAGAGTCAGCGAAAGGAGATAGG - Intronic
1085005526 11:73085384-73085406 AGGAGTCAACTGAAAGAGAGGGG + Intronic
1085987686 11:81806451-81806473 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
1086007452 11:82054517-82054539 GAGAGTGAACAGCTGGAGAATGG - Intergenic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086549930 11:88043685-88043707 AAGAGTCAGCAAAGGGAGATGGG - Intergenic
1086954591 11:92923055-92923077 AAGACTCAACCAAAGTAGAAGGG + Intergenic
1087197502 11:95315831-95315853 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1087837644 11:102890897-102890919 AAGAGGCAAGAAAAGGAGGAAGG - Intergenic
1088710683 11:112505788-112505810 AAGAGGCTAAAGCAGGAGAATGG - Intergenic
1089390744 11:118099911-118099933 AAGATTCAACTGAAGGAGCAGGG + Intronic
1090123741 11:124062671-124062693 AAGAAACAACAGAAGCTGAAAGG - Intergenic
1090305914 11:125690834-125690856 AAGAGTGAACAGAAAGGGAGTGG + Intergenic
1090309154 11:125719584-125719606 AAGAATCAACTGAGGCAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090970301 11:131636653-131636675 CAGAGCCCACGGAAGGAGAATGG + Intronic
1091215637 11:133899699-133899721 CAGAGTCCACAGAAAGAGAGGGG + Intergenic
1091771371 12:3153597-3153619 AACATTCAACAGTAGGAAAACGG - Intronic
1091970720 12:4784635-4784657 AAGAATCAACACACGGAGAGAGG - Intronic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1092291255 12:7160553-7160575 AAGAGGCCAGAGAAGGAGGAAGG - Intergenic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092725451 12:11481116-11481138 ATGTGTCAAGAGAAGGTGAAAGG + Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093359079 12:18201723-18201745 TAGAGTTAACATAAGGAGAAAGG - Intronic
1093577024 12:20743522-20743544 AGGAGTCAAGAAAAGGAGGAAGG - Intronic
1093808298 12:23463536-23463558 AAGATTCAGGAGAAGGAGAGTGG - Intergenic
1093928687 12:24933732-24933754 AATAGGCAGAAGAAGGAGAAAGG + Intronic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1094744077 12:33322976-33322998 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1094826367 12:34272257-34272279 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1095165290 12:38965061-38965083 AAGAGTCAATATAATGAAAATGG - Intergenic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095362499 12:41360001-41360023 AAGAGGCAGCTGAAGTAGAAAGG - Intronic
1095906347 12:47382122-47382144 GAGAGTCAACAAATGTAGAAAGG - Intergenic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1096745183 12:53722185-53722207 TACAGGCAGCAGAAGGAGAAGGG + Intronic
1096896278 12:54823232-54823254 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1096907822 12:54951470-54951492 AAGAATCAATAGAATGGGAAAGG - Intronic
1097309978 12:58108548-58108570 TGGAGTCAAGAGAAGGAGAAAGG - Intergenic
1097533183 12:60831636-60831658 AACATTCAACAGTAGTAGAATGG + Intergenic
1097558648 12:61172664-61172686 AACAGTAAACACAAGAAGAAAGG - Intergenic
1098770660 12:74548680-74548702 AAGAATCAAGAAGAGGAGAAAGG + Intergenic
1098958292 12:76710580-76710602 AAGAGGCAGGAAAAGGAGAATGG + Intergenic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1100165811 12:91916556-91916578 AAGAGTAAATGGCAGGAGAAGGG + Intergenic
1100263810 12:92957145-92957167 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1100538112 12:95530833-95530855 AACAGTCAACAATAGGGGAATGG + Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101074472 12:101114289-101114311 AACAGTCTACAAAAGGTGAAAGG + Intronic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1101710215 12:107257769-107257791 AAAAGTCAACACAGTGAGAAAGG - Intergenic
1101898739 12:108775266-108775288 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1104222282 12:126796594-126796616 AAGAGTCCTTACAAGGAGAAAGG - Intergenic
1104255813 12:127137019-127137041 AAAAGTAAAGAGATGGAGAAAGG - Intergenic
1104303957 12:127592603-127592625 AATAGGCAAAAGAAGAAGAAAGG + Intergenic
1107159712 13:37211571-37211593 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1107424197 13:40276399-40276421 AACAGGCAACAGAAGGAGCCCGG + Intergenic
1108055067 13:46477456-46477478 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1108100328 13:46947500-46947522 AAGAGTTATGGGAAGGAGAAAGG + Intergenic
1108686009 13:52819065-52819087 AAGAAAGAAAAGAAGGAGAAGGG - Intergenic
1108795126 13:54021584-54021606 AAAAGTCAACAGAATGATAAGGG - Intergenic
1109612613 13:64786666-64786688 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1109709975 13:66146700-66146722 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1110413798 13:75230654-75230676 AAGAGATACCAGAAAGAGAAAGG + Intergenic
1110880766 13:80569513-80569535 TATGGGCAACAGAAGGAGAAAGG - Intergenic
1110896905 13:80764510-80764532 AACAGTCTACAGAAAGACAAGGG - Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111112613 13:83734102-83734124 AAGAGTCAATAGAGGAAAAAAGG + Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111577563 13:90176180-90176202 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111898159 13:94167589-94167611 AAGAGTGTATGGAAGGAGAAGGG + Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112286099 13:98105725-98105747 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1113014766 13:105816455-105816477 AAGCGTCAAGAGAAGAAGATGGG + Intergenic
1113347098 13:109489661-109489683 AAGAGCCAATAGACAGAGAAAGG - Intergenic
1113402972 13:110011880-110011902 AAGAGTGAAGGGGAGGAGAAGGG - Intergenic
1114409460 14:22487013-22487035 ACAAGTCACCACAAGGAGAAAGG - Intergenic
1114497381 14:23142422-23142444 AAGATTCAACAGAAGATGCAGGG + Intronic
1114607717 14:24011339-24011361 AAGAGAAATCAGAAAGAGAAAGG - Intergenic
1116113874 14:40623259-40623281 AGGAGTAAACTCAAGGAGAAAGG - Intergenic
1116192377 14:41677105-41677127 AAAAGTAAAAACAAGGAGAAAGG + Intronic
1116349285 14:43838868-43838890 AAGCGACTTCAGAAGGAGAATGG - Intergenic
1116441621 14:44961529-44961551 AGAAGTCGACAAAAGGAGAAGGG + Intronic
1116442755 14:44972720-44972742 AAAAGTAAAGAGATGGAGAAAGG - Intronic
1116690989 14:48105551-48105573 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116912081 14:50479209-50479231 AAGGGACAACAGAAGAAAAAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118936699 14:70295362-70295384 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1119093017 14:71801856-71801878 AGGAGTAAAAGGAAGGAGAAAGG + Intergenic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1119193768 14:72702247-72702269 AGGAGGCACCAGCAGGAGAACGG + Intronic
1119247868 14:73128546-73128568 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1119405187 14:74394489-74394511 AAGAGTGATCAAAAGAAGAATGG - Intergenic
1119613190 14:76081007-76081029 AAAATTCAACAGAAAGAGACAGG - Intronic
1120463003 14:84820883-84820905 AACATCCAACAGAAGGAGCAAGG - Intergenic
1120905143 14:89613767-89613789 AGGAGTCTATAGAAGTAGAAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122041510 14:98990962-98990984 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122529013 14:102411625-102411647 GAGAGTCAGCAGAGGGAGATAGG - Intronic
1123153983 14:106207022-106207044 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1123509548 15:20982949-20982971 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1123566770 15:21556688-21556710 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1123603031 15:21993981-21994003 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125089764 15:35776608-35776630 AAGGCCCAAAAGAAGGAGAATGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126051978 15:44694480-44694502 AAGAGGCAAAAGAAAGAGAAAGG - Intronic
1126052140 15:44695660-44695682 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1126200445 15:45979454-45979476 AAGAGTCCACTGAAGGTGGAGGG - Intergenic
1126268115 15:46778890-46778912 AATAGACAAAAGAAAGAGAAAGG + Intergenic
1126318713 15:47398677-47398699 AAGGCTCAAAAGTAGGAGAAAGG + Intronic
1126821607 15:52509868-52509890 AAGAGATTAGAGAAGGAGAATGG - Intronic
1126832913 15:52627212-52627234 AAGAGGGAAGGGAAGGAGAAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127159550 15:56166989-56167011 GAGAGTCAACCAAAGGAGGATGG - Intronic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1129259161 15:74354423-74354445 AAGAGTCAGCAAAAGGAGATAGG - Intronic
1129568322 15:76649120-76649142 AATAGACAAAAGAAAGAGAAAGG - Intronic
1130057112 15:80536181-80536203 AACAGGCAAAAGAAAGAGAAAGG + Intronic
1130304271 15:82702658-82702680 AAGAGTCAACGAAAGGAGATAGG - Intronic
1131532149 15:93202954-93202976 AAGAGCCATCAGAAGGTCAAAGG - Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1202975131 15_KI270727v1_random:283783-283805 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1132984778 16:2759611-2759633 CAGAGTCAGCAGAAGTTGAACGG - Exonic
1133774296 16:8885443-8885465 AGGAGTCAAAAGAGGGTGAACGG - Intergenic
1133850046 16:9494855-9494877 AAGAGACAAAAGAAGGAGAGTGG + Intergenic
1134002280 16:10792176-10792198 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1134567239 16:15262243-15262265 AATAGGCAAAAGAATGAGAAAGG + Intergenic
1134735253 16:16494457-16494479 AATAGGCAAAAGAATGAGAAAGG - Intergenic
1134932268 16:18217760-18217782 AATAGGCAAAAGAATGAGAAAGG + Intergenic
1135175231 16:20221928-20221950 AAAAGTCAGAGGAAGGAGAAGGG - Intergenic
1135175238 16:20221958-20221980 AAGAGGCAGGAGCAGGAGAAGGG - Intergenic
1135494789 16:22941959-22941981 AAGAGTCAACAGACAAAGTATGG - Intergenic
1135683472 16:24478783-24478805 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1136271766 16:29152784-29152806 GAGAGGCCACAGAAAGAGAAAGG - Intergenic
1137449812 16:48561148-48561170 GAGAGGCAACAGAAGGTGAAAGG + Exonic
1137801283 16:51264270-51264292 AAGAGTGAACATGAGGATAATGG - Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138035143 16:53596740-53596762 AGGTGCCCACAGAAGGAGAAGGG - Intergenic
1138758489 16:59516895-59516917 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1138816060 16:60204059-60204081 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141222173 16:82081302-82081324 GAGTGACAACAGAAGGAGAGAGG - Intronic
1141412666 16:83846009-83846031 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1141636966 16:85319124-85319146 AAGAGAGAAGAGGAGGAGAAGGG - Intergenic
1142739507 17:1922853-1922875 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1143060465 17:4196226-4196248 AAGAATCAACAGCAGGGAAAGGG + Intronic
1143307978 17:5962999-5963021 AAGATTCAACAAAAGAAAAATGG - Intronic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1144010207 17:11140750-11140772 AAGAGGTACAAGAAGGAGAAAGG - Intergenic
1144554307 17:16268341-16268363 AAGTGGCAACAGAAGGGAAATGG - Intronic
1146095575 17:29927268-29927290 AAGAGGGAAAAGAAGAAGAAGGG - Intronic
1146165960 17:30588989-30589011 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1147024627 17:37569982-37570004 AATATCCAACAGGAGGAGAAAGG - Intronic
1148238713 17:45986023-45986045 GACTGTCAAGAGAAGGAGAAGGG + Intronic
1149041761 17:52198494-52198516 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1150116735 17:62557741-62557763 AAGAGTCAGATGATGGAGAAAGG - Intronic
1150566735 17:66348430-66348452 AAACGTCAACACAAGGAAAAAGG + Intronic
1150618135 17:66787936-66787958 AATAGCCACCAGAAGTAGAATGG - Intronic
1150980386 17:70134989-70135011 AAAAGGGAAAAGAAGGAGAAAGG - Exonic
1151909417 17:77072038-77072060 AAAAGAAAAAAGAAGGAGAAGGG - Intergenic
1153362372 18:4211875-4211897 AATGGTCAAAAAAAGGAGAAGGG - Intronic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155227272 18:23739568-23739590 AAGATGTAACAGAAGGAGAAGGG + Intronic
1155313878 18:24551997-24552019 GTGAGCCAGCAGAAGGAGAATGG - Intergenic
1155525927 18:26716135-26716157 CAGAGTCAAGAGATAGAGAAAGG + Intergenic
1156390646 18:36647695-36647717 AAGGGTCATCAGAAGTAGAATGG + Intronic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1157013651 18:43682627-43682649 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1157666981 18:49495508-49495530 GATAGTCAACAAAAGGAGCAAGG - Intergenic
1157918749 18:51695077-51695099 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1159536215 18:69718284-69718306 AATAGGCAACAGAAAGAGAAAGG - Intronic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159917845 18:74202115-74202137 TAGAGTCTTCAGAGGGAGAATGG + Intergenic
1160101891 18:75928549-75928571 AAGAGTCAAGAAAATGATAAAGG + Intergenic
1161878334 19:6929215-6929237 AATAGGCAAAAGAAAGAGAAAGG + Intronic
1162650838 19:12087782-12087804 AAAAATCAACAGAAAGAAAAGGG - Intergenic
1162864832 19:13537890-13537912 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1163057852 19:14734741-14734763 AATAGGCAAAAGAAAGAGAAAGG + Exonic
1163061039 19:14761957-14761979 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1163066789 19:14802895-14802917 AATAGGCAAAAGAAAGAGAAAGG + Intronic
1163899556 19:20089616-20089638 TAGAGTTAATATAAGGAGAAAGG + Intronic
1164236152 19:23336269-23336291 AATAGGCAAAAGAAAGAGAAAGG + Intronic
1164236215 19:23336872-23336894 AGGAGTTAAAAGCAGGAGAACGG - Intronic
1164258007 19:23546153-23546175 AAGAATCCACAGAAGTACAAAGG - Intronic
1164321696 19:24153864-24153886 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1164523177 19:28994453-28994475 AACAGGCAAAAGAAAGAGAAAGG - Intergenic
1164859421 19:31551163-31551185 AAGAGGGGAGAGAAGGAGAAGGG - Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
1167594330 19:50419127-50419149 AAGAGGGAACAGAACCAGAAGGG - Intronic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
1168673119 19:58256501-58256523 AAGAATCAACAGAAGCAAAATGG + Intronic
925625779 2:5841215-5841237 CAAAGTCAACAGAAGAGGAAAGG - Intergenic
925630650 2:5889591-5889613 AAAAGTGAAGTGAAGGAGAAGGG + Intergenic
925928558 2:8687777-8687799 AAGATGCAACAGAAGGACAGTGG + Intergenic
926164345 2:10510113-10510135 AAAAGACAACATTAGGAGAATGG + Intergenic
926266771 2:11330678-11330700 AAGTCTCAAAAAAAGGAGAAGGG + Intronic
927424798 2:22970285-22970307 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
927612364 2:24554401-24554423 AATAGGCAAGAGAAAGAGAAAGG + Intronic
927650124 2:24907588-24907610 AAGAGTCATCAGACAGAAAATGG + Intronic
928310327 2:30204497-30204519 AAGAGGCAACAGAAGCAAAAGGG - Intergenic
928863395 2:35887506-35887528 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930621786 2:53651687-53651709 AATAGGCAAAAGAAAGAGAAAGG - Intronic
930705272 2:54499018-54499040 ATGAGCCAACAGGAGGTGAAGGG - Intronic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
930917162 2:56706885-56706907 AAGAATCAACTAAAGCAGAAAGG - Intergenic
931084954 2:58819582-58819604 AAAATTTAACAGAAGGAGAGAGG - Intergenic
931448486 2:62347457-62347479 AACAGGCAAAAGAAAGAGAAGGG + Intergenic
931885355 2:66611232-66611254 AAGAGTCAATATAATGAAAATGG - Intergenic
932489440 2:72111126-72111148 GAGACTCAAAAGAGGGAGAAGGG - Intergenic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933242359 2:79936451-79936473 AAGAGCCAAGAGGAGGAAAAGGG - Intronic
933318484 2:80743112-80743134 AATATGCAACAGAAAGAGAAGGG - Intergenic
934777548 2:96948999-96949021 AAGTTACAACAGGAGGAGAAAGG - Intronic
934938745 2:98484176-98484198 CAGAGTCATCAGAAGGTGATGGG - Intronic
935195281 2:100810268-100810290 AAGAAGCAAAAGAAGAAGAAGGG + Intergenic
935326553 2:101942922-101942944 AAGAGGCAAGAGAACCAGAAGGG + Intergenic
935782576 2:106520904-106520926 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
935947933 2:108302945-108302967 AAGAGCCAAGAGATGGAGCACGG + Intronic
935957532 2:108392513-108392535 AAGAGACAACAGAAAGAGAAAGG + Intergenic
936644433 2:114352163-114352185 AAGAGTTCTAAGAAGGAGAATGG - Intergenic
936735708 2:115440683-115440705 AAGAATCAAAAGAAGCAAAATGG + Intronic
936801173 2:116268588-116268610 AAGAATCAAAAGAAGCAAAATGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937700789 2:124860843-124860865 GAGAGTCAACCTAATGAGAAGGG + Intronic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938139421 2:128783879-128783901 AAGAGTCAACAGAGGCTGAATGG + Intergenic
938287196 2:130128363-130128385 AAGAGTCACCCGAAGGAGCAAGG + Intronic
938428399 2:131210507-131210529 AAGAGTTACCCGAAGGAGCAAGG - Intronic
938469300 2:131544509-131544531 AAGAGTCACCCGAAGGAGCAAGG - Intergenic
938769318 2:134487077-134487099 AAGAACCAACAGAAGGATATAGG + Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939451798 2:142384004-142384026 AAGAAGGAAAAGAAGGAGAAAGG - Intergenic
939481167 2:142748716-142748738 AATAGGCAAAAGAAGGAGAAAGG + Intergenic
940530637 2:154872633-154872655 TAGAGTTAATATAAGGAGAAAGG - Intergenic
941284326 2:163590711-163590733 AACAGTGAAAAGAATGAGAAAGG - Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
942423725 2:175837064-175837086 AAGAGTAATCAAAAGAAGAATGG + Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943412347 2:187559867-187559889 TAGAGTTAATATAAGGAGAAAGG + Intronic
943951599 2:194136238-194136260 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
944520382 2:200560079-200560101 AACAGACAACAGAAGCAGGAAGG - Intronic
944690376 2:202153375-202153397 AAGAGTCAGAAGAAGGGGAGAGG + Intronic
945911539 2:215655417-215655439 AAGATTGAACTGAAGGAGATTGG - Intergenic
946012567 2:216577988-216578010 AAGAGTTAACAGTAGGGAAAAGG + Intronic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
947089532 2:226494825-226494847 AACAGTCAACACAAGGACACTGG - Intergenic
947572029 2:231243626-231243648 ATGATTCAGTAGAAGGAGAATGG - Intronic
948338724 2:237231992-237232014 AGAAGTCAACAGATGGAGGAAGG + Intergenic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1169271734 20:4205261-4205283 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1169816330 20:9660733-9660755 AAGAGTCAACAGCAAGTGCAAGG + Intronic
1170031355 20:11947551-11947573 AAGAGTGGACAGAGTGAGAAAGG - Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1170646538 20:18201375-18201397 AAGCAACAAGAGAAGGAGAAAGG - Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171083819 20:22217285-22217307 AACAGTCTCCAGATGGAGAATGG + Intergenic
1171198573 20:23223120-23223142 AAGAGTCACCAGATGGACCATGG + Intergenic
1172489427 20:35323177-35323199 ATGACTCATCAGAAGCAGAAAGG - Intronic
1172707481 20:36892683-36892705 AATAGACTACTGAAGGAGAAAGG + Exonic
1172947384 20:38699998-38700020 AAGAGAGAAAAAAAGGAGAAAGG + Intergenic
1173240992 20:41297142-41297164 TTGAATCAACACAAGGAGAATGG + Intronic
1173736456 20:45364871-45364893 AAGAATTAAAAGAAGAAGAATGG + Intronic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174740377 20:53007419-53007441 AAGAGTTAACAAGAGGAGTATGG + Intronic
1176219261 20:63962295-63962317 AAGAATGAAGTGAAGGAGAAAGG - Exonic
1176666834 21:9695560-9695582 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1178350561 21:31870527-31870549 AAGAGACAACAGAGGGAGATGGG + Intergenic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1178825621 21:36014079-36014101 AAGAGAGAAATGAAGGAGAAGGG + Intergenic
1179416866 21:41205575-41205597 AAGACACAACAGAAGTAGGAAGG - Intronic
1179497608 21:41783448-41783470 AAGAGTAAACAGAGGAGGAAAGG - Intergenic
1181507202 22:23367617-23367639 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1181777117 22:25167834-25167856 AAAAGGCAAGAGAAAGAGAATGG + Intronic
1183535045 22:38396634-38396656 AAGAGTCAGCAAAGGGAGATGGG + Intronic
1184419519 22:44371536-44371558 AAGAGTCTTCAGAGGGAGCACGG + Intergenic
1184911638 22:47539234-47539256 AAGAGTTAACAGAAGTGGAGTGG + Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
949220926 3:1632978-1633000 AATAGGCAGAAGAAGGAGAAAGG - Intergenic
949850966 3:8419907-8419929 GAGAGTCAAAATAAGGTGAATGG - Intergenic
950325112 3:12100391-12100413 AAGAGTCAACAAAAGGTGCTGGG + Intronic
950895623 3:16447967-16447989 AAGAGAGAAAAGAAGGAGAGAGG - Intronic
951076712 3:18402267-18402289 AAGATTCATCAGATGGGGAAAGG + Intronic
951154777 3:19337771-19337793 AAGAGACAACAGAAGTTGATAGG - Intronic
951274215 3:20665448-20665470 AAGAAGGAACAGAAGAAGAATGG - Intergenic
951299129 3:20972915-20972937 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
951742902 3:25944001-25944023 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
952086501 3:29828248-29828270 AAGAGCCACCAGACGGAGAGAGG - Intronic
952127696 3:30321128-30321150 AAGAGGCAATGGAAGGAAAATGG + Intergenic
952343043 3:32461030-32461052 AAGAGTCAGCAAAGGGAGATAGG + Intronic
952574302 3:34756131-34756153 AAGAATGAACATTAGGAGAATGG - Intergenic
952659999 3:35834008-35834030 AAAAGGCCACAGAAGGAAAAGGG + Intergenic
952877881 3:37962436-37962458 AAGAGAGAAAAGATGGAGAAGGG - Intronic
953199074 3:40761590-40761612 AAGAGGAAACACAAGAAGAAAGG + Intergenic
953213419 3:40896669-40896691 TAGAGTCGAGAGAAAGAGAATGG + Intergenic
953501796 3:43443608-43443630 AAGAGTCAAAACAATGAGAGAGG + Intronic
953840665 3:46387781-46387803 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
953946820 3:47156480-47156502 ATGTGTCAATAAAAGGAGAATGG + Intronic
954289345 3:49641244-49641266 AGGAGTCAACGAAAGGAGAAAGG - Intronic
954771318 3:52971922-52971944 AAGACTGAACAGGAAGAGAAGGG + Intronic
955150280 3:56360355-56360377 CAGAGTCTAGAGAAGTAGAAGGG - Intronic
955418411 3:58714190-58714212 CTGAGTCAACAGGCGGAGAAGGG - Intergenic
955445518 3:59006263-59006285 AAAAGCCATCAGAAGGAGATGGG + Intronic
955568637 3:60277755-60277777 AATAGGCAAAAGAAAGAGAAAGG - Intronic
956781986 3:72610987-72611009 AGGAGGCAAGAGCAGGAGAAAGG + Intergenic
957316340 3:78581307-78581329 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957317649 3:78588567-78588589 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957478523 3:80758923-80758945 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
957942808 3:87026462-87026484 AGGATTCAACAGAATGGGAATGG - Intergenic
958183337 3:90086613-90086635 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
958486221 3:94713382-94713404 AATACACAACAGAAGAAGAATGG - Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959555298 3:107710486-107710508 ATCATTCAGCAGAAGGAGAAGGG + Exonic
959615971 3:108347638-108347660 AGGAGACAACAGTAGGAAAAGGG + Intronic
960396062 3:117138893-117138915 AAGAGTACTCAGAAGTAGAAAGG + Intronic
960701617 3:120444942-120444964 CATAGTCAACCGTAGGAGAAGGG - Intronic
962050340 3:131806991-131807013 AAGAGATAAGAGAAAGAGAAAGG + Intronic
962384389 3:134921143-134921165 AACAGTGAGCAAAAGGAGAAGGG - Intronic
962400094 3:135050964-135050986 AATAGACAAAAGAAAGAGAAAGG + Intronic
963059017 3:141209818-141209840 TAGAGTTAATATAAGGAGAAAGG - Intergenic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963320386 3:143803979-143804001 TAGAGTTAATATAAGGAGAAAGG - Intronic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963893196 3:150658679-150658701 AATAGGCAAAAGAAAGAGAAGGG - Intergenic
963917831 3:150876138-150876160 ATGAGTGAACTTAAGGAGAAAGG - Intronic
964300764 3:155282873-155282895 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
964485668 3:157183148-157183170 AGAAGTGACCAGAAGGAGAAGGG - Intergenic
964830347 3:160877600-160877622 AATAGGCAAAAGAAAGAGAAAGG + Intronic
965019712 3:163213250-163213272 AAGAGCCAGCATAAAGAGAATGG + Intergenic
965168379 3:165226730-165226752 GAGAGTCAAAGGAAGGAAAATGG - Intergenic
965286301 3:166824490-166824512 TAGAGTTAATATAAGGAGAAAGG + Intergenic
965532714 3:169790639-169790661 AGCAGTCAACAGGAGTAGAATGG + Intergenic
966067445 3:175834270-175834292 TAGAGTTAATATAAGGAGAAAGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967041506 3:185697663-185697685 AAAAGGCAACAAAAGTAGAAAGG - Intronic
967205105 3:187112484-187112506 AAGAGAAAAGAGAAAGAGAAAGG - Intergenic
967962733 3:194938928-194938950 AAGAGGCAAGAGAAGCTGAAGGG + Intergenic
970266515 4:14293936-14293958 AAGAGACAAGAGAAAGAAAATGG - Intergenic
970641837 4:18075425-18075447 CAGAGACAACAGAAAGTGAAGGG + Intergenic
971112695 4:23606709-23606731 AAGGGTCAATAGACTGAGAAAGG - Intergenic
971267506 4:25108333-25108355 AAGAGTCAACAGATGGTTCATGG - Intergenic
971620150 4:28845388-28845410 AGGACTCAACAGATGCAGAATGG - Intergenic
972047227 4:34681678-34681700 AAGAGGCAATAAAAGAAGAAAGG - Intergenic
972291157 4:37691248-37691270 AACAGTCGACAAAAGGAGAATGG + Intergenic
972557821 4:40198233-40198255 AAGTGTCGGTAGAAGGAGAAGGG + Intronic
973627913 4:52791147-52791169 AAGAGTCCAGAGGAGGACAAAGG - Intergenic
973791346 4:54380813-54380835 AAGAGGGAACAGAAAGAGAGAGG - Intergenic
974331868 4:60489858-60489880 AAGGTTCATCAGGAGGAGAAAGG + Intergenic
975572558 4:75832752-75832774 AAGAGCCACCAGAAGCAGAAAGG + Intergenic
976637266 4:87299294-87299316 AAGAGCCATCAGAAGGAAAGAGG + Intergenic
976834690 4:89357805-89357827 GAGAGTGAACTGATGGAGAAAGG - Intergenic
976965388 4:91033424-91033446 AGGAGGCAACAGCAGGAGACTGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977042192 4:92029190-92029212 TAGAGTTAATATAAGGAGAAAGG - Intergenic
977128237 4:93198442-93198464 AGGAGGCAACATAAGGACAAAGG + Intronic
977156784 4:93583760-93583782 AAGTGAGAACTGAAGGAGAATGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977790082 4:101089262-101089284 AAGAGGCATCAGGAAGAGAAGGG + Intronic
978746335 4:112198526-112198548 AAGAGGCAACAGAAAGTGCATGG - Intergenic
979754553 4:124324850-124324872 AAGAGTCTGCAGAGGGACAAAGG + Intergenic
979990074 4:127364885-127364907 AACAGGCAAAAGAAAGAGAAAGG - Intergenic
980693509 4:136327680-136327702 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
980735108 4:136875270-136875292 AAGAGTATACAATAGGAGAAGGG - Intergenic
981239506 4:142459433-142459455 AAGAGTGAAACGAAGAAGAAAGG + Intronic
981337723 4:143585836-143585858 AGGAGTCAGCAGAAGGTGAGAGG - Exonic
981372812 4:143979420-143979442 GAGACTCACCGGAAGGAGAAAGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
981980188 4:150782441-150782463 TGGAGTCTCCAGAAGGAGAATGG - Intronic
982096908 4:151931595-151931617 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982671709 4:158327896-158327918 AATAGGCAAAAGAAAGAGAAAGG - Intronic
982725814 4:158904586-158904608 AATTCTCAACTGAAGGAGAAAGG + Exonic
982791362 4:159595300-159595322 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
982860882 4:160447554-160447576 AAGAGTCCAAAGAAGCAGTATGG - Intergenic
983706188 4:170662540-170662562 AACAGTCAAAAGAAAGAAAAAGG - Intergenic
985345612 4:189001665-189001687 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
985482689 5:126786-126808 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
985698089 5:1353212-1353234 GAAAGTCACCAGAAGGAGAGTGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
986083846 5:4422758-4422780 GGAAGTCAACAAAAGGAGAATGG - Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
986979111 5:13426443-13426465 AAGTGTCAACAGAGTGAAAAGGG - Intergenic
987075664 5:14379845-14379867 GACAGTGAACAGAAGCAGAACGG - Intronic
987166825 5:15207424-15207446 ACAAGTCAACATAAAGAGAATGG + Intergenic
987628084 5:20429244-20429266 AGGATTCAACTGAAGGAGATGGG + Intronic
987736167 5:21846328-21846350 AATAGGCAAAAGAAAGAGAAAGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
991106172 5:62844268-62844290 AAAAGACAAAAGAAAGAGAAAGG - Intergenic
991186755 5:63817659-63817681 AAGAGTCAGGTGAAGGAGAATGG - Intergenic
991633012 5:68675530-68675552 AAGAGTGAACAAATGGGGAAGGG - Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
992332934 5:75736330-75736352 AGAAGTGAACAAAAGGAGAAAGG + Intergenic
992960501 5:81953546-81953568 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993966358 5:94365229-94365251 AATAGGCAAAAGAAAGAGAAAGG - Intronic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994324380 5:98432404-98432426 AAAGGTCAAAAGAAGGGGAAAGG + Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995692111 5:114838865-114838887 AATAGTCACCAAATGGAGAATGG - Intergenic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
996111534 5:119571622-119571644 AGGATTAAACAGAAGGTGAAGGG - Intronic
996118101 5:119641102-119641124 GAGAGACAACTGCAGGAGAAAGG - Intergenic
996923594 5:128797279-128797301 AAGAGAAAAAAGAAGAAGAAAGG - Intronic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997497473 5:134342001-134342023 AATAGGCAAAAGAAAGAGAAAGG - Intronic
997499964 5:134365795-134365817 AAGAGACTAAAGAAGGACAAAGG - Intronic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998187448 5:139992446-139992468 GAGAGACAAAAGAATGAGAAGGG - Intronic
998444698 5:142189570-142189592 AAAAGCCATCAGTAGGAGAATGG - Intergenic
998614828 5:143728397-143728419 AAGGGCCAACAGAAAGAGAAAGG - Intergenic
998620279 5:143786976-143786998 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
998990392 5:147808959-147808981 AAGAGTGAATGGAAGGTGAAGGG - Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
999883840 5:155898101-155898123 AAAAGACAGCAAAAGGAGAAAGG - Intronic
1000075513 5:157781423-157781445 AAAGGTCAACAGCAGGAGATGGG - Intergenic
1000108037 5:158079416-158079438 AAGAGTCGTCACAAGGAGATAGG - Intergenic
1000262687 5:159603078-159603100 AACAGTAAGCAGAAAGAGAAGGG - Intergenic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000879070 5:166676359-166676381 ATGAATCAACAGAAGATGAATGG - Intergenic
1000885615 5:166744344-166744366 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1001126571 5:169024796-169024818 AAGAGACAAAATAAGGAAAAAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001275393 5:170347068-170347090 TGGAGGCAACAGAGGGAGAAAGG + Intergenic
1001554968 5:172630960-172630982 AAGAGGCCACAAAAGGGGAATGG + Intergenic
1002144163 5:177165563-177165585 AAGAGCCTACAGAAACAGAATGG - Intronic
1003233330 6:4274181-4274203 AAGAGTCAGCAGCAGGTAAAAGG + Intergenic
1003297494 6:4844934-4844956 AAGATTCAAAAGAATGAAAAAGG - Intronic
1003434943 6:6079435-6079457 TAGCGTCAACTGAAGAAGAAGGG + Intergenic
1003601965 6:7525996-7526018 AAGATTCATGAGGAGGAGAATGG + Intergenic
1003794187 6:9581614-9581636 TAGAGCCTACAGAAGGAGAGGGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004649185 6:17592135-17592157 AAGAATCAAAAGAATGAGAGAGG + Intergenic
1004852190 6:19711582-19711604 AACATTGAGCAGAAGGAGAATGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005136258 6:22571519-22571541 AAGAGACAATAGATGGAGAAAGG - Exonic
1005450122 6:25963869-25963891 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1005458823 6:26047995-26048017 AAGAAATACCAGAAGGAGAAAGG + Intergenic
1005770980 6:29071016-29071038 AATATTCAGCAGAAGGAAAATGG - Intronic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1005938319 6:30541968-30541990 AAGGATCAAGTGAAGGAGAAAGG - Exonic
1005986036 6:30875675-30875697 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006604742 6:35248154-35248176 AAGAGTCTACGGAGGGACAAAGG + Intronic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007590670 6:43018880-43018902 AAGATTGAACCGAAGGGGAAGGG + Exonic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008247878 6:49201596-49201618 AAGAGTAAAGGGAAGGTGAAAGG - Intergenic
1008259386 6:49346277-49346299 AGGAGACAGCAGAAGGATAAAGG + Intergenic
1008432034 6:51429651-51429673 AAGAGTCCACAGGTGGAGGAGGG - Intergenic
1008651012 6:53562796-53562818 AAGAGACAATAGTAGGAGGAAGG - Intronic
1009343823 6:62589827-62589849 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1009463912 6:63948600-63948622 AAGAGAGAAAGGAAGGAGAAAGG - Intronic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009773984 6:68180928-68180950 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1009885746 6:69622146-69622168 AACAGGCAAAAGAAAGAGAAAGG + Intergenic
1010402055 6:75457129-75457151 AAGACTCAACATAAGGATGAGGG - Intronic
1010586102 6:77659936-77659958 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1010627187 6:78152798-78152820 AACAGGCAAAAGAAAGAGAATGG - Intergenic
1011097201 6:83679477-83679499 AAAAGTCGACAGCAGCAGAAAGG + Intronic
1011581485 6:88871707-88871729 GAGAGTCAACAAATGCAGAAAGG + Intronic
1012021092 6:93920508-93920530 AACAGGGAAGAGAAGGAGAAAGG - Intergenic
1012319285 6:97822942-97822964 AAGAAAGAAAAGAAGGAGAAAGG + Intergenic
1012460894 6:99458785-99458807 CAGAGGCTACAGGAGGAGAATGG + Intronic
1012564058 6:100623492-100623514 ATGAGTCATGAGAAGTAGAAGGG + Intronic
1012576519 6:100807531-100807553 AAATGTCACCAGAATGAGAAAGG - Intronic
1013640894 6:112079384-112079406 AAGAGTCAACAGAACTATACTGG - Intronic
1014291836 6:119567094-119567116 AATAGTCAAAAGAAAGAGAAAGG - Intergenic
1015421701 6:133018016-133018038 AAGAGTCAACACAAAGGAAAAGG + Intergenic
1015720296 6:136234657-136234679 AAGAGTCTGAAGCAGGAGAATGG + Intronic
1015896783 6:138025485-138025507 AGGAGTCAAGAGAGGCAGAAAGG + Intergenic
1015944482 6:138486148-138486170 AGGAGTCAGCAGGAGGGGAAAGG - Intronic
1016200540 6:141402228-141402250 AAGAATCAAAAGAAAGAGATTGG + Intergenic
1016652759 6:146482090-146482112 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1016831369 6:148436572-148436594 AAGAGTAAGCATATGGAGAAAGG - Intronic
1017034314 6:150253200-150253222 AAGAGTCAAAGGAAGTAGATAGG - Intergenic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017562736 6:155647656-155647678 AACATTAAACAGAATGAGAAAGG + Intergenic
1017587035 6:155937809-155937831 AAGAGCCAAAAGAAGGAGTGGGG + Intergenic
1017627129 6:156359922-156359944 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1017848544 6:158281831-158281853 AAGAGTCATCAGATGGTGGAAGG - Intronic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1018473467 6:164117497-164117519 AAGAGAGAACAAAAGGAAAATGG - Intergenic
1020364539 7:7366749-7366771 AAGAGACAACAAAAGGGAAATGG + Intronic
1020473984 7:8573446-8573468 AAGAGTCAACAGATAGAGACAGG + Intronic
1021820981 7:24497282-24497304 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1022373376 7:29790587-29790609 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024572975 7:50739830-50739852 AAGAGGGAATAGAAAGAGAAAGG - Intronic
1024688136 7:51770423-51770445 AACAGTGAACAGGAGCAGAAAGG - Intergenic
1024752071 7:52478323-52478345 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1025153741 7:56584620-56584642 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1025763552 7:64418239-64418261 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1026222440 7:68412159-68412181 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1026274210 7:68862751-68862773 AACAGGCAAAAGAAAGAGAAGGG + Intergenic
1026517583 7:71086320-71086342 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1026594168 7:71720299-71720321 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1026618957 7:71933436-71933458 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1026624906 7:71983190-71983212 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1026834063 7:73626549-73626571 AAGAGGCTTCAGAAGCAGAAAGG - Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027366111 7:77460112-77460134 AAGAGGCCACAGTAGGAGAATGG + Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1027775233 7:82456595-82456617 GAGAGTTAAAAGAAGAAGAAGGG - Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028217267 7:88149432-88149454 AAGAGTCAAGAGAAAGAAAAGGG - Intronic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1028469341 7:91187638-91187660 AATAGGCAAAAGAAAGAGAAAGG + Intronic
1028965216 7:96794534-96794556 AAGAGCTAAGAAAAGGAGAAGGG - Intergenic
1030782350 7:113617178-113617200 AATAGGTAAAAGAAGGAGAAAGG - Intergenic
1030874202 7:114793177-114793199 AAAAGTAAAAAGAAGAAGAAAGG + Intergenic
1031588084 7:123557004-123557026 AAGACCTAACAGAAGGAAAAGGG + Intronic
1032046464 7:128613582-128613604 AAGAGTCAGATGATGGAGAAAGG - Intergenic
1032915339 7:136483203-136483225 AAGGGTCACAAGAAAGAGAAGGG - Intergenic
1033451818 7:141468749-141468771 AATAGACAAAAGAAAGAGAAAGG + Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033977240 7:147116882-147116904 AAGAGTCCAGACAAGGAGGAAGG - Intronic
1034864092 7:154625778-154625800 AAGAGGCAACAGAGGGGGAAAGG - Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1035157044 7:156922838-156922860 AACATTTAACAGCAGGAGAAAGG + Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035531924 8:359464-359486 AAGATTAAACACAAGGATAACGG - Intergenic
1036156722 8:6348901-6348923 TAGTTTCAACAGTAGGAGAAAGG + Intergenic
1036483485 8:9158834-9158856 AAGAATTAACAGAAAGAAAATGG - Intronic
1036571623 8:9984824-9984846 AAGACTCAACACAAGGAGCCAGG + Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1038370104 8:26980386-26980408 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1038403947 8:27308032-27308054 AAGTGACAACAGATGCAGAACGG + Intronic
1038473145 8:27842418-27842440 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1038484889 8:27927617-27927639 AGGATTCAACAGTAAGAGAATGG - Intronic
1038983680 8:32786086-32786108 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1039547761 8:38421946-38421968 AAGAGACAACGGAAGCAAAATGG + Intronic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040664803 8:49619614-49619636 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1040782630 8:51128554-51128576 AATAGACAAAAGAAAGAGAAAGG + Intergenic
1040957665 8:52995966-52995988 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041597784 8:59677207-59677229 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1042071225 8:64937117-64937139 CAGAGTCAAGGGAAAGAGAAAGG + Intergenic
1042397619 8:68310683-68310705 AATAGGCAAAAGAAAGAGAATGG + Intronic
1042511328 8:69615205-69615227 AATAGTCAAAATAATGAGAAGGG - Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043467510 8:80526945-80526967 AAGAGTCCACAGAATGAAACGGG - Intergenic
1043609684 8:82046576-82046598 CAGATTCAAAAGAATGAGAAAGG + Intergenic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1044301662 8:90591405-90591427 AATAGGCAAAAGAAAGAGAAAGG - Intergenic
1044359119 8:91260647-91260669 AGGAGCCACCAGAAGGAGCATGG - Intronic
1044403946 8:91805159-91805181 CAGAGACAACATACGGAGAAGGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1044945278 8:97383535-97383557 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045697892 8:104831275-104831297 ACGAGGAAACAGAAGGAAAAGGG + Intronic
1045794780 8:106029945-106029967 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1046420990 8:113982019-113982041 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1046789702 8:118307866-118307888 AAGACTGGAAAGAAGGAGAAAGG + Intronic
1047342366 8:123994428-123994450 AAGAGTCCAGAGAAGGAGTGGGG + Intronic
1047685256 8:127298767-127298789 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1048052042 8:130827606-130827628 AATAGACAAAAGAAAGAGAAAGG - Intronic
1048052419 8:130830546-130830568 AATAGGCAAAAGAAAGAGAAAGG - Intronic
1048159270 8:131997806-131997828 AATAGTTAACAAAAGGAGAAAGG - Intronic
1048250154 8:132858922-132858944 AAGAGCCAGCAGAAGAAGTATGG + Intergenic
1048388182 8:133933293-133933315 AAGAGTAAACATCAGGATAAAGG + Intergenic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1048799341 8:138181757-138181779 AAGAGTCATCAGAAGCAATATGG - Intronic
1049298365 8:141855781-141855803 AGGAGCCAACAGCAGGAGGAGGG + Intergenic
1050118141 9:2281409-2281431 GAGAGTCAACAAAGGGAGATAGG - Intergenic
1051310333 9:15764120-15764142 CAGAGTCAATAGTGGGAGAAAGG + Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052234983 9:26201221-26201243 AGGATTCATCAGTAGGAGAATGG + Intergenic
1052313113 9:27090067-27090089 GAGAGCCAACAGAGGGACAAAGG + Intergenic
1052552263 9:29967272-29967294 AAAAGTCAGAAGAGGGAGAAGGG - Intergenic
1052653922 9:31332718-31332740 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1053386980 9:37700047-37700069 AAAGGTCAACAGAATTAGAAAGG - Intronic
1053416847 9:37952143-37952165 AAGAGTCAACAGAGAGATACAGG + Intronic
1053436257 9:38076517-38076539 AAGCTTCCACAGAAGGAAAAGGG - Intergenic
1054807772 9:69410001-69410023 AAGAGTCAGCGAAAGGAGATGGG + Intergenic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056315117 9:85380761-85380783 AAGAGGCAAAAGTAGGAGAAAGG - Intergenic
1056324480 9:85464966-85464988 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1056363170 9:85879325-85879347 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1056391618 9:86146397-86146419 AGGAGTCAGCAAAAGGAGATGGG - Intergenic
1056621885 9:88221528-88221550 AAGAGTGAAAAGAATGGGAAGGG - Intergenic
1057408386 9:94794219-94794241 GAGAGCCAAAAGAGGGAGAAGGG + Intronic
1057521664 9:95765194-95765216 AAAACTCATCAGAAGGAGACAGG - Intergenic
1057856522 9:98605147-98605169 AGGCCTCAACAGAAGGAGAGGGG - Intronic
1059518668 9:114919427-114919449 AGGAGTTAACAGAAGCAGAGAGG + Intronic
1059984524 9:119809144-119809166 AAGGCTGAACAGCAGGAGAAAGG - Intergenic
1060214777 9:121732129-121732151 AAGAGGCAACGGAAAGAGGACGG - Intronic
1061103330 9:128509609-128509631 AATAGGCAAGAGAAAGAGAAAGG - Intronic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1203659263 Un_KI270753v1:26201-26223 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1185889181 X:3809251-3809273 AAGAGTCAGCAAAGGGAGACAGG - Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186243460 X:7594346-7594368 AAGTGCCTACAGAAGGAAAAAGG + Intergenic
1186265162 X:7824687-7824709 GCAAGTCAACAGAAGGAAAAAGG - Intergenic
1186573837 X:10744453-10744475 GAGCCTCAACAAAAGGAGAAAGG + Intronic
1186703345 X:12115562-12115584 AAGAGCCAACAGAGGGGGCAGGG - Intergenic
1187032804 X:15505219-15505241 AGAAGTAAATAGAAGGAGAAAGG + Intronic
1188190658 X:27168142-27168164 GTGAGTCCACAGAAAGAGAATGG + Intergenic
1188248128 X:27858229-27858251 AGGAGTAAACAGAAAGACAAGGG - Intergenic
1188552373 X:31378057-31378079 AAGAGTCAGCAAAGGGAGACAGG - Intronic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188924454 X:36022565-36022587 AAGAGGCAACAGACAGAGACAGG - Intergenic
1189136117 X:38551936-38551958 AAGAGTCAGCAAAAGGAGATAGG - Intronic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1189793898 X:44629163-44629185 AGGAGTCTAAAGCAGGAGAATGG - Intergenic
1189863677 X:45300653-45300675 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1190030093 X:46963772-46963794 AAGAGTGAATAGAAGCAGCAAGG + Intronic
1190338131 X:49275322-49275344 AAGAGCCAGGAGAAAGAGAAGGG - Intronic
1191761928 X:64655661-64655683 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1193617444 X:83707378-83707400 GAAAGTCAACAGAAAGAAAATGG - Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194482040 X:94438762-94438784 AATAGGCAAAAGAAAGAGAAAGG + Intergenic
1194660363 X:96624316-96624338 AAGAGTCAGCAGAGGGAGATGGG - Intergenic
1194873217 X:99158815-99158837 GAGAGTCAACAAAGGGAGATAGG + Intergenic
1194912475 X:99663931-99663953 AAGAGTCAAAATAAGCAGCAAGG - Intergenic
1194951600 X:100133933-100133955 AAAAGTCAAGAGAAGGTAAAAGG + Intergenic
1195120061 X:101740300-101740322 GAGATTCAAAAGGAGGAGAAGGG + Intergenic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196226629 X:113176226-113176248 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1196267982 X:113675316-113675338 AGGAGTCAACAATAGGAGAGTGG + Intergenic
1196888346 X:120268419-120268441 AACAGTCATCACTAGGAGAATGG + Intronic
1196944941 X:120814457-120814479 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197649846 X:129052489-129052511 AAGAGACATTAAAAGGAGAAAGG + Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1199224141 X:145352990-145353012 AAGAGTCAATATCAGGAAAATGG + Intergenic
1199499848 X:148497595-148497617 AGAAGCCAACAGAGGGAGAAGGG + Intergenic
1199500978 X:148505065-148505087 AAGAGACCACAGAGGGAAAACGG - Intronic
1199599131 X:149531042-149531064 AAGAGACAACACAAGGTGCAAGG + Intronic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1200031141 X:153296911-153296933 AAGAAACAACACAAGGAGAGAGG + Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic
1200837170 Y:7743795-7743817 AAGAGTCTTCAGAAAGAAAAAGG - Intergenic
1200845794 Y:7831348-7831370 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1201233480 Y:11888579-11888601 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1201540456 Y:15100279-15100301 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1201937724 Y:19425731-19425753 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1202062868 Y:20905613-20905635 AAGAGTCAGCAAAGGGAGATAGG - Intergenic